ID: 920943011

View in Genome Browser
Species Human (GRCh38)
Location 1:210501636-210501658
Sequence CAGCTGCTCCTGGGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920943002_920943011 15 Left 920943002 1:210501598-210501620 CCATGTCTGCAATCTGCTGACGT 0: 1
1: 0
2: 2
3: 7
4: 87
Right 920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG 0: 1
1: 0
2: 4
3: 38
4: 338
920943003_920943011 -8 Left 920943003 1:210501621-210501643 CCACAGTCCTGTCCCCAGCTGCT 0: 1
1: 0
2: 9
3: 75
4: 541
Right 920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG 0: 1
1: 0
2: 4
3: 38
4: 338
920943001_920943011 16 Left 920943001 1:210501597-210501619 CCCATGTCTGCAATCTGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG 0: 1
1: 0
2: 4
3: 38
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920943011 Original CRISPR CAGCTGCTCCTGGGGAAAAA TGG Intronic
900974577 1:6009048-6009070 CTGCAGCTCCTGGGGGAGAAGGG - Intronic
901460568 1:9388840-9388862 CAGCTTCTCCTGCTGTAAAAAGG - Intergenic
902244901 1:15114468-15114490 CAGCTGCCCCTGGGGAAGATAGG + Exonic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
904676230 1:32200854-32200876 CAGCCGCTCCTGGGGAGCACAGG + Intronic
905211063 1:36374452-36374474 CGGCTGCTCCTGGGAGCAAAGGG + Intronic
905463103 1:38134087-38134109 CAGCTGCTCCGGGAGAAGATAGG - Intergenic
908050727 1:60227043-60227065 CAGCAGCTACTGAGGAAAGAAGG + Intergenic
908419621 1:63947169-63947191 CTGCTGCTCCTGGGCCAACATGG - Intronic
909720069 1:78756979-78757001 CAGCTACTCCAGGAGAAATATGG - Intergenic
910177971 1:84451435-84451457 CAGAAACTCCTGGAGAAAAAAGG - Intergenic
911754979 1:101543705-101543727 CTGCTGCTGCTGGGTAAAAACGG + Intergenic
915321795 1:155060557-155060579 CAGGGGCTCCTGGGGAGAAATGG - Intronic
915562021 1:156693062-156693084 CAGTCGCACCTGAGGAAAAAGGG - Intergenic
915870727 1:159557118-159557140 GAGCTGCTGCTGGGGAAGGAAGG - Intergenic
916448040 1:164891931-164891953 CAGCTCCTCCTGGGGGAAAAAGG + Intronic
916570123 1:166017837-166017859 CAGTTTCTCCTGGAGTAAAATGG - Intergenic
917030270 1:170682732-170682754 TATATTCTCCTGGGGAAAAAAGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
918407408 1:184224447-184224469 CAGCTCCTTCTGGGTAAAGAGGG - Intergenic
920074630 1:203327329-203327351 CAGCTGCTCGTGGGGATTGAGGG - Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
920946705 1:210535982-210536004 CAGCTGCTCCTGGGGAGATTAGG + Intronic
921350046 1:214225594-214225616 CAGCTGCTCCTAGGCAAAGTTGG - Intergenic
922872326 1:228912853-228912875 CTGCTGCTGCTGGGAATAAAGGG + Intergenic
923134938 1:231109412-231109434 CAGCTGCTCCTGATGCAAGAGGG + Intergenic
923839011 1:237647026-237647048 TAGCTGTGCCTAGGGAAAAAGGG - Intronic
924157681 1:241196933-241196955 CAGCTAGTACTGGGGAGAAAGGG + Intronic
924594823 1:245435806-245435828 CCACTGCTCCTTGGGAACAAAGG + Intronic
924724768 1:246659159-246659181 CAGCTGCTTCTGGGCTACAATGG - Intronic
1063107760 10:3008407-3008429 CAGCTGGTCCTTGGGAAAGCTGG - Intergenic
1063566346 10:7174727-7174749 CAGCAGCTCCTGAGTAAGAAAGG - Intronic
1063664117 10:8051570-8051592 CGGCTGCTCCTTGGGAGGAAGGG + Intergenic
1064031474 10:11885812-11885834 CAGCTTCTCCAGAGGAACAAGGG + Intergenic
1065350015 10:24786985-24787007 CTGCTGCTCCTGGGACAGAAAGG + Intergenic
1065827958 10:29589011-29589033 AGGATGCTCCTGGGGAAAAAGGG - Intronic
1066733412 10:38452493-38452515 CAGCTGTGCCGGGGGAAAACTGG - Intergenic
1066989951 10:42503511-42503533 AAGCAGATCCAGGGGAAAAAAGG - Intergenic
1069595239 10:69665975-69665997 CATCTGCTCCTTAAGAAAAATGG + Intergenic
1069873297 10:71546307-71546329 CATTTGCTCGTGCGGAAAAATGG + Intronic
1073063135 10:100744051-100744073 GAGCTCCTCCTGAGGAATAAGGG + Intronic
1073512639 10:104052209-104052231 CAGCAGCCCCTGAGGAGAAATGG + Exonic
1074461306 10:113639776-113639798 CATGTGCTCCTGAGAAAAAATGG + Intronic
1076704974 10:132296444-132296466 AAACTGCTTCTGGGGAACAAGGG + Intronic
1077080196 11:721640-721662 CAGCTGAACCAGCGGAAAAAGGG + Exonic
1077148193 11:1055264-1055286 ACGCTGCTCCAGGGGAAAGAAGG + Intergenic
1077160456 11:1110166-1110188 CAGCTGCTCCTGCTGCAAAGAGG + Intergenic
1077662551 11:4082637-4082659 GAGGTCCTCCTGGGGCAAAAGGG + Intronic
1077804821 11:5580031-5580053 CATCTGTGCCTAGGGAAAAATGG + Intronic
1078387600 11:10906565-10906587 CAGCTGTCACTGGGGAGAAATGG + Intergenic
1081659851 11:44881370-44881392 CAGCTGCTCCTGGAGGGAACTGG - Intronic
1081779099 11:45697531-45697553 CAGCTGCTTCTTGGGAGAACTGG + Intergenic
1082808696 11:57465577-57465599 CAGTTTTGCCTGGGGAAAAAGGG - Intronic
1083213934 11:61206788-61206810 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1083216818 11:61225617-61225639 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1083219700 11:61244443-61244465 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1084459615 11:69289204-69289226 CTGCTGCTCCTGGGGCAGAGAGG - Intergenic
1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG + Intronic
1085117714 11:73944993-73945015 CAGCTGATCCTGAGGGTAAAGGG + Intergenic
1085404341 11:76252997-76253019 CAGATGCTCCTGGGGAGACGCGG + Intergenic
1085545552 11:77314445-77314467 GAGCAGCTCCAGGGGAATAAGGG + Intergenic
1085652077 11:78277441-78277463 CAGCTGGTGCTGGGGAAAGACGG + Intronic
1088274060 11:108065655-108065677 CAGCTGCTGCTGGGGGATGAGGG + Intronic
1090240856 11:125180669-125180691 ACACAGCTCCTGGGGAAAAAGGG + Intronic
1090705267 11:129330382-129330404 CAGCTTGTCCTGCGGAAATAGGG + Intergenic
1091344558 11:134844112-134844134 CTGCTGCTTCTGGGGAGAAATGG - Intergenic
1091457297 12:617555-617577 CTGAAGCTCCTGGGGATAAAAGG + Intronic
1091526890 12:1311561-1311583 CAGATGCTCACGGGAAAAAAAGG - Intronic
1093019934 12:14193933-14193955 CAGCAGCTGCCGGGGAAAAGTGG + Intergenic
1093466229 12:19452278-19452300 CAACTGCTCCTGGCCAAAAGTGG + Intronic
1095970951 12:47901773-47901795 CAGCTTCCCCTGGGGAAATTGGG - Intronic
1096080990 12:48832390-48832412 CAGCTGAGCCAGGGGAAACAGGG - Intronic
1098169616 12:67733615-67733637 AAACTGCCACTGGGGAAAAATGG - Intergenic
1098285821 12:68905896-68905918 CAGATCCTCCTGGGGAACACTGG + Intronic
1098370249 12:69751364-69751386 CACAGGCTCCTTGGGAAAAATGG - Intronic
1098657687 12:73053461-73053483 GAATTGCTTCTGGGGAAAAACGG - Intergenic
1099076945 12:78121713-78121735 GAGCTGCTACTAGGGAAAGAGGG - Intronic
1100270058 12:93016133-93016155 GAGCTGATCCTGGGCAAAGAGGG - Intergenic
1103004139 12:117408312-117408334 GAGCAGCTCCTGGGGAAGGAGGG - Intronic
1103363148 12:120365869-120365891 CAGCTGCCCCTGGGAAAAGCGGG - Intronic
1103720759 12:122974180-122974202 CTGGGCCTCCTGGGGAAAAAGGG + Intronic
1105272263 13:18888418-18888440 AAGATGCTCCAGGGTAAAAAGGG + Intergenic
1106033297 13:26021681-26021703 CAACTGTTACTGGTGAAAAATGG + Exonic
1106074300 13:26444374-26444396 CTGCTGCTCCTGGGATAAGAAGG - Intergenic
1107051180 13:36051800-36051822 AAGCTGCTACTGAGAAAAAAAGG - Intronic
1108068217 13:46600969-46600991 CAGCTGCTCCTTGGGAAATGGGG + Intronic
1108346570 13:49552233-49552255 CAGCTGGGCCTGGGAAACAATGG - Exonic
1108500510 13:51065964-51065986 CAGCTGCTCCTGGGGCCACAGGG + Intergenic
1108530374 13:51322469-51322491 CAGCTGCCTCTGGGGTATAATGG - Intergenic
1112180251 13:97070940-97070962 CAGCTGCTCCTGTGGAGATAGGG - Intergenic
1112397958 13:99050769-99050791 CAGCTGCTCTAGGGGATAGATGG - Intronic
1112789058 13:102983532-102983554 CATCAGCTCCTGGGGAAACACGG - Intergenic
1113795265 13:113053541-113053563 CACCTTCTCCTGGGGAAATCCGG - Intronic
1114208712 14:20597848-20597870 CACTTACTACTGGGGAAAAAAGG + Intronic
1114392161 14:22321410-22321432 CAGCTGCTTCTTTGGAAAAAAGG + Intergenic
1115809474 14:37090903-37090925 CCACTGCTCCTAGGGAAAATAGG + Intronic
1116522733 14:45870003-45870025 CAGCTGGCACTGGGGAAAGACGG - Intergenic
1118210491 14:63761701-63761723 GACCTGCTTCTGGAGAAAAAAGG + Intergenic
1118472741 14:66090251-66090273 CATCTGCTCCTTGTGCAAAATGG - Intergenic
1119271187 14:73306715-73306737 CAGGTGCTCCAGGAGCAAAAAGG - Intronic
1119287015 14:73463508-73463530 CAACAGCTCCTGGGGAACCAAGG - Intronic
1119400512 14:74359261-74359283 CAGCTTTTCCTGGAGACAAAAGG + Exonic
1120202573 14:81553806-81553828 AGGCAGCTCCTGGGGAAAAATGG + Intergenic
1120270378 14:82306366-82306388 CAGATGATCCTGAGGAAAGATGG - Intergenic
1121862851 14:97335944-97335966 CAACTTCTCCTGGGGAGCAATGG + Intergenic
1122018979 14:98820762-98820784 CTGATGCTCTTGGGGAAAATGGG - Intergenic
1122154572 14:99742473-99742495 GAGATGGTCCTGGGGAGAAAGGG + Intronic
1127603298 15:60560769-60560791 CAGCTGCTGCTGGGAAAAAATGG - Intronic
1127961814 15:63895835-63895857 CAGGTTCTCCTGGGGAGAGAGGG - Intergenic
1128300109 15:66561296-66561318 CAGCTGCTCCAGGTCAAATACGG - Exonic
1129774973 15:78230475-78230497 TGGCTGCTCCTGGGGAAAGGCGG - Intronic
1130195046 15:81771688-81771710 CAGATGCTACTGGAGAAAAGAGG + Intergenic
1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG + Intronic
1130976874 15:88783210-88783232 CAGCTGCTCCTGCTCAGAAACGG - Intergenic
1132045110 15:98557198-98557220 CAGCTTCTCCAGGAAAAAAATGG + Intergenic
1133387038 16:5378186-5378208 CAGCTTCTCCTTGGGAAGTAGGG + Intergenic
1133781264 16:8941085-8941107 CAGCAGCTCCTTGGCAAACATGG - Intronic
1134875873 16:17698082-17698104 CAGCAGCTCCTGGGAAGAACTGG + Intergenic
1135930309 16:26730688-26730710 CAGCTTTTCCTGGGGGAATATGG - Intergenic
1136059674 16:27717937-27717959 CAGCTGCTCCTGTGGGCAACTGG - Intronic
1136267332 16:29129494-29129516 CAGCTTGTCCTGGGGAACATGGG - Intergenic
1136986660 16:35112651-35112673 CAGCTGGTGGTGGAGAAAAAAGG + Intergenic
1137438705 16:48480373-48480395 CAGCAGCTCCTAGGTAAAATTGG - Intergenic
1137681553 16:50350887-50350909 CAGAAGCTCTTGGGGAAGAAGGG + Intronic
1138553457 16:57759350-57759372 CAGCTGCCCCGGGGGTAGAAAGG - Intronic
1139559422 16:67732312-67732334 CAGCTTCTGCTGGGGTTAAATGG - Intronic
1139630403 16:68228388-68228410 CAGCTACACCAGGGGCAAAAGGG - Exonic
1140207461 16:72945496-72945518 CAGCTGCTCCAGGAGAAGGAGGG + Intronic
1140410427 16:74737724-74737746 CACCTGCCCCTGGGGCAGAAGGG - Intronic
1141570788 16:84932528-84932550 CACCTGCTCCAGGGAAAAAAGGG + Intergenic
1141775887 16:86122267-86122289 CTGGTGCTCATGGGGTAAAAGGG + Intergenic
1142276226 16:89120297-89120319 CAGCCCCTCCTGGGGACATAGGG + Intronic
1142484696 17:239071-239093 CACCCCCTCCTGGGGAAAGAAGG + Intronic
1143134413 17:4703662-4703684 GAGTTTCTCCAGGGGAAAAATGG - Intronic
