ID: 920945884

View in Genome Browser
Species Human (GRCh38)
Location 1:210528203-210528225
Sequence CCAGACCCAGGGGTGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 370}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920945877_920945884 1 Left 920945877 1:210528179-210528201 CCTACAAGTGTGTGTCACAATGC 0: 1
1: 0
2: 4
3: 34
4: 224
Right 920945884 1:210528203-210528225 CCAGACCCAGGGGTGGTGCAGGG 0: 1
1: 0
2: 5
3: 34
4: 370
920945876_920945884 23 Left 920945876 1:210528157-210528179 CCGAGAGAGAGAGACACATGGTC 0: 1
1: 0
2: 1
3: 28
4: 253
Right 920945884 1:210528203-210528225 CCAGACCCAGGGGTGGTGCAGGG 0: 1
1: 0
2: 5
3: 34
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920945884 Original CRISPR CCAGACCCAGGGGTGGTGCA GGG Intronic
900362018 1:2293722-2293744 CCAGACCCAGGGGCCTTGCACGG - Intronic
900589376 1:3453018-3453040 CCAGACCCAGGGTGGCTGAACGG + Intergenic
900795042 1:4702764-4702786 CCAGAACCTGGGGTGGTCCCGGG - Intronic
901449290 1:9326258-9326280 CCAGCCCTTGGGGTGGTGCTGGG - Intronic
901635106 1:10666877-10666899 CCAGACCCTGTGGTGGGGCTTGG + Intronic
902164581 1:14559907-14559929 CAAGACCTAGGGCTGGTTCAGGG + Intergenic
902249470 1:15144587-15144609 CCACACCCAGGGCTTCTGCAGGG - Intergenic
902658112 1:17883363-17883385 CTAAGCCCAGGGGTGGAGCAGGG + Intergenic
902701973 1:18178759-18178781 CCAGACCCTGGGGTGGGGTAGGG - Intronic
903177427 1:21589346-21589368 CAGGACTCAGGGGTGGGGCAAGG + Intergenic
903471295 1:23589218-23589240 CCTGACCCTGGGGTGATGTAGGG + Intronic
903767999 1:25747083-25747105 CCAGCCCCAGGGGCCGTCCAGGG - Intronic
903854877 1:26331182-26331204 CCAGATACAGGAGTGGTGCGGGG - Intronic
904368003 1:30029241-30029263 CTTGTCCCTGGGGTGGTGCAGGG + Intergenic
904380782 1:30109286-30109308 CCAGAACCAAGGGTGGTCCCTGG - Intergenic
904575806 1:31504279-31504301 CCTGGCCCTGGGGTGGTGCTGGG - Intergenic
904683934 1:32247571-32247593 CCAGAGCCAGGCCTGGCGCAGGG + Exonic
904840459 1:33368856-33368878 CCTGACCCAGGCTGGGTGCAGGG + Intronic
906196520 1:43933695-43933717 CCAGATCCCGGGGTGGGGCTGGG - Exonic
906237718 1:44221894-44221916 CCAGCCCCAGCGGTGATGTATGG + Intronic
907325968 1:53638738-53638760 CCAGAACAAGGAGTGGGGCAGGG + Intronic
907349111 1:53811410-53811432 ACAGACTCAGGGCTGTTGCAGGG + Intronic
907492090 1:54814797-54814819 CAAGACCCAGGGCTGCTGGATGG + Intronic
907569482 1:55469655-55469677 CCTAACCCAGAGGTGTTGCAAGG + Intergenic
907858328 1:58325991-58326013 CCAGAGGGAGGGGTGGAGCAGGG - Intronic
908891863 1:68858042-68858064 CCACACTCAAGGGTGGTGCTAGG + Intergenic
913238888 1:116810627-116810649 CCAGAGCCAGGGAAGCTGCATGG + Intergenic
914050222 1:144125184-144125206 CCAGACCACGGGGAGGTCCAGGG + Intergenic
914128960 1:144840261-144840283 CCAGACCACGGGGAGGTCCAGGG - Intergenic
914348118 1:146817188-146817210 CCAGACCCCTGGCTGGTGTAGGG + Intergenic
915571554 1:156747632-156747654 CCAGAACCAGGGGTGGGGGTGGG + Intronic
917057921 1:171004094-171004116 ACAGACTCAGGGCTGTTGCAGGG - Intronic
919129234 1:193432902-193432924 CCAGACAAAGGTGTGCTGCAGGG - Intergenic
919801612 1:201357792-201357814 CCAGGGCCAGGTGTGGTGCGTGG + Intergenic
919944018 1:202306948-202306970 CCACATCCAGGGGTGGGCCATGG + Intronic
920244502 1:204577528-204577550 CCAGACCAGAGGGTGGGGCAGGG + Intergenic
920336686 1:205249675-205249697 TCACACCCAGGAGTGGTGGAGGG + Intronic
920945884 1:210528203-210528225 CCAGACCCAGGGGTGGTGCAGGG + Intronic
921053059 1:211524808-211524830 CCAGACACAAGTGTGGAGCAGGG - Intergenic
921215259 1:212931446-212931468 CCAGTTCCATGGCTGGTGCAGGG - Intergenic
922041470 1:221902666-221902688 CCAGACGGAGGGTTGATGCATGG - Intergenic
922613339 1:226945829-226945851 ACAGACCCAGGGAGGGAGCAGGG - Intronic
923022125 1:230173264-230173286 CTAGACCAAGGGGTGATGCCAGG + Intronic
923483856 1:234410642-234410664 CCAGACCCCGGGCTGTTCCAGGG - Intronic
1063068573 10:2635891-2635913 CCAGCCTCAGGGCTTGTGCAGGG + Intergenic
1063138548 10:3237482-3237504 CCAGACCCAGGGGTGAGCTATGG + Intergenic
1065708021 10:28489043-28489065 AGAGACTCAGAGGTGGTGCAGGG + Intergenic
1065881830 10:30043764-30043786 CCAGGCCCAGTGCTGCTGCAGGG + Intronic
1067066828 10:43108882-43108904 CCAGCCCCAGGCCTGTTGCATGG + Intronic
1067370627 10:45678655-45678677 CCAGGGCCAGGGCTGGTGCCCGG + Intergenic
1067389148 10:45847488-45847510 CCAGGGCCAGGGCTGGTGCCCGG - Intronic
1067548829 10:47219026-47219048 CCAGACTCAGGGCAGGGGCAGGG - Intergenic
1068803928 10:61173536-61173558 CAAGGCTCTGGGGTGGTGCAGGG - Intergenic
1069358371 10:67613845-67613867 ACAGACCCAGGGGTGGAGTGGGG + Intronic
1069618042 10:69818680-69818702 CAAGAACCAGTTGTGGTGCAGGG + Intronic
1069713956 10:70508880-70508902 CCAGGCCCAGGGCAGGTGAAGGG + Intronic
1070721921 10:78762868-78762890 CTAGATCCTGGGGTGGTCCAAGG + Intergenic
1072737253 10:97887579-97887601 CCAGACCCAGACGTGGTGCAGGG + Intronic
1073319537 10:102606326-102606348 CCACACCAAGGGGTGGTTTATGG - Intronic
1073539936 10:104310008-104310030 CCAGGGACAGGGGTGGGGCAAGG + Exonic
1074696445 10:116053948-116053970 CCATCCCCAGGCTTGGTGCATGG + Intergenic
1074773125 10:116746043-116746065 CCAGACCCTAGGATGGTGCCTGG + Intergenic
1074884154 10:117681811-117681833 CCAGGGCCTGGCGTGGTGCATGG - Intergenic
1074942890 10:118252129-118252151 TGAGACCCAGGGCTGGAGCATGG - Intergenic
1075273177 10:121070706-121070728 CAAGACCCTGAGGTGGTGCTTGG - Intergenic
1076323075 10:129598158-129598180 CCAGCCTCAGGGTGGGTGCATGG + Intronic
1077055335 11:589527-589549 CCAGTCCCAGGGGTTTTGCAGGG + Intronic
1077112822 11:869423-869445 CCAGGCCCTGGGGTGATGCTGGG + Exonic
1077288945 11:1780039-1780061 CCAAACACAGGGGTGGTGACTGG + Intergenic
1077495039 11:2882892-2882914 CCAGACCCAGGCTTGTTTCAAGG - Intergenic
1078897762 11:15612658-15612680 CCAAACCCAGGGTAGCTGCAGGG + Intergenic
1079342988 11:19628343-19628365 CCAGAGCCAAGCGTAGTGCAGGG + Intronic
1079644345 11:22844506-22844528 CCAGACAGAGGGGTGCTGCAGGG + Intergenic
1080941636 11:36925010-36925032 CCAGACCCAGTGGTGGAAGAAGG - Intergenic
1081315564 11:41625474-41625496 CCAGGCACAGGTGTGCTGCAGGG - Intergenic
1081596416 11:44462537-44462559 CTAGGCCCAAGGGTGGTCCAAGG + Intergenic
1081905132 11:46664396-46664418 CCATACCCAGGGGTGATGGAGGG + Intronic
1083085060 11:60134329-60134351 CCAGGCAGAGGGGTGTTGCAGGG + Intergenic
1083173591 11:60936504-60936526 CCAGACCCAGTTGTGGGGCTGGG - Exonic
1083734611 11:64672259-64672281 CCTGCCACAGGGGAGGTGCATGG - Intronic
1084009560 11:66340046-66340068 CCAGACCCAGGGGAGGGGGTTGG - Intronic
1084148815 11:67278662-67278684 CCAGACACTGGAGTGGGGCAGGG + Intronic
1084331224 11:68431857-68431879 CCAGGCCAGGGGGTGGTGGATGG - Intronic
1084438635 11:69158101-69158123 CCTGCCCCAGGGGTGGGACATGG - Intergenic
1084545340 11:69812531-69812553 TGAGGCCCAGGGGTGGTGCCAGG + Intronic
1084572539 11:69968256-69968278 CCTGAGCCAGGGGTGGTGGTGGG + Intergenic
1084881019 11:72171858-72171880 CAAGACCCAGGAGGGGTGAAGGG + Intergenic
1084937738 11:72596015-72596037 CCAGACCCAGGGCTGAGGCTGGG - Intronic
1085032915 11:73283486-73283508 CACCACCCAGGGCTGGTGCAGGG - Intronic
1085064870 11:73485504-73485526 CCAGACCAAGGCCTGGTCCAAGG - Intronic
1085705751 11:78785712-78785734 CAAAACCCAGGGATGTTGCAGGG + Intronic
1088645117 11:111911692-111911714 GCGGATCCAGGGGTGGTGGATGG + Exonic
1090483152 11:127085915-127085937 CCAGGCTAAGGGGTGGTGGAAGG + Intergenic
1096581631 12:52589381-52589403 ACAGTCCCAAGGGTGGGGCAGGG - Intronic
1096585054 12:52614546-52614568 ACAGAGCCAGAGGTGGGGCAGGG + Intronic
