ID: 920947335

View in Genome Browser
Species Human (GRCh38)
Location 1:210542028-210542050
Sequence AAGAGAAAGCAGAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2489
Summary {0: 1, 1: 1, 2: 29, 3: 283, 4: 2175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920947335_920947339 2 Left 920947335 1:210542028-210542050 CCTCCTTCCTTCTGCTTTCTCTT 0: 1
1: 1
2: 29
3: 283
4: 2175
Right 920947339 1:210542053-210542075 CCTCTCCCTTGATGTCCCTTTGG 0: 1
1: 0
2: 2
3: 17
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920947335 Original CRISPR AAGAGAAAGCAGAAGGAAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr