ID: 920947335 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:210542028-210542050 |
| Sequence | AAGAGAAAGCAGAAGGAAGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2489 | |||
| Summary | {0: 1, 1: 1, 2: 29, 3: 283, 4: 2175} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 920947335_920947339 | 2 | Left | 920947335 | 1:210542028-210542050 | CCTCCTTCCTTCTGCTTTCTCTT | 0: 1 1: 1 2: 29 3: 283 4: 2175 |
||
| Right | 920947339 | 1:210542053-210542075 | CCTCTCCCTTGATGTCCCTTTGG | 0: 1 1: 0 2: 2 3: 17 4: 208 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 920947335 | Original CRISPR | AAGAGAAAGCAGAAGGAAGG AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||