1096714663 12:53483821-53483843 CCAGCCCCAGGGCGGGTGGAAGG - Intronic
1102711817 12:114934557-114934579 CCAGACCTGGGGGCTGTGCAGGG + Intergenic
1104255380 12:127131741-127131763 CCAGACTCAGGGATGGATCATGG - Intergenic
1104727852 12:131088646-131088668 CCAGGCCCAGGGGTCGTGAGGGG + Intronic
1104802469 12:131563976-131563998 CCAGGCGCAGGGCAGGTGCATGG - Intergenic
1105608574 13:21947683-21947705 CCACCCCCAGGGGTGGTGCTGGG + Intergenic
1105694141 13:22871664-22871686 CCAGACAGAGGTGTGCTGCAGGG + Intergenic
1107905023 13:45053745-45053767 CCTGGCCCAGGGGTGCTGCCTGG + Intergenic
1109025306 13:57147010-57147032 CCAGGCCCGGAGGTGGTGCGAGG - Intronic
1109026296 13:57153583-57153605 CCAGGCCCGGAGGTGGTGCGAGG - Intronic
1109027288 13:57160154-57160176 CCAGGCCCGGAGGTGGTGCGAGG - Intergenic
1109028274 13:57166719-57166741 CCAGGCCCGGAGGTGGTGCGAGG - Intergenic
1109029261 13:57173290-57173312 CCAGGCCCGGAGGTGGTGCGAGG - Intergenic
1113561738 13:111286948-111286970 TCAGACACAGGGGCGGGGCAGGG - Intronic
1113807157 13:113116608-113116630 CAGGGCCCAGGGGTGGTGGAAGG - Intronic
1114660427 14:24340032-24340054 CCCGCCCCTGGGGTGGGGCAGGG + Exonic
1120727384 14:87960120-87960142 CCAGACACTGGGGTGGGGCTGGG + Intronic
1121030505 14:90654662-90654684 CCAGACCAAGTGGTGGGACAGGG + Intronic
1121050524 14:90816538-90816560 CCGGAGCCAGGGCTGGGGCAGGG + Intergenic
1121346272 14:93137978-93138000 CCAGCCCCTGGTGTGGTGCCTGG + Intergenic
1122703922 14:103608385-103608407 CCAGAGGCAGGGGTGGTGTATGG - Intronic
1122772195 14:104102487-104102509 CGAGGCCCAGGGGTGGGGAAGGG - Intronic
1122946066 14:105010287-105010309 CCTCACCCAGGGCAGGTGCATGG + Exonic
1122970564 14:105150500-105150522 AGTGACCCAGGGGTGCTGCAGGG - Intronic
1123038297 14:105480233-105480255 CCAGGCCCAGGGGTGTTGGCTGG - Intergenic
1123420097 15:20124493-20124515 CCAGACCATGGGGAGGTCCAGGG + Intergenic
1123445765 15:20329039-20329061 CCAGACCATGGGGAGGTCCAGGG - Intergenic
1123529320 15:21131029-21131051 CCAGACCATGGGGAGGTCCAGGG + Intergenic
1124971764 15:34495869-34495891 CCAGAGCGAGGCGGGGTGCACGG - Intergenic
1125793914 15:42390206-42390228 CCAGACCCTTGGGAGGTGCCAGG - Intronic
1126337846 15:47606120-47606142 AGAGACAGAGGGGTGGTGCAGGG + Intronic
1128323788 15:66710014-66710036 CCAGACCCAGCGGGGATGAAGGG + Intronic
1128686518 15:69690326-69690348 CCAGACACAGGACTGGGGCAAGG - Intergenic
1129335688 15:74850925-74850947 GCAGACCCAGGGCTGGTCCTTGG + Intronic
1129915558 15:79266901-79266923 CCACACCCAGAGGTGGTACAGGG - Intergenic
1130252199 15:82306944-82306966 CCAGTCCCCGGGCTGGAGCAGGG + Intergenic
1131317849 15:91356211-91356233 CCAGGCAAAGGTGTGGTGCAGGG - Intergenic
1131974769 15:97933549-97933571 CCAGACAGAGGTGTGCTGCAGGG - Intergenic
1132304812 15:100803412-100803434 CCATACCCAGGATTGGTGCTAGG - Intergenic
1132647153 16:1004374-1004396 CCAGGCCCAGGAGTGGGGCTGGG - Intergenic
1132740082 16:1407785-1407807 CGAGACCCAGGGTGGCTGCAGGG + Intronic
1133222289 16:4323947-4323969 CCACAGCCAGGGGTGGCACAGGG + Intronic
1133676634 16:8079573-8079595 CCAGACCCATGGGTGGTATTAGG - Intergenic
1134058295 16:11183531-11183553 GTAGACCCAGGGCTGGAGCAGGG - Intergenic
1134243621 16:12523702-12523724 CCAGACACAGGGGTGGGGTGGGG + Intronic
1136059602 16:27717574-27717596 CCAGACCCGGGGCATGTGCAAGG - Intronic
1136368363 16:29820399-29820421 CCAAGCCCAGGGGTGGGGCTTGG - Exonic
1136720980 16:32319569-32319591 CCAGACCATGGGGAGGTCCAGGG + Intergenic
1136839365 16:33525855-33525877 CCAGACCATGGGGAGGTCCAGGG + Intergenic
1137720040 16:50622433-50622455 CCAGGCCCAGGCCTGCTGCATGG + Intronic
1138205368 16:55120478-55120500 CCAGACCTAGGGATGGACCATGG + Intergenic
1139309085 16:66013205-66013227 GCTGACAGAGGGGTGGTGCATGG + Intergenic
