ID: 920937830

View in Genome Browser
Species Human (GRCh38)
Location 1:210452241-210452263
Sequence CTATGCACAAAGGCTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 191}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920937822_920937830 27 Left 920937822 1:210452191-210452213 CCTTCTCCCTCCCATAATTCGCC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 920937830 1:210452241-210452263 CTATGCACAAAGGCTGAGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 191
920937819_920937830 30 Left 920937819 1:210452188-210452210 CCCCCTTCTCCCTCCCATAATTC 0: 1
1: 0
2: 3
3: 54
4: 821
Right 920937830 1:210452241-210452263 CTATGCACAAAGGCTGAGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 191
920937824_920937830 20 Left 920937824 1:210452198-210452220 CCTCCCATAATTCGCCTCTCCAT 0: 1
1: 0
2: 0
3: 4
4: 101
Right 920937830 1:210452241-210452263 CTATGCACAAAGGCTGAGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 191
920937820_920937830 29 Left 920937820 1:210452189-210452211 CCCCTTCTCCCTCCCATAATTCG 0: 1
1: 0
2: 1
3: 26
4: 326
Right 920937830 1:210452241-210452263 CTATGCACAAAGGCTGAGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 191
920937821_920937830 28 Left 920937821 1:210452190-210452212 CCCTTCTCCCTCCCATAATTCGC 0: 1
1: 0
2: 0
3: 12
4: 227
Right 920937830 1:210452241-210452263 CTATGCACAAAGGCTGAGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 191
920937825_920937830 17 Left 920937825 1:210452201-210452223 CCCATAATTCGCCTCTCCATTTT 0: 1
1: 0
2: 0
3: 16
4: 138
Right 920937830 1:210452241-210452263 CTATGCACAAAGGCTGAGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 191
920937823_920937830 21 Left 920937823 1:210452197-210452219 CCCTCCCATAATTCGCCTCTCCA 0: 1
1: 0
2: 0
3: 13
4: 141
Right 920937830 1:210452241-210452263 CTATGCACAAAGGCTGAGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 191
920937826_920937830 16 Left 920937826 1:210452202-210452224 CCATAATTCGCCTCTCCATTTTT 0: 1
1: 0
2: 0
3: 17
4: 240
Right 920937830 1:210452241-210452263 CTATGCACAAAGGCTGAGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 191
920937827_920937830 6 Left 920937827 1:210452212-210452234 CCTCTCCATTTTTCTATTTTTCA 0: 1
1: 1
2: 13
3: 211
4: 1992
Right 920937830 1:210452241-210452263 CTATGCACAAAGGCTGAGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 191
920937828_920937830 1 Left 920937828 1:210452217-210452239 CCATTTTTCTATTTTTCATGCTT 0: 1
1: 1
2: 22
3: 200
4: 2362
Right 920937830 1:210452241-210452263 CTATGCACAAAGGCTGAGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920937830 Original CRISPR CTATGCACAAAGGCTGAGCA AGG Intronic
901855616 1:12042595-12042617 ATCTGCAGAAAGGCTGGGCATGG - Intergenic
904313580 1:29645341-29645363 CCAAGCAGAAAGGCTGAGCTTGG - Intergenic
904623939 1:31791623-31791645 CCATGCACAGAGGCCGAGCTCGG + Intronic
