ID: 920947123

View in Genome Browser
Species Human (GRCh38)
Location 1:210540053-210540075
Sequence CAGGACTTTAGGCAGAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920947123_920947130 15 Left 920947123 1:210540053-210540075 CCTAATTTCTGCCTAAAGTCCTG 0: 1
1: 0
2: 1
3: 13
4: 213
Right 920947130 1:210540091-210540113 CAATAGCCACCCTGATGACTTGG 0: 1
1: 0
2: 3
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920947123 Original CRISPR CAGGACTTTAGGCAGAAATT AGG (reversed) Intronic
902966934 1:20012011-20012033 GGGGACTTTAGGCAGTGATTAGG - Intergenic
903604773 1:24567703-24567725 CAGGACTTTAGAATTAAATTGGG - Intronic
905197170 1:36289368-36289390 TATGACTTTAGACATAAATTTGG - Exonic
905869790 1:41396645-41396667 CAGGACTCTAGGCAGAGATGTGG + Intergenic
909433081 1:75612415-75612437 CAGGCCTTAAGGTAGAAATGAGG - Intergenic
910192252 1:84606053-84606075 CAGGACCTTAGGCAGATAAATGG + Intergenic
910649532 1:89550743-89550765 AAGGAATTTAGGCAGAACTGTGG - Intronic
911115495 1:94241926-94241948 TGTGACTTTAGGCAGAAAGTTGG - Intronic
911184987 1:94894342-94894364 CTGGACTTTAGGCAGATAAGGGG - Intronic
911435408 1:97850244-97850266 CATGACTTTAATCAGATATTTGG - Intronic
911446270 1:97996741-97996763 CAGTACATTAAGCAGGAATTGGG + Intergenic
912326846 1:108773444-108773466 CAGGTCTTTATGTAGAAGTTTGG - Intronic
917639041 1:176964584-176964606 CAGGTATGTAGGTAGAAATTTGG + Intronic
919052002 1:192523096-192523118 CCTGACTCTAGGCAGCAATTTGG - Intergenic
919409500 1:197226569-197226591 CAGGCCTCTGGGCAGTAATTAGG + Intergenic
919588498 1:199469570-199469592 CAGGACTTTAGGAAGTGATTAGG - Intergenic
920947123 1:210540053-210540075 CAGGACTTTAGGCAGAAATTAGG - Intronic
921671361 1:217927378-217927400 CAGAACTCTAGACAGAAATTGGG - Intergenic
923301043 1:232640970-232640992 CAGTATTATAGGGAGAAATTGGG + Intergenic
923653269 1:235893304-235893326 TAGGAATTTCGGAAGAAATTAGG - Intergenic
924284683 1:242474355-242474377 CAGGACCTAAGACAGAAACTGGG + Intronic
924893530 1:248310684-248310706 CAGGAGTTTTAGGAGAAATTAGG + Intergenic
1063267768 10:4473529-4473551 CAGGACTATAGGCAATAACTAGG + Intergenic
1063673481 10:8118569-8118591 CAGGAGTGGAGGCAGAGATTGGG + Intergenic
1064307172 10:14177744-14177766 AAGGACTTTCGGAAGGAATTTGG + Intronic
1065567876 10:27033241-27033263 CAGGATTTAAAGAAGAAATTAGG - Exonic
1066115020 10:32232122-32232144 CAGTACCTAAGACAGAAATTTGG - Intergenic
1067063438 10:43089900-43089922 CAGGACTTGGGGCAGAGATCGGG + Intronic
1068117257 10:52748864-52748886 AAGGACTTGAGTGAGAAATTGGG + Intergenic
1069250470 10:66260104-66260126 CAGTACTTTAGGCAGATAAAGGG - Intronic
1070645528 10:78199607-78199629 CAGGACATTGGGCATAAATCAGG - Intergenic
1071404551 10:85317639-85317661 CAGGTCTATAGCCAGAGATTTGG - Intergenic
1071444280 10:85731402-85731424 GAGGTCTTTAAGCAGAATTTTGG - Intronic
1074717729 10:116235420-116235442 CAGGACTTTAGCAAGGGATTTGG - Intronic
1076684137 10:132189394-132189416 CAGAAGATTAGGCAGAAAGTAGG - Intronic
1079865729 11:25731284-25731306 CAGGTGTTTAGGGAGAGATTTGG - Intergenic
1080457284 11:32428766-32428788 CAGGACTTTCGGCAGGAAGACGG + Intronic
1082303008 11:50533537-50533559 CAGGAGCTTTGGAAGAAATTTGG - Intergenic
1085978211 11:81686935-81686957 AAGGACATTAGGCAGAACTAAGG - Intergenic
1087998940 11:104850406-104850428 CAAGAAATTAGACAGAAATTGGG - Intergenic
1088039805 11:105365886-105365908 CAGCACTTTTGGAAGCAATTTGG - Intergenic
1088194832 11:107262788-107262810 CAGGACTTCATGCAGAAGTAGGG + Intergenic
1088433301 11:109782427-109782449 CTGGGCTTTAGGCAGAAAACTGG - Intergenic
1088892518 11:114056400-114056422 CAGAATCTCAGGCAGAAATTGGG - Intergenic
1088983837 11:114888306-114888328 TAGGACTTTGGGCAGTGATTAGG - Intergenic
1089635515 11:119809156-119809178 CAGCACTTGAGGCAGAGATTTGG - Intergenic
1091803354 12:3339041-3339063 AAGGACTTCAGGCAGAAGATAGG + Intergenic
1091959998 12:4685659-4685681 CAGGACGTTAGGAGGAAGTTAGG - Intronic
1093175265 12:15906207-15906229 AAGGACTTGAGACAGAAATGAGG - Intergenic
1094542956 12:31377853-31377875 CTGGACTTTAGATATAAATTTGG - Intergenic
1095137152 12:38618670-38618692 GAGGAGTTGAGGCAGAAACTTGG - Intergenic
1095673739 12:44891749-44891771 CATGACATCAGGCAGAAAATTGG + Intronic
1096201643 12:49687863-49687885 GAGGACTTTAGGGAGATATTTGG - Intronic
1099508060 12:83503040-83503062 CAGGGCTGTAGACATAAATTAGG + Intergenic
1105707110 13:22974831-22974853 AAGGACATTAGGGAGAAATTAGG - Intergenic
1108419999 13:50238882-50238904 CAGGTCTTTGGCCAGAAATAAGG + Intronic
1110767648 13:79299255-79299277 CAGAAGTTTAGGTAGAAAATAGG + Intergenic
1111212339 13:85095667-85095689 CAGGACTTAGGTCAGAAATTTGG - Intergenic
1112892205 13:104251600-104251622 CAGGACTCTAAACACAAATTAGG + Intergenic
1113112241 13:106835776-106835798 CAGGACTGTAGCAAGCAATTTGG + Intergenic
1115717104 14:36118200-36118222 TATGACTTGAGGGAGAAATTTGG - Intergenic
1116103850 14:40475139-40475161 CAGGACTTTAGGCAAATAAAGGG - Intergenic
1116566619 14:46452817-46452839 AAGAATTTGAGGCAGAAATTAGG - Intergenic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1119441688 14:74632567-74632589 CAGGAATGTAGGCAGTAATGAGG - Intergenic
1119762166 14:77159217-77159239 CAGGGCGTTAGGCACCAATTGGG - Intronic
1120422795 14:84309466-84309488 CATGACTCTTGGAAGAAATTGGG - Intergenic
1120485673 14:85110989-85111011 CAGAACAATAGGCATAAATTAGG - Intergenic
1122580789 14:102770531-102770553 CAGGACTTTAGTCTGAGATGGGG - Intergenic
1125191924 15:37003632-37003654 CAATATTTTAGGAAGAAATTTGG - Intronic
1125192021 15:37004609-37004631 CAGGCCTTGAGGCAGAGATGTGG - Intronic