1139985919 16:70898357-70898379 CCAGACCCCTGGCTGGTGTAGGG - Intronic
1140046722 16:71444441-71444463 CCTGGCCCAGAGGTGGTGAAGGG - Intergenic
1140686115 16:77435141-77435163 CGAGCCCCCGGGCTGGTGCAAGG + Intergenic
1141205200 16:81928061-81928083 CCAGACCCTGGGATGGTTCAAGG + Intronic
1141370733 16:83483928-83483950 CCAGAGACAGGGGGGCTGCATGG + Intronic
1142176139 16:88646305-88646327 GCAGACCCAGGGGACGTGCGCGG + Intronic
1142282622 16:89156528-89156550 CCAGACACAGGGGTGCTGCCAGG + Intergenic
1142304343 16:89277263-89277285 CCAGAGGAAGGGGTGGTGCCGGG - Intronic
1142417424 16:89949997-89950019 CCAGCCCCAGGCCTGGCGCACGG - Intronic
1203005452 16_KI270728v1_random:198201-198223 CCAGACCATGGGGAGGTCCAGGG - Intergenic
1203137002 16_KI270728v1_random:1734322-1734344 CCAGACCATGGGGAGGTCCAGGG - Intergenic
1203149530 16_KI270728v1_random:1826140-1826162 CCAGACCATGGGGAGGTCCAGGG + Intergenic
1142719483 17:1766801-1766823 CAGGACCCAGGGGTTGGGCAGGG - Intronic
1142860307 17:2756741-2756763 CCAGAGCCACGGGAGGTGCTGGG - Intergenic
1142901302 17:3013404-3013426 TCCGACCCAGGAGTGGAGCAGGG - Intronic
1143427867 17:6854266-6854288 ACAGACTCAGAGGTGTTGCAGGG + Intergenic
1144139720 17:12336742-12336764 ACAGACTCAGGGCTGTTGCAGGG - Intergenic
1144670625 17:17130712-17130734 CCAGGCCCAGGGCTGGAGCTGGG + Intronic
1145747703 17:27332468-27332490 CCAGTCAGAGGGGTGGGGCAGGG + Intergenic
1145917804 17:28586387-28586409 GGAGACCCAGTGGTGGTGTAAGG + Intronic
1146568132 17:33930805-33930827 GCAGACCCACAGGTGGTGGAGGG + Intronic
1147142045 17:38465577-38465599 CCAGGCCCAGGGGTGGCAGAAGG + Intronic
1148107694 17:45128141-45128163 CCACACCCAGGGCTGGAGCCTGG + Intronic
1148829351 17:50420341-50420363 CCAGGCCCAGGTGTGGCGCTGGG + Intergenic
1149461915 17:56835160-56835182 CCGGATCCAGTGGTGGGGCATGG - Exonic
1150128574 17:62653938-62653960 CTCTAGCCAGGGGTGGTGCAGGG + Intronic
1151318424 17:73338056-73338078 CCAGCCACAGTGATGGTGCATGG + Exonic
1151373567 17:73666621-73666643 CCAGGCCCAGGGCAGGGGCAGGG + Intergenic
1151477146 17:74350599-74350621 CCAGGCACAGGGGTGGGGCCTGG - Intronic
1151555270 17:74843315-74843337 CCAGACCGCGGGGTCGGGCAGGG + Exonic
1151712915 17:75817070-75817092 CCAGGCCCGGGGGTGGGGTAGGG + Intronic
1152089928 17:78240686-78240708 AGAGACCTAGGGGTGGGGCAGGG - Exonic
1152109252 17:78348252-78348274 CCAGACCCTGGGGGGTTGCAGGG - Intergenic
1152279871 17:79378992-79379014 TCAGACCCAGGGCTGGGACACGG - Intronic
1152291933 17:79444653-79444675 CTAGACCCAGGGCTTGTGAAAGG - Intronic
1152425621 17:80217019-80217041 CCTGCCCCAGGTGAGGTGCAAGG - Exonic
1152518302 17:80838872-80838894 CCAACCCCAGGGGTGCTGGAAGG + Intronic
1152670859 17:81605130-81605152 CCAGAGCCAGGCGTGGTGGCGGG + Intronic
1153184260 18:2469410-2469432 CCAAAACCAGAGGTGGTTCAAGG + Intergenic
1153964426 18:10167003-10167025 AAAGACCCAGGGGTGGGGCCGGG - Intergenic
1156498314 18:37540578-37540600 CCAGACGCAGCAGTGGGGCAGGG + Intronic
1159900292 18:74038859-74038881 CCTGGCCCTGGGGTGGTTCAGGG + Intergenic
1160874636 19:1291345-1291367 TCAGTCCCCGGGATGGTGCAAGG - Intronic
1161043639 19:2123110-2123132 CCAGTCCCAGGGGAGATGCAGGG - Intronic
1161064729 19:2232033-2232055 CCAGACTGAGGGGTGGTGTGTGG + Exonic
1161711648 19:5851867-5851889 CCAGACCCAGGGAGAGTGCAGGG + Intergenic
1161965120 19:7543491-7543513 CCCGACCCAGGGCTGGTTCATGG - Intronic
1162016905 19:7851062-7851084 TGAGACCCAGAGGTGGAGCATGG - Intronic
1162958565 19:14113198-14113220 CTAAACCCAGGGGTGGGGGAGGG + Intronic
1163612338 19:18308035-18308057 CCAGCCCCAGGGATGGGGAAGGG + Intronic
1164648395 19:29874923-29874945 GGAGACCCAGGCTTGGTGCATGG + Intergenic
1165230080 19:34381330-34381352 CCAGAGCCAGGGATGGGGCAGGG - Intronic