906098026 1:43237166-43237188 CAATCCAAAAAGGCTGAGGAAGG + Intronic
907696818 1:56739320-56739342 CTATGCACAAAGGCAGACCCTGG - Intronic
912652453 1:111451411-111451433 CTATGGAGAAAAACTGAGCAAGG - Intronic
913215369 1:116615623-116615645 CAATGTACAAGGTCTGAGCAAGG + Intronic
914715142 1:150248351-150248373 GGATGAACAAAGGCTGGGCACGG - Intergenic
915248611 1:154572815-154572837 GTATGCAGAAAGCCTGAGGAAGG - Intronic
916006383 1:160664954-160664976 CTGAGCACAAAGGCTGCCCATGG - Intergenic
917591863 1:176484164-176484186 CTATGCACATAGGAGGAGAACGG - Intronic
917928135 1:179805929-179805951 AGATGCCCAGAGGCTGAGCAAGG - Intronic
920645494 1:207800624-207800646 CTGTGCAAAAAGCCTGATCAAGG + Intergenic
920755611 1:208728271-208728293 TCCTGCACAAAGACTGAGCATGG + Intergenic
920937830 1:210452241-210452263 CTATGCACAAAGGCTGAGCAAGG + Intronic
921052145 1:211518299-211518321 GTATGCCCAGAGGCTGAGCTTGG - Intergenic
923081728 1:230663513-230663535 CTTTGGACAAAAGCTGAGAAGGG - Intronic
1064360002 10:14655849-14655871 TTATTCACAAAGTCTGATCAGGG + Intronic
1064935588 10:20675543-20675565 CTATGTAAAAAAGCTGAGGAAGG + Intergenic
1065307869 10:24385305-24385327 AAATGCAGGAAGGCTGAGCATGG + Intronic
1066479717 10:35783891-35783913 ATTTGCACAACGGCTGATCAAGG + Intergenic
1071507953 10:86244198-86244220 CTATGCAGAAACCCTTAGCAAGG + Intronic
1071629588 10:87207320-87207342 CTATGCAGAAAGGCTATGAAAGG + Intergenic
1073136804 10:101224737-101224759 CTCGGCACAAAGGCGGCGCAGGG - Intergenic
1076192986 10:128495903-128495925 CTGTGCCCAGAGGCTGACCAAGG - Intergenic
1077116827 11:888988-889010 CTCAGCACAAAGCCTGAGCAGGG - Intronic
1077649346 11:3955820-3955842 CTATGTGGAAAGGCTGAGGAGGG + Intronic
1077921522 11:6645342-6645364 CTAAGCCCAAAGGCTGGGCTAGG + Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1085201228 11:74703487-74703509 CCATGCACACAGGCTGAATAAGG + Exonic
1086374226 11:86183998-86184020 CTATGCACAAACAGTGAGGAGGG + Intergenic
1087108101 11:94432363-94432385 CTCTACCCAAAGGCTGAGTAAGG + Intronic
1087922761 11:103885772-103885794 CTATGAACAAAGCCCGAACAAGG - Intergenic
1089670630 11:120054597-120054619 CAATGGACAATGGCTGAGGATGG - Intergenic
1093429756 12:19071262-19071284 TTATGCACAAAAGCTCAGAAGGG - Intergenic
1093494502 12:19740666-19740688 CTATCAACAAAGGCAGAGAATGG - Intergenic
1096249296 12:50017864-50017886 ATATGAACATAGGCTGGGCACGG + Intronic
1096502394 12:52072529-52072551 TAAGGCACAAAGGCTGGGCACGG - Intronic
1098097790 12:66978478-66978500 CTTAAGACAAAGGCTGAGCAGGG - Intergenic
1098522606 12:71450597-71450619 CTATGAACAGAGGCTGGGCCTGG - Intronic
1105219104 13:18309100-18309122 CAATGTACAAGGTCTGAGCAAGG + Intergenic
1107270410 13:38609509-38609531 ATTTGGACAAAGGCTGAGGAAGG + Intergenic
1108483652 13:50902231-50902253 AAATGCACAAAAGCTCAGCAAGG + Intergenic
1110170165 13:72490861-72490883 CTATGCAAAAATACTGGGCATGG - Intergenic
