ID: 920938682

View in Genome Browser
Species Human (GRCh38)
Location 1:210459933-210459955
Sequence CTTTCAAAGGTGTAACTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920938677_920938682 -10 Left 920938677 1:210459920-210459942 CCAGGGTTGCCATCTTTCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 920938682 1:210459933-210459955 CTTTCAAAGGTGTAACTGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 135
920938674_920938682 14 Left 920938674 1:210459896-210459918 CCTATAGTTGCAGTCAGACATCA 0: 1
1: 0
2: 0
3: 2
4: 352
Right 920938682 1:210459933-210459955 CTTTCAAAGGTGTAACTGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920938682 Original CRISPR CTTTCAAAGGTGTAACTGGG CGG Intronic
904832116 1:33312004-33312026 CTGTCAAAGCTGTGAGTGGGAGG - Intronic
908321070 1:62979426-62979448 CTTTCATATGTGGTACTGGGGGG + Intergenic
909869928 1:80726727-80726749 CTTTCAAAAGTGGAAATAGGAGG + Intergenic
912849480 1:113109760-113109782 CTTTCAGAGGTCGAAGTGGGTGG - Intronic
917698505 1:177555470-177555492 CATTCAAAGGTGCAATGGGGAGG + Intergenic
918283410 1:183027822-183027844 CTTGCAAAGGTTTTCCTGGGGGG - Intronic
918563782 1:185901375-185901397 CTTTCAAAGGTAGAAATGAGGGG + Intronic
919271910 1:195359536-195359558 ACTACAAAGGTGTAATTGGGAGG + Intergenic
920938682 1:210459933-210459955 CTTTCAAAGGTGTAACTGGGCGG + Intronic
1067554381 10:47258120-47258142 ATATCCAAGGTGTGACTGGGTGG + Intergenic
1067563276 10:47318997-47319019 CTTTCAAATGGGTAGCTAGGTGG - Intergenic
1070310056 10:75266432-75266454 CATTCAAAGGTGAAAGAGGGAGG - Intergenic
1072678400 10:97486422-97486444 CTTTCAGAGGTTGAAGTGGGCGG - Intronic
1076034350 10:127186538-127186560 GTGTCAAGGGTGGAACTGGGTGG - Intronic
1079727766 11:23897562-23897584 CTTTCATATGTCTAACAGGGTGG - Intergenic
1080725356 11:34894372-34894394 CTTTGAAATATGTATCTGGGAGG + Intronic
1083948845 11:65942594-65942616 ATTTCAAAGGTGGAGCTGGTAGG + Intergenic
1084164537 11:67369239-67369261 CTTTCAGATGTGTGACTGGCCGG + Intronic
1086580290 11:88391497-88391519 CTTGCATCAGTGTAACTGGGAGG - Intergenic
1088123385 11:106395412-106395434 CTTCCAAAGGTGTTGCTGAGTGG + Intergenic
1090755221 11:129784681-129784703 CTTTCAAATGTGTATATTGGAGG - Intergenic
1090972962 11:131658671-131658693 CTTTAAAAGGTGTAAGCGGCCGG + Intronic
1091456449 12:611700-611722 CTTCCAAAGGTGTAACCAGGAGG - Intronic
1095503040 12:42861387-42861409 GCTTCAAAGGGGTAACTGAGGGG + Intergenic
1100277360 12:93083219-93083241 CTTTGGAAGGTGTAGGTGGGTGG - Intergenic
1103974227 12:124691728-124691750 CTTTAAAAGGTGAAAGTGGGTGG - Intergenic
1106203540 13:27566539-27566561 CTTGCAAAGGTTCAACTAGGAGG - Intronic
1113380817 13:109804187-109804209 CTTTCAAAGGTGTGCATGGTGGG - Intergenic
1117183285 14:53214360-53214382 CTTTAAAAGGTATAACTGCCCGG + Intergenic