1165434771 19:35789806-35789828 CCAGACCCAGGGCTGGGTCCTGG + Intergenic
1165738925 19:38194193-38194215 CCACACTTGGGGGTGGTGCATGG + Intronic
1166893361 19:46008177-46008199 CCAGACCCCGTGGTTCTGCAGGG + Exonic
1167323884 19:48812511-48812533 CTGGACCCAGGGGGGGGGCAGGG - Intergenic
1167552208 19:50169074-50169096 TCACACCCACGGGTGGGGCACGG + Intergenic
1167638741 19:50668836-50668858 CCAGAGCCAGGCGGGGTGGAGGG + Exonic
1167829403 19:52007467-52007489 CAAGACCAAGGGGTGATGGAAGG + Intronic
1168258195 19:55178725-55178747 CCGGATCAAGGGGTGTTGCATGG - Intronic
1168419652 19:56192991-56193013 TCTGACCCAGGGCTGTTGCAGGG + Exonic
1168492430 19:56821936-56821958 CCAGACCCAGGGCAGGGCCAGGG + Intronic
1202689629 1_KI270712v1_random:77822-77844 CCAGACCACGGGGAGGTCCAGGG + Intergenic
925027533 2:621387-621409 CCAGACCCAGCGCCGGTGCCGGG + Intergenic
927214771 2:20662063-20662085 CCAGACCCAGAGAGGGTGGATGG + Intergenic
927842326 2:26453582-26453604 CCAGAACCAGGGGAGCTGGATGG + Intronic
930160977 2:48155941-48155963 TCAGGCCCTGGGATGGTGCATGG - Intergenic
930421945 2:51165264-51165286 CCAGGCTCAGGGCTGGTGCTGGG + Intergenic
931297808 2:60946697-60946719 CCAGGTCCTGGGGTGGGGCAGGG + Intronic
931575981 2:63719293-63719315 CCAGAACCCTGGGTGGTGCAGGG + Intronic
931809811 2:65843958-65843980 CTAGACCAGGGGGTGGTGCAGGG + Intergenic
932849541 2:75171381-75171403 CCAGGCCGAGGTGTGCTGCAGGG + Intronic
933956790 2:87378200-87378222 CCAGACCACGGGGAGGTCCAGGG - Intergenic
934089982 2:88542832-88542854 GCAGACCCTGGGGAGGTGCCTGG + Intergenic
934272260 2:91546532-91546554 CCAGACCACGGGGAGGTCCAGGG + Intergenic
935633909 2:105235245-105235267 CCAGATCCATGGGAGATGCAGGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936064088 2:109317461-109317483 CCAGACCCAGGGGAAGAGCAGGG - Intronic
936148299 2:109996442-109996464 CCAGACCATGGGGAGGTCCAGGG + Intergenic
936196378 2:110374926-110374948 CCAGACCATGGGGAGGTCCAGGG - Intergenic
937028472 2:118718624-118718646 TGAGACCCATGGGTGGTCCATGG + Intergenic
937202100 2:120210285-120210307 CCAGAGCCAGGGGCGAAGCAGGG + Intergenic
938810044 2:134844515-134844537 CCTGACCGAGGGGTGGGGTACGG + Intronic
938950749 2:136252254-136252276 AGAGACCCAGGGCTGGAGCAAGG - Intergenic
939865045 2:147463113-147463135 GGAGACCCAGGGCTGTTGCATGG - Intergenic
939919211 2:148087558-148087580 CCAGACTCTGGGCTGGTGCTGGG - Intronic
939997381 2:148932517-148932539 CCATACCCAGGGTTGGCGCTGGG + Intronic
940589455 2:155702658-155702680 CCAGATCCAGGGGAGGAGAAAGG - Intergenic
941951283 2:171160169-171160191 CCAGACCCTGGGGTGGGGGATGG - Intronic
942009927 2:171751261-171751283 CCAGAACCAGTAGTGGTCCATGG - Intergenic
942190157 2:173461732-173461754 CCAGCCCCAAGAGAGGTGCAGGG + Intergenic
943876411 2:193072766-193072788 CCAGGCCCACAGGTGGTGCTTGG + Intergenic
944338795 2:198570001-198570023 CAAGGCCCAGGGGTGGCCCAGGG + Intronic
944392315 2:199229762-199229784 CCAGGCACAGGCGGGGTGCATGG - Intergenic
944486204 2:200208371-200208393 CCAGAGCCTGGAGTGGGGCATGG + Intergenic
946208064 2:218125046-218125068 CCAGACTCTGGGCTGGTGCTAGG + Intergenic
947523476 2:230865246-230865268 CCAGAGCCCGGGGTGGAGCAGGG + Intronic
948622445 2:239244823-239244845 CCAGGCCCAGGGGTAGTGCCAGG - Intronic
948730615 2:239961535-239961557 GCAGACACAGGGGTGGGGCTGGG + Intronic
948947809 2:241230031-241230053 CCAGAGGCAGGCGAGGTGCAGGG - Intronic
949075804 2:242057033-242057055 ACAGACCCAGGGGAGCTGCTGGG + Intergenic
1173424731 20:42932688-42932710 CCAGAGCCTGGGCTGGTGCTGGG - Intronic
1173663039 20:44747065-44747087 CAAGCCCCAGGGGGGGTGCCGGG - Intronic
1175232245 20:57481351-57481373 CCAGACCCAGGGGAGGGGAGTGG + Intergenic
1175794641 20:61764109-61764131 CAAGACCCAGGCGGGGAGCAGGG + Intronic