1110337449 13:74348106-74348128 CTATGTACAAAGACTGAACTTGG + Intergenic
1110815552 13:79856762-79856784 CCATTCACCAAGGCTGACCATGG + Intergenic
1114430518 14:22656775-22656797 CTATGAACAAAAGTAGAGCAAGG + Intergenic
1118607849 14:67516149-67516171 TCCTGCAGAAAGGCTGAGCAGGG + Intronic
1118991933 14:70804941-70804963 CTATCCACAGGGACTGAGCAGGG - Intronic
1124337524 15:28868473-28868495 CTATTTACAAAGGCGGGGCAGGG + Intergenic
1126897282 15:53272529-53272551 CTATGCAGACAGGCTCAGCAGGG - Intergenic
1127965564 15:63920362-63920384 CCATGCAGAAAGGGGGAGCAAGG - Intronic
1128591165 15:68898803-68898825 CGCTGCGAAAAGGCTGAGCATGG - Intronic
1130673422 15:85932263-85932285 CCATGAACAAGGGCTGCGCAGGG + Intergenic
1131062744 15:89414053-89414075 ACTTGCACATAGGCTGAGCATGG - Intergenic
1131712674 15:95073174-95073196 ATCTGCAGAAAGGCTGAGCTCGG - Intergenic
1131890783 15:96969516-96969538 CTGTGCACCAAGCCTGGGCAGGG + Intergenic
1134455488 16:14392190-14392212 CAAATAACAAAGGCTGAGCATGG - Intergenic
1135323166 16:21510203-21510225 CTCTGCAGAAGGCCTGAGCAGGG - Intergenic
1136334650 16:29603390-29603412 CTCTGCAGAAGGCCTGAGCAGGG - Intergenic
1138645598 16:58422076-58422098 CTATTCAGAAAGGCTGAGGTAGG + Intergenic
1141931222 16:87204850-87204872 ACATTCACAAAGGCTGGGCATGG + Intronic
1142035363 16:87859226-87859248 CTCTGCAGAAGGCCTGAGCAGGG - Intronic
1143152038 17:4813298-4813320 ATATGCAGGAAGGCTGGGCAAGG - Intronic
1143276933 17:5718611-5718633 CTATGCATGGAGGCTGAGCCTGG + Intergenic
1144225722 17:13143417-13143439 TTATGCACAAAAGCAGTGCATGG + Intergenic
1147397767 17:40158118-40158140 CTATACCCAGATGCTGAGCAGGG + Intronic
1148263646 17:46206990-46207012 AAATGGGCAAAGGCTGAGCATGG + Intronic
1148370212 17:47094051-47094073 AAATGGGCAAAGGCTGAGCACGG + Intergenic
1149503734 17:57175425-57175447 GCATGCACAAAGGATGAACATGG - Intergenic
1151758554 17:76088231-76088253 TCAGGCACAAAGGCTGAGCCAGG + Intronic
1151890505 17:76948342-76948364 CGATGCCCACAGGCTGGGCAGGG - Intronic
1151942576 17:77301865-77301887 GTCAGCACAAAGGCAGAGCAGGG + Intronic
1154289662 18:13096423-13096445 CTCTGCACAAAGCATGTGCATGG + Intronic
1156357254 18:36352485-36352507 CAATGCACAGTCGCTGAGCATGG - Intronic
1156971227 18:43159224-43159246 CTAGGCACAGAGGCTGATCTTGG + Intergenic
1159211529 18:65328209-65328231 CTGTGCACATAGGCTAGGCATGG - Intergenic
1159675367 18:71277852-71277874 TGATACACATAGGCTGAGCATGG - Intergenic
1161274064 19:3405385-3405407 CGATGGACAAGGGCTGGGCAGGG + Intronic
1161629147 19:5343108-5343130 CTGTGCACAAATGCTTAGCGTGG + Intergenic
1164089117 19:21932164-21932186 GTATGCACACAGGCAGAGTAAGG + Intergenic
1164193381 19:22931965-22931987 ATATGCACACAGGCAGAGTAAGG + Intergenic
1168463806 19:56585610-56585632 CTATGCTTCAAGGCTGGGCATGG + Intronic
925706176 2:6686173-6686195 CTGTGCCCAATGGCTCAGCAGGG - Intergenic