1143786328 17:9258526-9258548 CAGCTGCGCCAGGGGAAACCAGG + Intronic
1144584823 17:16481851-16481873 CAGGTGCTCCTGGGGAGGCAGGG - Intronic
1145812730 17:27774290-27774312 CAGCATCTCCTGGTGAAACACGG + Exonic
1147242154 17:39097478-39097500 CCTCTGCTCCTGGGGAGAAATGG - Intronic
1147921401 17:43919340-43919362 CTGCTGCTACGGGGGAAGAAAGG - Intergenic
1148080057 17:44963023-44963045 CAGCTCCTCCTGGGGTCCAAGGG + Intronic
1148210911 17:45807979-45808001 TGGCTGCTGCTGGGCAAAAATGG + Intronic
1148798109 17:50207111-50207133 GAGCTGCTCCAGGGGAGAAAGGG + Intergenic
1149231863 17:54544377-54544399 CAGCTCCAGCAGGGGAAAAATGG - Intergenic
1150195450 17:63293615-63293637 CAGCTGCAGCTAGGGAAAAGAGG - Intronic
1152324169 17:79625981-79626003 CAGTTGCTCCAGGGGAAAGGCGG + Intergenic
1152661958 17:81546648-81546670 CAGCTGCTCCTGGGGCATCCTGG - Intronic
1154267565 18:12892310-12892332 CAGCTGCTCATGGGGTACACAGG + Intronic
1156257700 18:35413360-35413382 CACCAGCTGCTGGGGAAAAGAGG + Intergenic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1156512658 18:37654245-37654267 GACCTGCTCCTGGGAAACAAAGG - Intergenic
1156545163 18:37957013-37957035 CAACTGCTGCTGGGGAAGAGTGG - Intergenic
1156688776 18:39681305-39681327 CAGCTGCTGCTGCTGAAAAATGG - Intergenic
1157396509 18:47346050-47346072 CTGCTGCTCCTTGGGAAAGAGGG + Intergenic
1157748444 18:50157603-50157625 CAGCAGCTAGTGAGGAAAAAGGG - Intronic
1158110969 18:53941178-53941200 CAGCTGGTGCTGGAGAAGAATGG + Intergenic
1158406732 18:57166386-57166408 CAGGTGCTTCAGAGGAAAAATGG + Intergenic
1158676625 18:59525870-59525892 CATCTGCTCCTGGACAAAACTGG - Intronic
1158751002 18:60260812-60260834 CAGCTTCTCCTGGAGATAAAAGG - Intergenic
1159103083 18:63976856-63976878 CAGCAACTCTTGGGGAAAATGGG + Intronic
1160197930 18:76772305-76772327 CAGCTTCTCCTGAGGGAAAAGGG - Intergenic
1160434560 18:78836427-78836449 CAGCTGTGCCTGGGGACAGAAGG - Intergenic
1162035540 19:7936553-7936575 CAGCTGCTCATTGGTAAAATGGG + Intronic
1163027408 19:14520284-14520306 CAGCTGCCCCTGGGCAGACAGGG + Intronic
1163168607 19:15515089-15515111 CAGCTGCCTTTGGGGAAGAAGGG - Intronic
1164990269 19:32677570-32677592 TAGCTGCTCTTGGGGACGAATGG - Exonic
1165040096 19:33062978-33063000 CAGCAGCACCTGGGGGAAAATGG - Intronic
1165263117 19:34637408-34637430 CAGCAGCTCCTGGAAAAAAGCGG + Intronic
1165275896 19:34751326-34751348 CCTGTGCTCCTGGAGAAAAATGG - Intergenic
1166781438 19:45345520-45345542 TTGCTGCTCCTGGGGAGCAATGG - Exonic
1166975569 19:46603233-46603255 CAGGTTCTGCTGGGGGAAAATGG - Intronic
925591405 2:5513411-5513433 CAGCTTTTCCTGAGGAAGAAGGG + Intergenic
927139458 2:20119822-20119844 CAGCAGCTGCTGAGGAAAAGGGG - Intergenic
928452313 2:31387811-31387833 CAGCAACTCTGGGGGAAAAATGG + Exonic
929355682 2:41021583-41021605 CAGCTGGTCCTGGGTACAGAGGG + Intergenic
929440793 2:41964575-41964597 CAGATACTCCTAGGGAAAAGAGG + Intergenic
932184180 2:69677754-69677776 CACCTGCTTCTGTGGAGAAATGG - Intronic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
933285114 2:80376986-80377008 TAGCTTCTACTGGGGAAAGATGG - Intronic
933671735 2:85014332-85014354 CATCTACTTCTGGGGAAAAAAGG + Intronic
935684294 2:105669933-105669955 CTGCTGCTCCTGGGCAAAGCTGG + Intergenic
935798717 2:106671114-106671136 CAGCTACTCCTGGCTAAAAGGGG + Intergenic
936047888 2:109200974-109200996 GGGCTGCTGCTGGGGACAAAGGG + Intronic
937213392 2:120293283-120293305 CAGCTGCTCCTAAGGACACAGGG + Exonic
938275359 2:130015758-130015780 CAGCTGCCAATGGGGTAAAAGGG - Intergenic
938294853 2:130171793-130171815 CAGCTGCTGCTGGGGCAAGAGGG + Intronic
938296141 2:130180948-130180970 AAGCAGCTCCTGGAGAAAATAGG - Intronic
938460603 2:131493706-131493728 AAGCAGCTCCTGGAGAAAATAGG + Intergenic
938461780 2:131502051-131502073 CAGCTGATGCTGGGGCAAGAGGG - Intergenic
939902600 2:147868443-147868465 CCACTGCTACAGGGGAAAAAAGG - Intronic
940973553 2:159919801-159919823 TAGCTGCAGCTGGAGAAAAATGG - Intergenic
941983390 2:171485353-171485375 CAGCAGTTCCTGGGGAAGGAAGG - Intergenic
943267680 2:185756097-185756119 CAGCTCCTCTTGGGCATAAAAGG + Intronic
946255764 2:218440786-218440808 TAGCTGCTCCAGGGGGAAGATGG - Exonic
1170477464 20:16730117-16730139 CAGCTGCAACAGGGGAGAAAAGG - Exonic
1171188193 20:23138428-23138450 GAGCTGTCCCTGGGGATAAAGGG - Intergenic
1171488290 20:25499166-25499188 CAGCAGCTCCTGAGGAGCAATGG + Intronic
1172940611 20:38651361-38651383 CAGCTGCTCCTGAGGAGTATAGG + Intergenic
1173407470 20:42778979-42779001 CAGTTGCTTCTTGGGAAAGAGGG + Intronic
1173874082 20:46358758-46358780 GGTCTGCTGCTGGGGAAAAAGGG + Exonic
1173909210 20:46651539-46651561 CTGCTCCTCCTGGAGGAAAAGGG + Intronic
1174238569 20:49114618-49114640 CAGCTGCCTGTGGGGAAGAAGGG - Exonic
1175963838 20:62650300-62650322 CAGCTGGGCTTGGGGAAGAAGGG - Intronic
1176101480 20:63366463-63366485 CAGCTGCAGGTGGGGAAAGAGGG - Intronic
1177121619 21:17143952-17143974 TAGGTGATCCAGGGGAAAAACGG + Intergenic
1179182898 21:39060948-39060970 CACCTGCTCCCAGGGAAAATAGG - Intergenic
1180066915 21:45417174-45417196 GAGCTGCTCCTGGGGAATCTGGG - Intronic
1180514988 22:16132301-16132323 CAGCCTCTCCTGGGAGAAAAGGG - Intergenic
1181269846 22:21652601-21652623 CCGCGGCTCCAGGAGAAAAAGGG - Intronic
1181647721 22:24242834-24242856 CAGCTGCTGCTGCGGAACAGGGG - Intronic
1182499629 22:30736996-30737018 CAGAAGTTCCTGTGGAAAAATGG - Intronic
1183343236 22:37293670-37293692 CTGCAGATCCTGGGGAGAAAGGG + Intronic
1183599619 22:38832369-38832391 CAGCTCCTGCTGGGGCAGAAAGG + Intronic
1183896768 22:40975646-40975668 CAGCTTCTGCTTGGGCAAAAGGG + Intergenic
1184987447 22:48145374-48145396 CTGCTGCTCCTGGGGCCAAGTGG + Intergenic
949729999 3:7098124-7098146 CAGCTGTTACTAGGGAAATAAGG - Intronic
949930539 3:9074847-9074869 CAGCTGCTACTGGGTATGAATGG + Intronic
950412190 3:12846239-12846261 CAGCTGCTCCAGTGGCTAAAAGG + Intronic
950719793 3:14874882-14874904 CAGCTGGTCCTGGGGAAGCCAGG + Intronic
951127667 3:19002856-19002878 CAGCTGCTCCAGTAGAATAAGGG - Intergenic
953040495 3:39251517-39251539 CAGCTTCTCCATGTGAAAAATGG - Intergenic
954107248 3:48415977-48415999 CATCTGCTCCAGGGGAAAGATGG - Intronic
954973489 3:54671644-54671666 CAGCTGCTCCAGGGCAGGAATGG + Intronic
955155085 3:56408821-56408843 CTGCTGCTCCTGGGGGACAGCGG - Intronic
956434585 3:69221505-69221527 CAGCTTCTCCTGGAAAACAAAGG + Intronic
956942643 3:74181487-74181509 AAGCTCCTCCTGGGTGAAAATGG - Intergenic
959049607 3:101512625-101512647 TAGCTGCTGCTGGGGAGGAAAGG - Intronic
959543017 3:107561697-107561719 TATCTGCTTCTGGGGAGAAATGG + Intronic
959952617 3:112197015-112197037 CAGCAAATTCTGGGGAAAAAGGG - Intronic
960664125 3:120094067-120094089 CAGCTGCTCCTGGCGCAATGAGG - Intronic
961474606 3:127138781-127138803 CAGTGGCTCCTGGCCAAAAAGGG + Intergenic
961862896 3:129931739-129931761 CAGCTGCTGGAGGGGAAAGAAGG - Intergenic
962373572 3:134841091-134841113 CAGCTTCTCCTGGTGGAATAAGG - Intronic
962964823 3:140343900-140343922 CAGCAGCTCCTCGGTAAAGACGG - Intronic