1176041667 20:63068930-63068952 CCAGAGCCGGGGGTGGTGGGTGG - Intergenic
1176386068 21:6139073-6139095 CCAGCCCCAGGACCGGTGCACGG + Intergenic
1179447785 21:41445291-41445313 CCAGACCCGGGGGAGGTGCAGGG - Intronic
1179494710 21:41764266-41764288 CCTGGCCCAGGGGAGCTGCAGGG + Intronic
1179737405 21:43399179-43399201 CCAGCCCCAGGACCGGTGCACGG - Intergenic
1179783644 21:43718263-43718285 CCGTTCCCCGGGGTGGTGCAGGG + Intergenic
1180092841 21:45541847-45541869 CCAGACCCGGGGGTGGGACTTGG + Intronic
1180551790 22:16546741-16546763 CCAGACCATGGGGAGGTCCAGGG - Intergenic
1180831644 22:18909903-18909925 CCAGACCCAGGGCAGCTGGAGGG - Intronic
1180977280 22:19855274-19855296 CCAGACACTGGGGTGCTGCTGGG + Intergenic
1181050055 22:20234191-20234213 CCAGGCCCAGAGGTGGGGCCAGG + Intergenic
1181352216 22:22267182-22267204 CCAGACCATGGGGAGGTCCAGGG + Intergenic
1181492482 22:23269198-23269220 GCAGACCCAGGGGTGTGGCTGGG - Intronic
1182042556 22:27249697-27249719 CCAGGCTCAGGAGTGGTGCTAGG + Intergenic
1183019851 22:35018371-35018393 TCAGAGCCAGGGGTGCTGCCAGG + Intergenic
1183271895 22:36867522-36867544 CCATACCCAGGGATGGTACGTGG - Intronic
1183942848 22:41305865-41305887 CCAGCCCCAGAGGCGGTGCCAGG + Intronic
1184291033 22:43498334-43498356 CCTTACCCAGTGGTGGTCCATGG - Exonic
1184773189 22:46609944-46609966 CCACACTCAGGGGTGCTGGAAGG - Intronic
1184816632 22:46876800-46876822 CCACCCCCAGGGCTGCTGCAGGG + Intronic
1185218993 22:49619522-49619544 CCAGACCCAGGGCAGGTCCAGGG + Intronic
950442085 3:13016087-13016109 GGGGACCCAGGGGTGGTGCCAGG + Intronic
950709610 3:14804962-14804984 CCTGACCCATGGGGGCTGCATGG - Intergenic
951037676 3:17951622-17951644 CCAGACAGAGGTGTGCTGCAGGG + Intronic
951179631 3:19644314-19644336 CCTGACCCACTGGTGGTGGATGG - Intergenic
953391273 3:42535268-42535290 CTGGAGCCAGGGGTGGGGCAGGG + Intronic
953447992 3:42983780-42983802 CCTGACCCAGGCTTTGTGCAGGG + Intronic
953874909 3:46661149-46661171 CCAGACCCAGGGGTGAAGGGAGG - Intergenic
954397394 3:50299933-50299955 GCAGATTCAGGGGTCGTGCAGGG + Exonic
954435143 3:50491920-50491942 CCAGACCCAGGATTGGTGCAGGG + Intronic
955192897 3:56778362-56778384 CCAGGCCCTGGGGTAGGGCATGG - Intronic
956149424 3:66225220-66225242 CCAGGCCGAGGTGTGCTGCAGGG - Intronic
956246266 3:67186618-67186640 CCAGACAGAGGTGTGCTGCAGGG - Intergenic
961186779 3:124921959-124921981 CAAGACCATGGGGTGGTCCAAGG + Intronic
961316018 3:126036256-126036278 ACAGGCCCAGAGCTGGTGCAAGG - Intronic
961449617 3:126996623-126996645 CCTGACCCAAGGGAGGTGCAGGG + Intronic
961635941 3:128332697-128332719 GCAGCCCCAGAGGTGGTGCTGGG + Intronic
961684591 3:128620825-128620847 TGAGGCCCAGGGATGGTGCAGGG - Intronic
961710391 3:128823871-128823893 CCAGAGCCATGGGTGGTGGAAGG - Intergenic
962735473 3:138321723-138321745 CCAGACACAGGGGTGGCAGAGGG + Intronic
964624719 3:158748135-158748157 CCAGACCCAAGGGTCGTGTAGGG + Intronic
964813815 3:160695077-160695099 CAAGGCCCAGGGGTGGGGCTAGG - Intergenic
968282147 3:197485099-197485121 CAGGACCCAGGGGTGGGGAATGG - Intergenic
968484462 4:852255-852277 GCAGACCCAGGGCTTGTCCACGG + Intronic
968612630 4:1564065-1564087 CCAGTGCCAACGGTGGTGCAGGG - Intergenic
968636964 4:1685494-1685516 CCAGCCCCAGGGGTGCTGCATGG - Intergenic
968688768 4:1978928-1978950 CCGGATCCAGGGGCGGTGCAGGG + Exonic
969701077 4:8768136-8768158 GCAGACCCATGGGTGGGGCCCGG - Intergenic
971266182 4:25097810-25097832 CCAGACACAGGGCAGGTGCTAGG + Intergenic
972872138 4:43313186-43313208 CCAGACAGAGGTGTGCTGCAGGG + Intergenic
975623298 4:76315811-76315833 CCAGACTCGGGGCTGGTGCTGGG - Intronic
975698857 4:77042544-77042566 GCATACCCAGGGCTGGTGAAGGG + Intergenic
982508414 4:156249985-156250007 GAAGAGCCAGAGGTGGTGCAGGG - Intergenic