1125701450 15:41689020-41689042 CAGGGCTTTAGGAGAAAATTAGG - Intronic
1126350096 15:47736650-47736672 CAGGACTTTAAGCAGGATTTTGG + Intronic
1126520063 15:49582889-49582911 AAGGAATTAAGGCAGAAATCAGG + Intronic
1126526017 15:49655050-49655072 GAGGACTTTGGGAAGTAATTTGG - Exonic
1126686976 15:51256960-51256982 CAGGACAACAGGCATAAATTGGG - Intronic
1127068628 15:55266119-55266141 CAGGTCTTTGGGAAGTAATTAGG + Intronic
1127431733 15:58916675-58916697 CAGGCCTTTAGGTAGAAAGCTGG - Intronic
1129702060 15:77773869-77773891 CAGGACTTAAGGGAGAGAGTGGG - Intronic
1130396987 15:83511275-83511297 CAGGACTACAGGCAGAAGTAGGG + Intronic
1130563598 15:84977357-84977379 CTGGACTTTATCCAGTAATTGGG + Intergenic
1131722126 15:95181133-95181155 CAGGAATTTAGTGAAAAATTGGG + Intergenic
1132315959 15:100890680-100890702 CAGGACTGGAGGCAGAATCTTGG + Intronic
1137481246 16:48853434-48853456 CAAATCTTTATGCAGAAATTGGG + Intergenic
1137912509 16:52392351-52392373 CAGGATGGTAGGGAGAAATTTGG + Intergenic
1139814270 16:69655297-69655319 CAGTACTTCAGGCAGCATTTGGG - Intronic
1140056926 16:71533698-71533720 GAGGCCTGTAGTCAGAAATTAGG - Intronic
1143520701 17:7442766-7442788 CAGGAGCTTGGGCAGAAAGTGGG - Exonic
1147875641 17:43618581-43618603 CAGGGCTTTGGGCAGAAATAGGG + Intergenic
1149641299 17:58204612-58204634 TAGGACTTTGGGGGGAAATTAGG + Intronic
1150072392 17:62162875-62162897 GAGGTATTTAGGCAAAAATTAGG + Intergenic
1153705952 18:7746114-7746136 AAAGACATTAAGCAGAAATTTGG + Intronic
1154049484 18:10940500-10940522 CAGGACTTTATGAAGAATATAGG + Intronic
1155462525 18:26098936-26098958 CAGTACCTAAGACAGAAATTTGG + Intergenic
1156750907 18:40454007-40454029 TAGGACTTTATGTAGAAATAAGG + Intergenic
1156941860 18:42777314-42777336 CAGGACTGGAGACATAAATTTGG + Intronic
1157026214 18:43847079-43847101 CATTACTTTAGACATAAATTTGG + Intergenic
1157686445 18:49646324-49646346 CTGGACCCAAGGCAGAAATTTGG + Intergenic
1162194835 19:8976548-8976570 CAGGAGTTTGGGCAGAACTGGGG - Exonic
1163442834 19:17330192-17330214 CATGACCTTAGGCAGGAATCGGG + Exonic
1164749191 19:30638954-30638976 AAGGAGTTTAGGTAGAAAATGGG - Intronic
1165709995 19:38004251-38004273 CAGCAATTTAGGCAAAAAGTGGG + Intronic
1165718436 19:38062216-38062238 GGTGACTTAAGGCAGAAATTAGG - Intronic
1166143879 19:40821433-40821455 GAGGAATGTAGGTAGAAATTGGG + Intronic
1166183729 19:41125663-41125685 GAGGAATGTAGGTAGAAATTGGG - Intronic
1167765023 19:51476424-51476446 CAGGACCTGAGGCAGAATGTGGG + Intergenic
1168512710 19:56986222-56986244 AAGGACATTGGCCAGAAATTAGG - Intergenic
927372658 2:22374914-22374936 CTAGACTTTAGGAAGAAATAGGG - Intergenic
927894321 2:26771661-26771683 CAGCATATCAGGCAGAAATTAGG + Intronic
928499897 2:31879988-31880010 AAGGACTTTAGGGATTAATTAGG - Intronic