964604390 3:158544196-158544218 AAGCTGATGCTGAGGAAAAATGG + Exonic
965261247 3:166489223-166489245 CAGCTGCACCTGGGGTTACAGGG - Intergenic
965849514 3:173006865-173006887 AAGCTGCTGCTTGGCAAAAATGG + Intronic
966060736 3:175751251-175751273 TAGCAGCCCATGGGGAAAAATGG + Intronic
966332745 3:178833342-178833364 CAAATGCTCCCAGGGAAAAAAGG + Intronic
966443217 3:179970453-179970475 CTCCTGCTCCTGGGTAAAACAGG - Intronic
968279656 3:197466760-197466782 CAGCTGGTCATGGGGTGAAATGG + Intergenic
968507702 4:979282-979304 GATCAGCACCTGGGGAAAAAAGG - Intronic
968868465 4:3228363-3228385 CAGCTGCTCCTGGGGTTGACTGG + Intronic
969457158 4:7306647-7306669 AAGCTGGTCCTGGGGAAGGAGGG + Intronic
969663518 4:8544150-8544172 CAGCTGCTTCTGTGCAGAAAGGG - Intergenic
971470856 4:27024973-27024995 CTGCTGCTCCTGGGTGAGAAGGG + Intronic
972240116 4:37181593-37181615 CAGCAGCTCCTTGGGAGAGAAGG + Intergenic
972332105 4:38073641-38073663 CAGCTGCTTTTGGTCAAAAATGG - Intronic
973339260 4:48986876-48986898 CTACAGCTCCTGGGGAAAACGGG - Intronic
974364345 4:60926961-60926983 CAGCTGCTTCTGGGGCAGAAAGG - Intergenic
974952568 4:68600753-68600775 CAGCTGCTCCTGCAGACATAGGG - Intronic
978717531 4:111864107-111864129 CAGCTGCTGTAGGGGAAAATGGG + Intergenic
980053957 4:128062085-128062107 CAGCTGGCCCTGCGGAAAAGCGG + Intronic
981018542 4:140001192-140001214 CAACTGCTCATGGAGAAAACTGG - Intronic
983335189 4:166382980-166383002 CAGTAGCTCCTGGGAAACAAGGG + Intergenic
983928566 4:173429156-173429178 CAGCTGTCCCTGGGGAAATCAGG - Intergenic
984948301 4:184987171-184987193 CAGCTGCTCCTTGTAAAGAAAGG - Intergenic
985461249 4:190108818-190108840 CAGCTGCTCCTGCAGACATAGGG + Intergenic
985831675 5:2238505-2238527 CAACTGCTTCTGGGGAAATAGGG + Intergenic
986227131 5:5826405-5826427 CAACTGTACCTAGGGAAAAACGG + Intergenic
987176881 5:15321079-15321101 CAGCTGCTCCTGGAGAATAATGG - Intergenic
987744049 5:21947800-21947822 CAGCGGCCTCTGAGGAAAAAAGG + Intronic
988470280 5:31531604-31531626 CAGATCCACCTGGGGAAAGAGGG - Intronic
989201513 5:38769075-38769097 GGGCTGCACCTGGGGTAAAAAGG - Intergenic
989519645 5:42386239-42386261 AATCTGCTCCTGGGAGAAAATGG - Intergenic
990561596 5:56989129-56989151 CAGATTCTCCTGGGGAAACTGGG - Intergenic
991295515 5:65076104-65076126 CTGCAGCTCCTGGGGAGGAAAGG + Intergenic
992327570 5:75676536-75676558 CAGCTAGTACTCGGGAAAAAAGG + Intronic
994130723 5:96224591-96224613 CAGATGCTCCAGGGGAGAATCGG - Intergenic
994888097 5:105592851-105592873 GAAATGCTACTGGGGAAAAAAGG - Intergenic
995324967 5:110880128-110880150 CAGCTGCTCTGGGAGAGAAAGGG - Intergenic
995879655 5:116830135-116830157 CTGCTGCTGCTGGAGAAATATGG + Intergenic
998291317 5:140917137-140917159 CAGCTGCTGCTGGGGGATATGGG + Intronic
998348518 5:141485565-141485587 CAGCTGCTGCCGCGGAAAACGGG - Exonic
998354275 5:141521629-141521651 CAGCTGCCTCTCTGGAAAAAAGG + Intronic
998681134 5:144468471-144468493 CAACTGCTCATGAGTAAAAACGG + Intronic
999752428 5:154638749-154638771 CAGCTGCTCCTGCAGACATAGGG + Intergenic
1000414156 5:160965769-160965791 CAGCTGCACATTGAGAAAAAAGG + Intergenic
1001263892 5:170257588-170257610 CAGCTGCTACTGAGAAAACAGGG + Intronic
1001547666 5:172580424-172580446 CAGCTGCTCCTGGAGAGCAGGGG + Intergenic
1001985085 5:176067557-176067579 CAGCAGCTGCTAGGGAGAAAGGG - Intronic
1002231780 5:177770578-177770600 CAGCAGCTGCTAGGGAGAAAGGG + Intronic
1002263561 5:178013175-178013197 CAGCAGCTGCTAGGGAGAAAGGG - Intronic