1117914040 14:60658403-60658425 ATTTCCTAGGAGTAACTGGGTGG + Intergenic
1120410027 14:84142702-84142724 CATCCAAAAGTGTGACTGGGTGG - Intergenic
1121414626 14:93770604-93770626 ATTTGATAGGAGTAACTGGGGGG - Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1126251832 15:46576378-46576400 CTTTCAAATGTGTAAATTGCAGG + Intergenic
1127146752 15:56032831-56032853 ATTTCAAAGGTTAAAATGGGCGG - Intergenic
1127170028 15:56291708-56291730 CTTTCAAAGGTAGAAGTTGGGGG - Intronic
1128634351 15:69293693-69293715 CTTGCAAAGGGAGAACTGGGGGG - Intergenic
1129190193 15:73932923-73932945 CTCTCAAAGGAGAAACAGGGAGG - Intronic
1135787861 16:25366589-25366611 CTTTTCAACCTGTAACTGGGTGG + Intergenic
1140588043 16:76317923-76317945 CTGTCAAATGGGAAACTGGGGGG + Intronic
1145375061 17:22339372-22339394 ATTTCAAGGGTGGAACTGGAAGG - Intergenic
1146535059 17:33642797-33642819 ATTTCAAAGATGCAACTAGGAGG - Intronic
1147152308 17:38524733-38524755 CTTTGGAAGGTGGAAGTGGGAGG + Intergenic
1148806363 17:50266081-50266103 CTTTCAAGTGTGGCACTGGGAGG - Intergenic
1148969135 17:51464104-51464126 CTTTTAAAGATGTAACTGGTCGG + Intergenic
1149438892 17:56658271-56658293 TTTTCAAAGATCTAACTTGGAGG + Intergenic
1153247088 18:3082721-3082743 CTGTCAAGAGTGTAAATGGGAGG + Intronic
1153674964 18:7449121-7449143 CATGCAAAAGTGTAACTGTGAGG + Intergenic
1155609428 18:27648266-27648288 CTATTAAATGTGTTACTGGGTGG + Intergenic
1155866067 18:30966375-30966397 CTCTCAGAGGTGGAACTTGGAGG + Intergenic
1158369528 18:56784139-56784161 CTTTCAGAGGAGTAAATGGGAGG + Intronic
1160359078 18:78255483-78255505 CTGTCAATGGTGGCACTGGGGGG - Intergenic
1164208436 19:23076615-23076637 CTCTCAGAGGAGCAACTGGGTGG + Intronic
1164328830 19:24231724-24231746 ATTTCTAAGGTCAAACTGGGTGG + Intergenic
1165143643 19:33718064-33718086 CTTTCAGAGGACTAACTGGGAGG - Intronic
927659227 2:24978764-24978786 CTTTCATAAGTGGAAGTGGGAGG + Intergenic
929884981 2:45870403-45870425 GTTTTAAAGGTATAACTGGGGGG + Intronic
932065427 2:68553144-68553166 CTTTCTAAAGTATCACTGGGGGG + Intronic
934705120 2:96471731-96471753 CTTTGGAAGGTGGAAGTGGGAGG - Intergenic
939289898 2:140180590-140180612 CTATGAAAGGTGAAACTGGAAGG - Intergenic
941797290 2:169613683-169613705 CTTTGAAAGGTCAAAGTGGGAGG + Intronic
944305078 2:198169819-198169841 CATTCAAAGGTGTTGGTGGGTGG + Intronic
944930448 2:204513049-204513071 ATTTCAAAGGAGTAACTTGTTGG - Intergenic
945685409 2:212963001-212963023 TTTTCAATGGTGTAAATGAGAGG - Intergenic
946767891 2:223057003-223057025 CTTTCAGAGCTGCAACTGGAGGG + Intronic
948389361 2:237600998-237601020 CTTTCAGAGGTACAATTGGGAGG - Intronic
1169210630 20:3764488-3764510 CTGTCGAAGGTGTGGCTGGGAGG - Intronic
1173251303 20:41365525-41365547 CTCTCAAAGGAGTCACTGAGTGG - Intronic
1174954916 20:55086903-55086925 ATTTCAATGGTGTAGCTGGATGG + Intergenic