928826697 2:35430501-35430523 AAGGATTTGAGACAGAAATTTGG - Intergenic
928862143 2:35872022-35872044 CAGGAGTTTTGTCAAAAATTAGG - Intergenic
929229123 2:39541153-39541175 CAGGACTTGTGGAAAAAATTAGG - Intergenic
929446187 2:42003155-42003177 CAGGAATTTAGGCACAGCTTAGG - Intergenic
930620000 2:53633819-53633841 CAGCATTTGTGGCAGAAATTTGG - Intronic
932831592 2:74995641-74995663 CAGGGCTTCAGTCAAAAATTTGG + Intergenic
934694286 2:96387847-96387869 GGGGACTTTAGGCAGTATTTAGG + Intergenic
937484203 2:122297068-122297090 CAGGAGTTTAGGAAGAAAGATGG + Intergenic
937585150 2:123537811-123537833 CAGTTCTATAGGCAGAAAATAGG - Intergenic
938009948 2:127820879-127820901 CAGGACTTTAGGCAAATAAAGGG + Intergenic
938658598 2:133462334-133462356 CAGGAATTTAGAAAGAAAGTGGG - Intronic
939507352 2:143062922-143062944 GAGGACTTGAGGCAAAGATTTGG - Intergenic
939716150 2:145586640-145586662 CAAGTTTTTAGGCAGAAATCAGG - Intergenic
941952311 2:171168520-171168542 CAGGACTTTGGGGGCAAATTAGG + Intronic
947088893 2:226487706-226487728 CAGGAATTGAGCCAAAAATTAGG - Intergenic
947171834 2:227320353-227320375 CAGGACTTTAGAGAGACAGTAGG + Intergenic
1169935412 20:10878274-10878296 CAGGACTTTGGGGATGAATTAGG + Intergenic
1170717216 20:18842302-18842324 AAGGACTATAGGCATAAACTGGG + Intergenic
1173465683 20:43279344-43279366 AAGAACTTCAGGCAGAAATAAGG - Intergenic
1174080260 20:47966253-47966275 CAGGACTGTATCCAGATATTTGG + Intergenic
1174795462 20:53518728-53518750 AAAGACTTAAAGCAGAAATTTGG + Intergenic
1174798506 20:53542530-53542552 AAAGACTTAAAGCAGAAATTTGG + Intergenic
1174805147 20:53598797-53598819 CAGGACTTGAGGCTGGAGTTAGG - Intronic
1175603509 20:60294278-60294300 CTGGACTGTGGGCAGAAGTTTGG - Intergenic
1182501914 22:30754147-30754169 CTGGACTTCAGCCAAAAATTGGG + Intronic
1183855274 22:40628915-40628937 CAGGTGTTAAAGCAGAAATTGGG - Intronic
1183924521 22:41196780-41196802 CAGGACTTTAGAAAGACGTTTGG - Intergenic
1184305718 22:43600207-43600229 CAGGAATTTTTACAGAAATTGGG - Exonic
952225920 3:31375663-31375685 CAGAACCTGAGGCAGAGATTTGG - Intergenic
953696011 3:45160054-45160076 CAGTGCCTAAGGCAGAAATTTGG - Intergenic
955380749 3:58435843-58435865 CAGGGCTAAAGGTAGAAATTTGG + Intergenic
955757184 3:62237206-62237228 AAGGCCTTTATGCAGAAATTTGG + Intronic
956045266 3:65189483-65189505 CAGGGCTTGAGTCAGAAATAGGG + Intergenic
957781339 3:84821496-84821518 CAGGACTTTGGGAAGAAATTAGG + Intergenic
958425517 3:93974233-93974255 GAGGACTTTAGGAAGAACTATGG + Intergenic
962652269 3:137508851-137508873 CAAGACTTTAGGTGGAAAGTTGG + Intergenic
966107081 3:176348932-176348954 CAGGATTTTTTGCAGAAATTTGG + Intergenic
968972783 4:3804564-3804586 TAGGACTGTAGGCAGATATGGGG + Intergenic
969499842 4:7546068-7546090 CAGGACCTTTGGGAGGAATTAGG - Intronic
970083809 4:12322165-12322187 CAAGACATTAGGAAGAAAATTGG - Intergenic
970572576 4:17397453-17397475 TAGGTCTCTAGGCAGAAATAGGG - Intergenic
970581975 4:17481796-17481818 CAGCACTTGAGGAACAAATTTGG - Intronic
975021141 4:69490451-69490473 CAGAACTTTCTGCAGAGATTTGG + Intronic
976390970 4:84503083-84503105 CAGCACTTAAGGTAGAGATTTGG + Intergenic
978981185 4:114947647-114947669 TAGTACTGTAGGCAGAAATGTGG + Intronic
981294678 4:143117951-143117973 CAGGAATGTAGGTAAAAATTTGG + Intergenic
983530713 4:168807220-168807242 AAAGGCTTTAGGGAGAAATTTGG + Intronic
1202768277 4_GL000008v2_random:171257-171279 CAGACCTTTAGATAGAAATTGGG - Intergenic
986773690 5:10995114-10995136 CAGGGCTGGAGGCAGAATTTTGG + Intronic
986895278 5:12358330-12358352 CAGGGCTTTAAGTAGAAGTTAGG - Intergenic
988218456 5:28310033-28310055 TATGACTGGAGGCAGAAATTTGG + Intergenic
990394717 5:55365442-55365464 CAGGATTTTATGCAGAAAAAGGG - Intronic
991624940 5:68591074-68591096 CACGACTTTAGGCAAGAAATGGG + Intergenic
992624372 5:78623957-78623979 CAGGCCTTTAGGAAGTGATTTGG - Intronic
996487853 5:124057745-124057767 CAGGACAACAGGCATAAATTGGG + Intergenic
996512953 5:124337948-124337970 GAGGCCATTAGGCAGTAATTAGG - Intergenic
996657411 5:125957995-125958017 AAGGAATTTAGGCATGAATTAGG + Intergenic
997185440 5:131877333-131877355 GAGGCCTTTAGGGAAAAATTTGG - Intronic
997479218 5:134170889-134170911 CAAGTATTTAGGCAGCAATTCGG + Intronic
998563028 5:143189250-143189272 AAGGAGCTTAGGCAGAAATGGGG + Intronic
1000554073 5:162702208-162702230 TAGGACTTCAGGTACAAATTTGG + Intergenic
1001309045 5:170597591-170597613 CAGGATTGAAGGCAGTAATTGGG - Intronic
1004140895 6:13015917-13015939 CATGAAATTAGGCAAAAATTAGG - Intronic
1004556915 6:16707135-16707157 CAGCACTTGAGACAGAAATGTGG + Intronic
1008924407 6:56876911-56876933 CAGGAATTTAGGCAGTAAGCTGG - Intronic
1009532730 6:64841967-64841989 CTGGAATTTATGAAGAAATTGGG - Intronic
1012641590 6:101624627-101624649 CTGAGCTTTAGGCATAAATTAGG - Intronic
1012964710 6:105661141-105661163 TAGGACGATAGGCATAAATTTGG + Intergenic
1014024619 6:116631085-116631107 CAGGACATTAAGTAGTAATTTGG + Intronic
1016080161 6:139845823-139845845 AAAGACTTTAGGTGGAAATTTGG - Intergenic
1016512206 6:144856069-144856091 CAGGCCTTTGGGCTGAGATTGGG - Intergenic
1018216783 6:161536077-161536099 AAGGACTTTGGGCAGATATTGGG - Intronic
1019793295 7:3031570-3031592 CAGGACTTGGGGCAGTAAATGGG - Intronic
1021935545 7:25627530-25627552 CAGGACAATAGGCACAAATCAGG + Intergenic
1021993178 7:26155719-26155741 CATGACTTTGGGGAGAAAATGGG + Intronic
1023037109 7:36141620-36141642 CACAACTTTAGGCTGAATTTTGG - Intergenic
1023485486 7:40681859-40681881 CAGGCCCTCAGGAAGAAATTTGG + Intronic
1023757460 7:43432726-43432748 GAGCAATTTAGGCAGAGATTAGG - Intronic
1024409476 7:49023612-49023634 AAGGACTTTAGGAAGACTTTAGG - Intergenic