1002433752 5:179219203-179219225 CTGCTGCTCCTGGGGGAAGGAGG - Intronic
1003298889 6:4858815-4858837 CAGTTCCTCCTCTGGAAAAAGGG + Intronic
1003723214 6:8729189-8729211 CAACTGCTCCAAGGAAAAAATGG + Intergenic
1005246126 6:23887386-23887408 CGGCTGCTGCTGGGGCAGAAGGG - Intergenic
1006257899 6:32845625-32845647 CAGCAGCTCATGGAGAAAAAGGG - Exonic
1006471127 6:34229384-34229406 CAGCTGGTCCTGGGTGGAAAGGG + Intergenic
1007487211 6:42189321-42189343 TATATGCTCCTGGGGAAAAGAGG + Intronic
1008579327 6:52891493-52891515 GAGATGCTACTGTGGAAAAAAGG - Intronic
1012146274 6:95686979-95687001 CAGCTGGTCCTGGGAACAGAAGG + Intergenic
1012937502 6:105383563-105383585 CATCTGCTCTTGGGTGAAAAGGG + Intronic
1013233159 6:108175077-108175099 CAGCGGCTCCTGCTGAAAGACGG - Intronic
1013577252 6:111496194-111496216 CTGCTACTACAGGGGAAAAAAGG - Intergenic
1013975826 6:116077424-116077446 CAGCTGCTCCTCAGGTAAAGTGG + Intergenic
1016941393 6:149485346-149485368 TAGCTGCTCCTGGGGAAAGTCGG + Intergenic
1019082132 6:169441599-169441621 CAGCATCTCCTGCGTAAAAATGG - Intergenic
1019300481 7:300667-300689 CTGCTGGTCCTGGGGACAAGTGG - Intergenic
1019409930 7:901935-901957 CATCTCCTGCTGGGGGAAAAGGG - Intronic
1019906330 7:4067903-4067925 CAGGAGCCCCTGGAGAAAAATGG + Exonic
1023720526 7:43089001-43089023 CTGCTGCTCCAGGGTAAGAAGGG + Intergenic
1023760141 7:43457919-43457941 CGGCTGCTGATGGGGAAAAGTGG - Intronic
1024627815 7:51223349-51223371 GGGCTGCTTTTGGGGAAAAAAGG + Intronic
1024964053 7:55005727-55005749 CAGCAGCTGCGAGGGAAAAAGGG - Intergenic
1026673872 7:72412929-72412951 CAGCTGCCCCAGGAGAAAGAGGG - Intronic
1027343299 7:77232754-77232776 CAGCTGCCCATGGGGAAGAAGGG + Intronic
1027840717 7:83307810-83307832 CAGATTCTCATGGGTAAAAACGG + Intergenic
1029812599 7:103064445-103064467 CATCTGCTCCTGGAGAACATGGG + Intronic
1030664883 7:112265569-112265591 CACGTGCTGTTGGGGAAAAATGG + Intronic
1030937698 7:115606121-115606143 CAGGTGCTCATGGGAAAAACTGG - Intergenic
1032066505 7:128775419-128775441 CAGGTACTGCAGGGGAAAAAGGG - Exonic
1033887148 7:145963052-145963074 CTGCTGCTGCTGGGGAATAAGGG - Intergenic
1034285223 7:149879584-149879606 CAGCATCTCCTTGGGAAAGAGGG - Exonic
1034451309 7:151138628-151138650 CAGCGCCGCCTGGGGACAAAGGG - Intronic
1034827052 7:154275205-154275227 GAGCTGCTGCTGGGGAAAGGAGG - Intronic
1035362117 7:158320463-158320485 CAGCTGCTCGGAGTGAAAAATGG - Intronic
1035689818 8:1552729-1552751 CAAGTGCTCCTAGTGAAAAAAGG - Intronic
1036933969 8:12982864-12982886 CAGCTTCTCCAAGGGACAAAAGG + Intronic
1037405493 8:18538071-18538093 ATGCTGCACCTGAGGAAAAATGG + Intronic
1038468786 8:27792484-27792506 TAGCTGCTACTGTGGAAACAAGG - Intronic
1039466548 8:37788969-37788991 TGGCTGCCTCTGGGGAAAAAAGG + Intronic
1039640913 8:39219614-39219636 AAGCTGCTGCTGGGGGATAAGGG + Intronic
1040603681 8:48909577-48909599 AACCTGCTCCTGGGGGAAGATGG - Intergenic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1041252798 8:55950850-55950872 GAGCTACTCAAGGGGAAAAAAGG + Intronic
1041378406 8:57225342-57225364 CAGCTGGTGCCAGGGAAAAATGG - Intergenic
1041439398 8:57877726-57877748 CAGCTGGTCCTGGGGCCCAAAGG - Intergenic
1045829837 8:106445830-106445852 CAGCTCCTCCTGGAGAACAGTGG + Intronic
1047995469 8:130330935-130330957 CATCTGCTACTGAGAAAAAAAGG - Intronic
1048159330 8:131999274-131999296 CAGTTGCATTTGGGGAAAAAAGG - Intronic
1048383757 8:133892326-133892348 CATCTGTTGTTGGGGAAAAAAGG + Intergenic
1048508057 8:135038530-135038552 CTGCTGGTCCTGGGGCAAGATGG - Intergenic
1048510426 8:135056939-135056961 CATCTGCAGCTGGGGAGAAAAGG + Intergenic
1049105268 8:140608793-140608815 CAGCTGCTCCAGGGCAGCAAGGG + Intronic
1049307243 8:141910605-141910627 CAGCAGCTCCTGAGGCACAAGGG + Intergenic
1049802442 8:144524291-144524313 CAGCAGATCGTGAGGAAAAAGGG + Exonic
1049942632 9:562393-562415 CAACTGCTTCTGGGGAAGATGGG + Intronic
1050847433 9:10239893-10239915 CAGCTGGCTTTGGGGAAAAAGGG - Intronic
1052520988 9:29548218-29548240 CAGCTGCTTCTTGGTACAAAGGG - Intergenic
1052743486 9:32416436-32416458 CAGACACTCCTTGGGAAAAAAGG - Intronic
1053003997 9:34592419-34592441 CATTTGCGCCTGGGGAAATATGG + Intergenic
1053151693 9:35747925-35747947 CAGCTGCTTGTGGGAAATAAGGG + Intronic
1053180243 9:35962268-35962290 CAGCTGCTGCTGGGGCAGAGAGG - Intergenic
1053563073 9:39216333-39216355 CAGCTGCCCCTGTGGAAAACTGG + Intronic
1053674038 9:40403920-40403942 CAGCTACTCTGGGGGAAAAGAGG - Intergenic
1053828863 9:42054277-42054299 CAGCTGCCCCTGTGGAAAACTGG + Intronic
1053923841 9:43030287-43030309 CAGCTACTCTGGGGGAAAAGAGG - Intergenic
1054134074 9:61402722-61402744 CAGCTGCCCCTGTGGAAAACTGG - Intergenic
1054385142 9:64543989-64544011 CAGCTACTCTGGGGGAAAAGAGG - Intergenic
1054510587 9:65972370-65972392 CAGCTACTCTGGGGGAAAAGAGG + Intergenic
1054601696 9:67133175-67133197 CAGCTGCCCCTGTGGAAAACTGG - Intergenic
1054800846 9:69346916-69346938 CACCTTCTCATGGGGAAAAGGGG + Intronic
1054810877 9:69432939-69432961 CAGCTGGGGCTGGGTAAAAAGGG + Intronic
1055373666 9:75625825-75625847 CAGCTGCAGCTCTGGAAAAAGGG - Intergenic
1056726544 9:89123947-89123969 CATCTGGTACTGGGCAAAAAGGG + Intronic
1056925642 9:90832136-90832158 CAGTTGCTCCTGGGGAAATATGG - Intronic
1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG + Intronic
1057611011 9:96543785-96543807 CATTTGCTCCTGGGGAAACAGGG + Intronic
1058983854 9:110194320-110194342 AAGCTGCTGGAGGGGAAAAAGGG + Intronic
1059457911 9:114411452-114411474 CAGCTGATCCTGGGGGAAGCTGG + Intronic
1061293833 9:129666586-129666608 CAGCTGCTCCCGGGGCAAACTGG - Intronic
1061727553 9:132589837-132589859 CACCCGCTCCTGGGGAGAAAGGG - Exonic
1061788234 9:133043827-133043849 CGGCAGCTCCTGGTGGAAAAAGG - Exonic
1062388787 9:136325959-136325981 CAGCAGCGCCTGGGGAAAGAGGG + Intergenic
1185832778 X:3317519-3317541 CAGCTTCTCCTGGTGGATAACGG + Exonic
1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG + Intronic
1187358620 X:18602726-18602748 CAGGTTCTCATGGGGAAAATTGG + Intronic
1187937112 X:24346907-24346929 CAGCTGCTCCAAGAGAGAAACGG + Intergenic
1189608930 X:42710783-42710805 CTTCTGCTCCTGGGGTGAAAAGG - Intergenic
1189881474 X:45497940-45497962 CTGCTGCTGCTAGGGAGAAACGG + Intergenic
1191638066 X:63399790-63399812 CAGCTGCTCCAAGAGAACAATGG + Intergenic
1192614882 X:72609258-72609280 ATGCTGCTCATGGGGAATAAAGG - Intronic
1194842092 X:98754878-98754900 CAGCTGCTGCTGGGGGATGAGGG + Intergenic
1195559183 X:106263861-106263883 CAGCTGCTCCAGGAGAGCAATGG + Intergenic
1196122901 X:112069481-112069503 CACCTTCTGCTGGGGAAAACAGG - Intronic
1199269316 X:145864399-145864421 AACCTGATCCTGGGGAAAACTGG - Intergenic
1199320729 X:146435480-146435502 CTGCTGATCCTAGGAAAAAATGG + Intergenic
1199542275 X:148969964-148969986 CAGCTACTCCTAGGGACGAAGGG + Intronic
1200397494 X:155999676-155999698 CAGCTGCTTCTGGGGTACCAAGG + Intronic
1201243318 Y:11979374-11979396 CAGCTTCTCCTGGTGGATAATGG - Intergenic