1179306475 21:40157935-40157957 CTTTCAAAGGCTGAATTGGGAGG - Intronic
1180883210 22:19221302-19221324 CTTTCAAAGGTGTGCCTGTGGGG - Intronic
1182726278 22:32448571-32448593 CTGTCAAAAGGGTAACTAGGAGG + Intronic
1184058689 22:42068746-42068768 CTTGCAAAGCAGTAAGTGGGAGG + Intronic
1184197015 22:42936665-42936687 CTTTGGAAGGTCCAACTGGGTGG + Intronic
1185323614 22:50214967-50214989 CTTTCAAAGCAGTTACTGAGGGG + Intronic
951256261 3:20452932-20452954 CTTTCACCTGTGTAACAGGGAGG + Intergenic
951740834 3:25921476-25921498 CTTTCAAAGGTGGACATGTGGGG - Intergenic
953940067 3:47086787-47086809 CTTTCGAAGGTGGAAGAGGGAGG + Intronic
957861964 3:85964575-85964597 ATTTTAAAGGTGTAATTAGGAGG - Intronic
958841716 3:99213167-99213189 ATTTCAGAGGTGGATCTGGGAGG - Intergenic
963929544 3:150989311-150989333 CTTCCAAAGGAGTAAATGGCTGG - Intergenic
964316226 3:155447164-155447186 CTTTAGAAGATGAAACTGGGGGG + Intronic
964351713 3:155809769-155809791 CTTTCAAAGGAGTAATTGTAAGG - Intergenic
966436663 3:179892683-179892705 ATTTAAAAGATGTGACTGGGAGG - Intronic
966597163 3:181734518-181734540 TTTTTTAAGGTGTCACTGGGTGG - Intergenic
967751170 3:193118068-193118090 CTGTCACAGGTGTGACTGGCTGG + Intergenic
970607629 4:17695407-17695429 CTTTGAGAGGTGAAAGTGGGAGG - Intronic
971018677 4:22513397-22513419 CTTTGAGAGGTGGAAGTGGGTGG - Intronic
971739983 4:30507164-30507186 CTTTCAAAGGTGTCCCAGAGAGG - Intergenic
974612043 4:64229847-64229869 CTTTCAAATGTGTATATTGGAGG - Intergenic
975232934 4:71956070-71956092 CTTCCAAATGTATATCTGGGGGG - Intergenic
975270973 4:72432534-72432556 CTTTAAAATGTTTAACTGAGAGG - Intronic
977723588 4:100268223-100268245 TTATCAAAGGTGTTCCTGGGAGG - Intergenic
979108969 4:116725716-116725738 TTTTCAAATGTGTAACTGTGGGG - Intergenic
979312013 4:119213483-119213505 CTTGCACAGGTGTAATAGGGAGG + Intronic
980242352 4:130192595-130192617 CTGTCAAAGGTGGAACCAGGTGG - Intergenic
981249036 4:142576642-142576664 GTTTAAAAGGTGTAACTGAAAGG - Intronic
982408604 4:155047293-155047315 CTTTTACAGGTGTAACTGACAGG + Intergenic
987570017 5:19645151-19645173 CTTTCAAAGCTGTAACTAATGGG + Intronic
987607556 5:20157034-20157056 CTTTTAAGTGTGTAACAGGGAGG + Intronic
991292077 5:65042868-65042890 CTTTTCTAAGTGTAACTGGGAGG - Intergenic
991482211 5:67092924-67092946 ATTCTGAAGGTGTAACTGGGAGG - Intronic
992657654 5:78926501-78926523 CTTTCAATGGAGTCACTGGGAGG + Intronic
993002327 5:82394031-82394053 CTTTAAAATGTGCAGCTGGGAGG - Intergenic
995752291 5:115465481-115465503 CTTTCAAAGTTGTGACAGAGTGG + Intergenic
1001346829 5:170909847-170909869 CTTTAAAAGGCAAAACTGGGGGG - Intronic
1003288891 6:4761247-4761269 CTTTCAAAGCTGTATCTCGAGGG + Intronic
1007234423 6:40380023-40380045 CCTTCAAAGGGGGAAGTGGGAGG - Intergenic
1007715891 6:43856001-43856023 ATTCCAAGGATGTAACTGGGGGG + Intergenic
1008807920 6:55454341-55454363 CTTTCAAAGGTGTATACTGGAGG + Intronic