1024905600 7:54375484-54375506 CAGGACTGTAGATAGGAATTTGG - Intergenic
1026439256 7:70429449-70429471 CAGGCTTTTAGGTAGAAACTTGG + Intronic
1026554724 7:71397312-71397334 CTGGACTTAAGGCAAAAATCTGG + Intronic
1028116003 7:86998476-86998498 CAGGACTAGATGCAGAAGTTAGG - Intronic
1028938268 7:96489940-96489962 CATGACTTTACTCAGAAATAGGG - Intronic
1031559915 7:123226059-123226081 CAGGAGTTTAGGAAGAAAAGTGG + Intergenic
1031829358 7:126607934-126607956 TAGGACTTTTCACAGAAATTTGG - Intronic
1039273582 8:35909906-35909928 CAGGATTTTAGGAAGTTATTAGG - Intergenic
1040571149 8:48612444-48612466 TAGGAAATTGGGCAGAAATTTGG + Intergenic
1040604083 8:48912338-48912360 CAGGATTTCTGGAAGAAATTGGG + Intergenic
1041420368 8:57661149-57661171 CAGGAGTTTAGCCTGAGATTCGG - Intergenic
1041505334 8:58591198-58591220 CATGACTGCAGGCAGAAATGTGG + Intronic
1041719227 8:60961323-60961345 CATGAGCTTAGGCAGTAATTTGG + Intergenic
1042760577 8:72267852-72267874 CAGGACTTTAGGCAAATAAAGGG - Intergenic
1044373199 8:91438560-91438582 CAGTACTTCAAGCAGAATTTGGG - Intergenic
1044747872 8:95388724-95388746 CAGTGCTTTAAGCAGAAAGTAGG - Intergenic
1045748043 8:105446910-105446932 CAGGAGATTAGGGAGAAAGTAGG + Intronic
1045769989 8:105725561-105725583 CAGTACTTCAGGCATAAATCAGG + Intronic
1047641986 8:126830469-126830491 CAGGAATTCAGGCAGGAAATGGG + Intergenic
1047911331 8:129533163-129533185 CAGAAATAGAGGCAGAAATTAGG + Intergenic
1048489512 8:134879820-134879842 GAGGTCTTTGGGCAGTAATTAGG - Intergenic
1051390967 9:16562747-16562769 TTGGACTTTAGGAAAAAATTAGG - Intronic
1053755968 9:41308845-41308867 AAGGACTTAAAGCAGAAAGTAGG + Intergenic
1055783899 9:79851442-79851464 CAGGATTCAAGGAAGAAATTAGG + Intergenic
1056913437 9:90724741-90724763 CAGGAGGTTAGGCAGAAAAGAGG + Intergenic
1057489013 9:95507749-95507771 CAGGAGTTTAGGCTGCAAATAGG + Intronic
1058080754 9:100698935-100698957 CAGGATATCAGGCATAAATTGGG + Intergenic
1058109872 9:101020604-101020626 CAGGATATTAGGCTGACATTGGG - Intergenic
1058188474 9:101884504-101884526 CATGGCTTTAGGCAGAGATGTGG + Intergenic
1059802308 9:117762885-117762907 CAGGACTGGAGGCAGAGATATGG + Intergenic
1060262599 9:122089698-122089720 CAGGACTTCATGCAGTAATGAGG + Intronic
1186712586 X:12215772-12215794 TAGGCCTTGAGGCAGAAATGTGG - Intronic
1187343589 X:18442865-18442887 CAGGGTTTAAGCCAGAAATTTGG + Intronic
1189124780 X:38434908-38434930 GGGGACTTTAGGCAGTCATTAGG - Intronic
1189305094 X:39980922-39980944 AAAGACTTAAGGCAGAAATGAGG + Intergenic
1189338845 X:40188636-40188658 GAGGACTTTAGGCAGCAAGCAGG + Intergenic
1190326165 X:49208385-49208407 GAGGCCTTCAAGCAGAAATTTGG - Intronic
1190406007 X:50088414-50088436 CAGAACTGGAGGCAGAAATTGGG - Intronic
1192243878 X:69357681-69357703 CAGGATATTAGGCTGAAACTCGG - Intergenic