982959793 4:161822614-161822636 CCAGACCTAGGGCTGGGCCAGGG - Intronic
984078431 4:175213420-175213442 CTAGCTCTAGGGGTGGTGCAGGG - Intergenic
984842281 4:184079683-184079705 CCAGACGCTGGGGAGGTGCAAGG - Intergenic
987507496 5:18792854-18792876 CCAGACACAGGTGAGGTGCCTGG + Intergenic
993985751 5:94595232-94595254 CCAGACAGAGGTGTGCTGCAGGG - Intronic
994304108 5:98181057-98181079 CCAGACTCAGGGCTGGTACTGGG - Intergenic
994839916 5:104910294-104910316 CCACACACGGGGGTGGTGGAAGG + Intergenic
995703579 5:114961963-114961985 CCAGACAGAGGTGTGCTGCAGGG - Intergenic
997271389 5:132541190-132541212 CCAGAACCTGGGATGGTGCAGGG - Intergenic
997468896 5:134105689-134105711 CCACACCCAGGGAAGCTGCATGG + Intergenic
997716012 5:136043657-136043679 TCAGAGCCAGAGCTGGTGCAGGG + Intronic
998093747 5:139385295-139385317 CCAGACCTAGGTGGGGTCCAGGG + Intergenic
999354415 5:150911275-150911297 CCAGACCTCAGGGTGGTGCTTGG - Intergenic
999575597 5:152973101-152973123 CCAAACTCAGTGATGGTGCAAGG - Intergenic
999745036 5:154585447-154585469 CCAGACCTGGGGGTGCAGCAGGG - Intergenic
1000097964 5:157987536-157987558 CCAGGCCCAGGGGGAGCGCATGG - Intergenic
1001319517 5:170668835-170668857 CCAGAAGCAAGTGTGGTGCAGGG - Intronic
1001433328 5:171680674-171680696 CCAGCCACAGGGGTGGGGCTGGG - Intergenic
1002320576 5:178373200-178373222 CCAAACCCAGTGGGGGTCCAAGG - Intronic
1003240796 6:4344105-4344127 GCAGACCCAGGGTGGGTGCTAGG + Intergenic
1003486264 6:6582287-6582309 GCAGAGCCAGGGGTTGGGCAGGG + Intergenic
1003698865 6:8440022-8440044 AAAGAGCAAGGGGTGGTGCAAGG - Intergenic
1006193614 6:32223845-32223867 TCAGACCCAGAGGTGAGGCATGG - Exonic
1006718639 6:36136082-36136104 CCATACCCAGGGATGGGACAGGG - Intronic
1007355280 6:41310474-41310496 CCAGTCCCAGGAGTGGTGGGGGG + Intergenic
1007691961 6:43708221-43708243 AAAGACCCAGGGATGGAGCAGGG + Intergenic
1007836965 6:44681435-44681457 CCAAGCTCAGGGGTGGAGCATGG + Intergenic
1008622295 6:53282440-53282462 CCACACCCAGGGGAGGGGAAGGG - Intronic
1014343183 6:120233749-120233771 CTAGACCCAAAGGTGCTGCAGGG + Intergenic
1017485542 6:154898780-154898802 CCACAGCCCTGGGTGGTGCAAGG - Intronic
1018049579 6:159997265-159997287 CTGGACCCAGGGGAGCTGCAGGG - Intronic
1021731182 7:23597256-23597278 TCTGACCCAGGGTAGGTGCAGGG + Intergenic
1022541920 7:31145744-31145766 GCAGTCCCAGTGGTGGTGCCTGG - Intergenic
1023866804 7:44242218-44242240 GCAGACCCACGGGTGCTTCAGGG + Exonic
1023996496 7:45161956-45161978 CCAGACCCAGGGGTGAGGACAGG + Intronic
1024532644 7:50406329-50406351 TGAGATCCAGGGGTGATGCAGGG - Intergenic
1025187974 7:56875719-56875741 CCTGACCCAGGGGTTGTTCTTGG + Intergenic
1025683948 7:63701205-63701227 CCTGACCCAGGGGTTGTTCTTGG - Intergenic
1025790233 7:64681549-64681571 CCAGACCCTGGGGTTGAGGAAGG - Intronic
1032784400 7:135188884-135188906 CCAGAGCCTGGGCTGGGGCAAGG - Intronic
1033906738 7:146214467-146214489 CCAGACACTAGGATGGTGCATGG + Intronic
1034400439 7:150858260-150858282 CCTGACCCTGGGGCTGTGCATGG + Intronic
1034416976 7:150970436-150970458 CCAGACCCCAGGGTGGGTCAAGG + Intronic
1034710902 7:153190696-153190718 CCAGGCCCAGAAGTGGCGCATGG - Intergenic
1035072238 7:156154052-156154074 CAACACCCTGGTGTGGTGCATGG - Intergenic
1035337307 7:158138249-158138271 CCACACCCAGGGGTGCTGCGGGG - Intronic
1035468276 7:159093803-159093825 CCGGACCCAGGGACGCTGCAGGG - Intronic
1035752639 8:2007369-2007391 CCGGGCCCAGGGGTGATACAGGG + Intergenic
1037228263 8:16622053-16622075 TCAGAACCAGGGGAGGTTCAGGG - Intergenic
1037643906 8:20773036-20773058 CTAGACCCAGGGGTGTAGAAGGG - Intergenic
1037781871 8:21874982-21875004 CCAGACCCAGGGGCGATGCATGG + Intergenic
1037916755 8:22777653-22777675 CCAGAGCCGGGGGTGGTGGCTGG + Intronic
1038265165 8:26033585-26033607 CCTGTCCGAGGGGTGGTGCAGGG + Intronic