1013094844 6:106935270-106935292 CTTTGAAAGGTGGAGGTGGGAGG - Intergenic
1014602026 6:123425075-123425097 ATTTCAAAGGTGAAAGTGAGAGG + Intronic
1015513921 6:134066249-134066271 CTTTCAAAAGCCTAAGTGGGCGG + Intergenic
1015708324 6:136112050-136112072 CTTTCCAAAGTGTCGCTGGGTGG + Intronic
1016428930 6:143963085-143963107 ATTTTAAAGGTGACACTGGGGGG + Intronic
1018036782 6:159888688-159888710 CTTTGGAAGGTGTGACTTGGAGG + Intergenic
1024172591 7:46805475-46805497 ATTTGTAAGGTGTAACTGAGTGG - Intergenic
1026529026 7:71181341-71181363 CTTTCAAAAGAGGAACTGAGAGG + Intronic
1026670387 7:72385650-72385672 CTGTCAAGGGAGTAACTTGGTGG + Intronic
1028277122 7:88870604-88870626 CTTTCAGAGGTGTAGCTGCAAGG + Intronic
1028399393 7:90408257-90408279 CTTTGAAAGGTGGAGGTGGGGGG + Intronic
1029295869 7:99540065-99540087 CTTTCAGAGGTCAAAATGGGAGG - Intergenic
1032324969 7:130918962-130918984 CTTGCCAAGGAGCAACTGGGTGG + Intergenic
1034351498 7:150417854-150417876 CTTTCACAGGTGTAACTTGAGGG + Intergenic
1035122093 7:156577277-156577299 ATTTCAAATGCGTTACTGGGTGG + Intergenic
1041601503 8:59722559-59722581 ATTTCAAAGGTTTAACAAGGAGG - Intergenic
1042476066 8:69248958-69248980 CTTCTAAAGGTGTAACTATGAGG - Intergenic
1047072173 8:121357483-121357505 TCTTCAAACGGGTAACTGGGAGG - Intergenic
1047181840 8:122595865-122595887 TTTTCAAAGATGTTAGTGGGAGG - Intergenic
1047474868 8:125217144-125217166 CTATCAAAGGGGTAGCTTGGTGG - Intronic
1048299983 8:133244507-133244529 CTTACAAAGGAGGAACAGGGTGG + Intronic
1052842369 9:33303576-33303598 CTATCAAAGCTGTAACTGCTGGG - Intronic
1055629913 9:78212825-78212847 CTTTTACAGAGGTAACTGGGAGG + Intergenic
1058136146 9:101309703-101309725 CTTTCACATCTGTAAATGGGAGG - Intronic
1059960876 9:119563292-119563314 CTTTCAAAGTTGGACTTGGGAGG + Intergenic
1060595384 9:124844728-124844750 CTTTGAGAGGTGTAGGTGGGTGG + Intergenic
1062470608 9:136701985-136702007 TTTGCAAAGGTGTAAGTGGGGGG - Intergenic
1186111068 X:6256497-6256519 CTTTGAAAGGTTGAAGTGGGAGG - Intergenic
1187251557 X:17603087-17603109 CTTTGGAAGGTGAAAGTGGGAGG - Intronic
1188256971 X:27974442-27974464 CTTTCAGAGGTCTAACTGCGGGG - Intergenic
1190569994 X:51770935-51770957 CTTTAAAAGGAGGAACTGGCTGG - Intergenic
1192022387 X:67408392-67408414 TTTACAAGGGTGTAACTTGGGGG - Intergenic
1193152621 X:78140388-78140410 CTGGGAAGGGTGTAACTGGGAGG - Intergenic
1193291296 X:79776504-79776526 CTTTGAAAGGGCTAAGTGGGCGG - Intergenic
1195700026 X:107698024-107698046 CTTTCATAGGTCAAAGTGGGTGG - Intergenic
1195832347 X:109072733-109072755 ATTTTAAAGGTGTATCTGGGGGG - Intergenic
1197249872 X:124204444-124204466 CCTTCAAAGTTTTAACTGCGTGG + Intronic
1198087313 X:133293431-133293453 AATTCAAAGGTGTGACGGGGTGG + Intergenic
1198195836 X:134360945-134360967 CTTTGAAAGGTCCAAGTGGGAGG + Intergenic