926653486 2:15371791-15371813 CAATGAACAGAGGCTGAGGAGGG + Intronic
928218806 2:29385284-29385306 CTATTCAGAAAGGCTGATAATGG + Intronic
930695209 2:54404573-54404595 ATAAGCAAAAAGGCAGAGCAAGG + Intergenic
931854344 2:66285982-66286004 CTAGGAAGAAAGGCTGAGCCTGG - Intergenic
934184952 2:89663413-89663435 CAATGTACAAGGTCTGAGCAAGG - Intergenic
935138866 2:100333448-100333470 GCATGCACAAAGGCAGATCATGG - Intergenic
935402703 2:102677095-102677117 CTATGGACTAATGCTTAGCATGG - Intronic
937371184 2:121298551-121298573 ATATGCACAAGGGCTGGGCGCGG - Intergenic
937462815 2:122103851-122103873 CAATGTCCCAAGGCTGAGCAGGG + Intergenic
938056918 2:128222705-128222727 AAATGCAAACAGGCTGAGCACGG - Intergenic
939090339 2:137772938-137772960 CTATGAACAAAGGCAGAACCTGG + Intergenic
940123745 2:150298439-150298461 CTATGAAAATAGGCTGAGCGTGG - Intergenic
941600294 2:167535245-167535267 GTGTGCAATAAGGCTGAGCATGG + Intergenic
945995372 2:216431932-216431954 GTATGCATAAAGGCAGAGAAAGG - Intronic
946653267 2:221917024-221917046 CTAAGAACAAAGGCACAGCAGGG + Intergenic
947781884 2:232774235-232774257 TTATTCACAAAGGCTAAGCAGGG - Intronic
947866516 2:233401628-233401650 CTGTGAACTAAGGCTGGGCATGG + Intronic
948157303 2:235793631-235793653 TGCTGCTCAAAGGCTGAGCAGGG - Intronic
948321538 2:237073655-237073677 CTATGCAAAAAGGCTGGGCGTGG + Intergenic
1169494950 20:6106427-6106449 CTGTACAGAAAGGCTGACCAAGG + Intronic
1169998213 20:11583261-11583283 AAAAGCACAGAGGCTGAGCAAGG - Intergenic
1170956648 20:20986379-20986401 CTCTGCACAAAGGCTGAGGAAGG - Intergenic
1172564326 20:35917052-35917074 CTGTAAACAAAGGCTGAGCATGG - Intronic
1173151274 20:40568314-40568336 CCCAGCACAAAGCCTGAGCAAGG + Intergenic
1173256643 20:41398464-41398486 CTAAGCACAAATGATGAGCAAGG - Intergenic
1174890189 20:54383537-54383559 CTAGGCAAAAAGGGTGAGGAAGG - Intergenic
1175553654 20:59832721-59832743 GTGTGCACCGAGGCTGAGCAGGG - Intronic
1175829740 20:61956488-61956510 CATTGAACAAAGACTGAGCAGGG + Intronic
1178772862 21:35521734-35521756 CCAGGCACTAAGGCTGAACAAGG - Intronic
1179559715 21:42207681-42207703 GTGTCAACAAAGGCTGAGCAGGG - Intronic
1179891219 21:44335979-44336001 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891235 21:44336031-44336053 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891251 21:44336083-44336105 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891267 21:44336135-44336157 CTGGGCACACTGGCTGAGCAGGG - Intronic
1180816699 22:18793956-18793978 CAATGTACAAGGTCTGAGCAAGG + Intergenic
1181202890 22:21228303-21228325 CAATGTACAAGGTCTGAGCAAGG + Intergenic
1181331185 22:22092748-22092770 CTATGCACACAGGCTGCAAAAGG + Intergenic
1182888593 22:33797303-33797325 CAATGCCCAAAGGCAGAGAAAGG - Intronic
1183140256 22:35931211-35931233 CTTTGCACAAAGGCTGAAAGTGG + Intronic
1185185929 22:49400300-49400322 CTCTGCACACAGGCTGTGCATGG + Intergenic
