ID: 920947123

View in Genome Browser
Species Human (GRCh38)
Location 1:210540053-210540075
Sequence CAGGACTTTAGGCAGAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920947123_920947130 15 Left 920947123 1:210540053-210540075 CCTAATTTCTGCCTAAAGTCCTG 0: 1
1: 0
2: 1
3: 13
4: 213
Right 920947130 1:210540091-210540113 CAATAGCCACCCTGATGACTTGG 0: 1
1: 0
2: 3
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920947123 Original CRISPR CAGGACTTTAGGCAGAAATT AGG (reversed) Intronic