1039899885 8:41743979-41744001 GCTGAGCCAGGGGTGGGGCAGGG + Intronic
1040110887 8:43566788-43566810 CCCGACCCGGGGGGGGGGCACGG - Intergenic
1041091939 8:54310150-54310172 CCAGACCCACAGGTGGTTTAAGG + Intergenic
1042539624 8:69895071-69895093 AGAGTCCCAGGGGTGATGCAGGG + Intergenic
1043370123 8:79581706-79581728 CCAGACTCATGAGTGGTGCCTGG - Intergenic
1044518392 8:93167257-93167279 CCTGACCCAGAGGTGGAGAATGG - Intergenic
1045178957 8:99759216-99759238 CAAGATCCAGGGCTTGTGCATGG - Intronic
1048443221 8:134475314-134475336 AGAGACCCAGGGCTGGTCCAAGG - Intergenic
1048956628 8:139542870-139542892 CCAGACCCAGGGCAGGGGCTTGG + Intergenic
1049300038 8:141864720-141864742 TCAGAGCAAGGGGTGATGCAGGG + Intergenic
1049353271 8:142175520-142175542 CCAGAGCCAGAGCAGGTGCAGGG - Intergenic
1049427321 8:142543259-142543281 CCAGACCCAGGGGACATGCCTGG - Intronic
1049613566 8:143566975-143566997 CCAGGCCCAAGGTTGGGGCATGG + Exonic
1049776503 8:144408305-144408327 CCAGGCCCAGGGATGGTGAGAGG - Intronic
1049776787 8:144409605-144409627 CCAGACCCAGGACGGCTGCAGGG + Intergenic
1051128725 9:13835282-13835304 CCAGACAGAGGTGTGCTGCAGGG + Intergenic
1051193201 9:14535762-14535784 CCAGAGCCTGGGGAGGTGCAGGG - Intergenic
1052689720 9:31802048-31802070 CCAGGCAGAGGGGTGCTGCAGGG + Intergenic
1053489678 9:38489155-38489177 CCAGGCCCAGAGGGGGTGCAGGG + Intergenic
1055170747 9:73255102-73255124 CCAGGCAGAGGGGTGCTGCAAGG + Intergenic
1055793615 9:79949961-79949983 GCAGACCCAGGGATGGAGAAGGG + Intergenic
1056870201 9:90270126-90270148 CCAGAGACAGGGGAGGTGCCAGG - Intergenic
1057498027 9:95575484-95575506 CCATTCCCACGTGTGGTGCACGG - Intergenic
1058866628 9:109167103-109167125 CCAGACCCCCGGGTGCTGCCGGG + Exonic
1060195919 9:121623239-121623261 TAACATCCAGGGGTGGTGCAGGG + Intronic
1061511989 9:131067220-131067242 CCAGACCCCAGGGTGGCACATGG + Intronic
1061949550 9:133928816-133928838 CCAGACGCAGGGCAGGTGGATGG + Intronic
1062139498 9:134948080-134948102 CCAGACGAAGGGGTAGTGGAGGG - Intergenic
1062433540 9:136536144-136536166 GTTGCCCCAGGGGTGGTGCAGGG - Intronic
1203445048 Un_GL000219v1:46125-46147 CCACACCCAGGCGTGGGGAACGG - Intergenic
1185831817 X:3310209-3310231 CCAGCCCCGGGAGGGGTGCAGGG + Exonic
1186878114 X:13837470-13837492 GCAGACCCAGGGGGGCTTCACGG + Intronic
1187126763 X:16461701-16461723 CGGGAGCTAGGGGTGGTGCAGGG + Intergenic
1189884391 X:45526052-45526074 CCAGACCCAAGGATGTTGTAAGG + Intergenic
1189917500 X:45870763-45870785 CCAGGCCCATTGGTGGTGCATGG - Intergenic
1190482303 X:50889607-50889629 CTAGACCCAGTGGTGCAGCAGGG + Intergenic
1190928512 X:54929491-54929513 CCAAAGCCAGTGCTGGTGCAGGG - Exonic
1191719888 X:64220528-64220550 ACTGAGGCAGGGGTGGTGCATGG - Intergenic
1192313620 X:70035632-70035654 CCAAACCCAGGGAAGGGGCACGG - Exonic
1192793970 X:74411558-74411580 GGAGACCTAGGGGTGGGGCACGG - Intergenic
1194252952 X:91600541-91600563 CCAGGCACAGGTGTGCTGCAGGG - Intergenic
1194281825 X:91962727-91962749 CCAGGCACAGGTGTGTTGCAGGG - Intronic
1195849078 X:109263906-109263928 CCAGGCCCTGGGTTGGTCCAAGG + Intergenic
1196218868 X:113088199-113088221 ACAGACTCAGGGTTGTTGCAGGG + Intergenic
1196313489 X:114196536-114196558 CCAGACAGAGGTGTGCTGCAGGG - Intergenic
1197776002 X:130119176-130119198 CCAGACCCTGGGATCGTCCAGGG + Intergenic
1199289473 X:146090186-146090208 CCAGGCCCAGGGGTGCAGCCTGG + Intergenic
1199782644 X:151076665-151076687 GCAGACCCAGGGCTGGTGGAGGG + Intergenic
1199866308 X:151853125-151853147 CCAGTCCAAGGTGTGCTGCAGGG + Intergenic
1200571888 Y:4841781-4841803 CCAGGCACAGGTGTGCTGCAGGG - Intergenic
1200599421 Y:5187381-5187403 CCAGGCACAGGTGTGTTGCAGGG - Intronic
1200951247 Y:8902089-8902111 CCACACCAAGGTGTGGTGCCAGG - Intergenic