1203224029 22_KI270731v1_random:67123-67145 CAATGTACAAGGTCTGAGCAAGG - Intergenic
1203266798 22_KI270734v1_random:19677-19699 CAATGTACAAGGTCTGAGCAAGG + Intergenic
949543239 3:5050675-5050697 CTATCAGCAAAGGCTGAGGAAGG - Intergenic
950162854 3:10772862-10772884 CTGTGCACGGTGGCTGAGCAGGG + Intergenic
950428049 3:12935219-12935241 CAACACACACAGGCTGAGCAGGG - Intronic
954810255 3:53243057-53243079 CTATGGACAAGGGCTGAGGAAGG + Intronic
955437713 3:58920382-58920404 CTATCCACTATGGCTGGGCATGG - Intronic
955678516 3:61475242-61475264 CTATACCCCACGGCTGAGCAAGG + Intergenic
957733862 3:84180652-84180674 CAATATACAAAGGCAGAGCAAGG - Intergenic
958196390 3:90246548-90246570 GTAGCCACAAAGGCTGGGCACGG + Intergenic
958419582 3:93915174-93915196 GTAGCCACAAAGGCTGGGCACGG + Intronic
958582977 3:96050960-96050982 GTATGTCCTAAGGCTGAGCAGGG + Intergenic
959237179 3:103739608-103739630 TTATGCAGAGAGGCTGGGCATGG - Intergenic
960554793 3:119016048-119016070 CCAGGCAGAAAGGCTGAGCTAGG + Intronic
960632373 3:119744983-119745005 CTATACACAAAAGCAGAGAAAGG + Intronic
960725060 3:120661740-120661762 CTGTCCAAAAGGGCTGAGCAGGG + Intronic
961040253 3:123673401-123673423 ACATGCACTGAGGCTGAGCATGG - Intronic
961380973 3:126496372-126496394 CTATACACCAACACTGAGCAAGG + Intronic
964477908 3:157113026-157113048 CTTTCCACAGAGGCTGAACATGG - Intergenic
965592303 3:170373320-170373342 CCAGGCATAAAGGCTGGGCACGG - Intronic
970580561 4:17470867-17470889 CTTTGCCCAAAGGCTGGGCTGGG - Intronic
971501078 4:27318492-27318514 CTACCCTCAAAGGATGAGCAGGG + Intergenic
973970397 4:56207648-56207670 CTATTCATAGAGGCTAAGCAAGG + Intronic
975746430 4:77479990-77480012 CTATGCACAATGGATGAGACTGG - Intergenic
977917612 4:102611807-102611829 CTTTGCACAAACTCTGAGCTGGG - Intronic
978496165 4:109361221-109361243 CTATTCACAAAGGCTGGGCATGG - Intergenic
981871783 4:149495684-149495706 TTTTACACAAAGGCAGAGCAGGG + Intergenic
982928476 4:161370464-161370486 CAATGCACAAATCCTGAGTAAGG + Intergenic
983631234 4:169851767-169851789 CTAAGGACAATGGCTGAGAAAGG - Intergenic
984548427 4:181133305-181133327 ACATGCAAAAAGGCTGAGGAAGG - Intergenic
988166035 5:27590688-27590710 CAATGCACTCAGGCTGAGCTGGG + Intergenic
988647265 5:33108318-33108340 CAATGCTCCAAGGCTGTGCAGGG - Intergenic
989392664 5:40918246-40918268 CTACTCACAAAGGCTGAGGTGGG + Intronic
990825743 5:59895392-59895414 CTATACACAAAATCTGAGAAAGG + Intronic
990952270 5:61310251-61310273 CTATGAACACAGACTGGGCACGG + Intergenic
997426981 5:133809927-133809949 TGATGCACAAAGGCAGACCAGGG + Intergenic
999674360 5:153984010-153984032 TTATGCACACAGGCAGAACAGGG + Intergenic
1006954214 6:37852869-37852891 ATATACATAAAGGCTGGGCATGG - Intronic
1009559854 6:65225423-65225445 CAATCCACATAGGCTGGGCACGG + Intronic
1012701351 6:102460874-102460896 CTATGGACAAAAGCTCATCATGG + Intergenic
1018534410 6:164805275-164805297 CTATGCCCACATGATGAGCAGGG - Intergenic
1019558451 7:1644138-1644160 CTGTCCACACAGGCTGGGCATGG + Intergenic
1023030814 7:36089240-36089262 CAGTGCACCAAGGCTGGGCAGGG - Intergenic
1024306495 7:47933620-47933642 CCATACACGAAGGCTGATCATGG - Intronic
1025243098 7:57294384-57294406 CAATAAACAAAGGCTGATCATGG + Intergenic
1028352567 7:89867076-89867098 TTATGCAAAATGGCTGGGCATGG - Intergenic
1030377931 7:108775156-108775178 ATATCCTCAAAGGCTGGGCAAGG - Intergenic
1032114530 7:129105386-129105408 CTAGGGCCAAAGGCTTAGCAAGG - Intergenic
1033800678 7:144898304-144898326 ATATGCCAAAAGGCTGGGCATGG - Intergenic
1034214706 7:149396425-149396447 GTATAAACAAAGGCTGGGCAAGG + Intergenic
1035415711 7:158683847-158683869 CTGTTGACAAGGGCTGAGCAAGG + Intronic
1035887111 8:3303213-3303235 CTATGTACAGAGGCTGGACATGG + Intronic
1037268448 8:17096248-17096270 CTATGCATACAGGCTAAGTAAGG - Intronic
1038341751 8:26692159-26692181 GTATGCACTGAGGCTGGGCATGG - Intergenic
1038454981 8:27667155-27667177 ATGTGGACAAAGGCTGACCAAGG - Intronic
1039567700 8:38563413-38563435 CTGTTCACAAAGGCAGAGAAGGG - Intergenic
1041103728 8:54421353-54421375 CTATTCAGGAAGGCTGAGGAAGG + Intergenic
1041802114 8:61811866-61811888 CTCTCCACAAAGGGTGAGCTGGG - Intergenic
1041947534 8:63462911-63462933 CTATAAACAAAGGCTTAGCTTGG + Intergenic
1042762955 8:72290671-72290693 ATATGCAAAAAGGCTGTGTAAGG - Intergenic
1046545905 8:115649729-115649751 CTTTGCCCAAAGGCTGGACACGG - Intronic
1049308985 8:141923454-141923476 CCATGTAGAAAGGCTGAGGATGG - Intergenic
1049466717 8:142754384-142754406 CTTTGCAGAAAGGCTTAGCCTGG - Intergenic
1050295186 9:4197240-4197262 CTATGCAGAGATGCTGTGCAAGG + Intronic
1052347724 9:27427027-27427049 CCATGAGCAAAGGCAGAGCAAGG + Intronic
1053304235 9:36972735-36972757 CTATGAAAATAGGCTGGGCACGG + Intronic
1058475638 9:105329676-105329698 CTATGCACCAAGGAGAAGCAGGG - Intronic
1059063136 9:111054230-111054252 CCATGCCCAATGACTGAGCAAGG + Intergenic
1060704389 9:125784751-125784773 CAATCCACAAAGGCTGAGAAAGG - Intronic
1061485812 9:130919997-130920019 CCAGGCACTGAGGCTGAGCAGGG + Intronic
1203490622 Un_GL000224v1:101748-101770 CACTGAACAAAGACTGAGCAGGG - Intergenic
1203503245 Un_KI270741v1:43627-43649 CACTGAACAAAGACTGAGCAGGG - Intergenic
1187318495 X:18220195-18220217 CTATGCCAAAACGCTGAACAGGG + Intronic
1189437574 X:41006529-41006551 TTAGGTACAAAGGCTGGGCATGG - Intergenic
1190133844 X:47776307-47776329 CTATACACAGAGGCTAAGAAAGG + Intergenic
1194124118 X:89992538-89992560 CTTTGCACAAAGGCTTGGCTAGG - Intergenic
1195805383 X:108759556-108759578 CTATGAAAAAAAACTGAGCATGG + Intergenic
1196679688 X:118458167-118458189 CAATGCATGAAGGCTGAGCGCGG - Intergenic
1198006228 X:132497229-132497251 CAATGCACAAATGCAGAGAACGG + Intergenic
1199430698 X:147756673-147756695 GTATGCAAGAAGGCTGGGCATGG - Intergenic
1200789241 Y:7284994-7285016 ATATATACAAAAGCTGAGCATGG - Intergenic