ID: 920949245

View in Genome Browser
Species Human (GRCh38)
Location 1:210557061-210557083
Sequence CTGAATGAGCTGGAGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920949235_920949245 15 Left 920949235 1:210557023-210557045 CCCACACTCACAGCAGGGCTGAA 0: 1
1: 0
2: 1
3: 12
4: 218
Right 920949245 1:210557061-210557083 CTGAATGAGCTGGAGGAGCATGG 0: 1
1: 0
2: 4
3: 39
4: 311
920949236_920949245 14 Left 920949236 1:210557024-210557046 CCACACTCACAGCAGGGCTGAAG 0: 1
1: 0
2: 0
3: 25
4: 248
Right 920949245 1:210557061-210557083 CTGAATGAGCTGGAGGAGCATGG 0: 1
1: 0
2: 4
3: 39
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920949245 Original CRISPR CTGAATGAGCTGGAGGAGCA TGG Intronic
900344215 1:2203448-2203470 TGGACTGAGCTGGAGCAGCAGGG - Intronic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902694892 1:18133607-18133629 CTGAAGGAGATGGTGGTGCAAGG - Intronic
902809743 1:18881344-18881366 CAGAATGAACTGGAGGAGTCAGG - Intronic
903829975 1:26168953-26168975 CTCAATGAACTGGAGCAGGAAGG + Intergenic
903918884 1:26785515-26785537 CTGAGTGTAATGGAGGAGCAAGG - Intergenic
904091280 1:27946637-27946659 CTGCAGGAGGTGGTGGAGCAGGG + Intronic
904444704 1:30559632-30559654 CTGAGTGAGATGGAGCAGGATGG + Intergenic
904889814 1:33771313-33771335 CACAAGGACCTGGAGGAGCAGGG - Intronic
904909454 1:33922876-33922898 ATGGATGGGCTGGAGGAGGAAGG - Intronic
905132326 1:35770148-35770170 CTGGGGGAGCTGGAGGTGCACGG + Intergenic
906613578 1:47219967-47219989 CTCAATGACCAGGAGGAGGAGGG - Exonic
906694137 1:47812762-47812784 CAGAATGATATAGAGGAGCATGG + Intronic
906953007 1:50349615-50349637 CTGAATGAGCTGGAGAAGAGTGG - Intergenic
907407630 1:54263385-54263407 CCGAATGAACCGGAGGAGCTGGG - Intronic
907931040 1:59000469-59000491 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
908361643 1:63374175-63374197 CTGAATGAGTTCGAGGAATATGG + Intronic
908395599 1:63722667-63722689 CTGAAGGAGCTGTAGGACCTGGG - Intergenic
908471529 1:64448741-64448763 CTGAAATAGCTGGAGGAGAAGGG + Intergenic
909354865 1:74696942-74696964 CTGAATGAGGTCAAAGAGCAGGG + Intergenic
909432842 1:75609603-75609625 CTAAATGAACTAGAGGAGCCAGG + Intronic
910991994 1:93066362-93066384 CTGGGTGAGCTGGAGGTGCCTGG + Intergenic
911315722 1:96354511-96354533 CTGAATGAGATGAGGCAGCATGG - Intergenic
911674071 1:100638980-100639002 CTGAATGATCTGGAGGAAGCAGG + Intergenic
912953989 1:114139853-114139875 CTGGATGCCCTGGAGGAACAAGG - Exonic
913161148 1:116147135-116147157 CAGAAGGAGCTGAAGAAGCAGGG - Intergenic
913332696 1:117680465-117680487 ATGAATGAGCAGGAAGGGCAGGG - Intergenic
915932617 1:160069717-160069739 CTGTATTAACTAGAGGAGCAGGG + Intronic
916273235 1:162966727-162966749 CTGAATGAGGTGGAGAGCCATGG + Intergenic
916696052 1:167237685-167237707 CTCAATTAACTGGAGGAACAGGG - Intronic
916840338 1:168594119-168594141 CTGAAGGAGGGAGAGGAGCAAGG + Intergenic
917716584 1:177744527-177744549 ATGAATGAGCTGGAGTAACATGG - Intergenic
918439013 1:184546961-184546983 CTGGCTGATCTGGAGGATCAGGG + Intronic
919800403 1:201350654-201350676 AAAAATCAGCTGGAGGAGCAGGG - Intergenic
920436182 1:205948454-205948476 CTGAGAGAGCTGGAGAAGCATGG + Intergenic
920782094 1:209003648-209003670 CTGAAGGAGATGGAGAAGAAAGG + Intergenic
920949245 1:210557061-210557083 CTGAATGAGCTGGAGGAGCATGG + Intronic
921656934 1:217750771-217750793 CGGAATGTGCTAGAGCAGCATGG + Intronic
922130114 1:222769243-222769265 CTGCCTGTGCTGCAGGAGCAAGG + Intergenic
922251866 1:223856582-223856604 CTGGGGCAGCTGGAGGAGCACGG + Intergenic
922698907 1:227746556-227746578 CTGCATGAGCTGCAGGAACCAGG + Intronic
923204120 1:231741621-231741643 CTTAGGGAGCTGGTGGAGCAGGG + Intronic
923520358 1:234730718-234730740 CTGTAGGAGCTGGTGCAGCATGG - Intergenic
924055172 1:240118003-240118025 CTGAATGAGATGAAGGAGTGAGG + Intronic
924853018 1:247849761-247849783 CTGAATGAACTGCAGGCACATGG - Intergenic
1063046182 10:2394435-2394457 CAGAATCCGCTGGAGGAGGAAGG + Intergenic
1063282517 10:4645769-4645791 CTGAATGTGGAGGAGGAGCCAGG - Intergenic
1064281005 10:13951482-13951504 CTGAAAGAGGTGGAGTAGAAGGG + Intronic
1065094710 10:22269226-22269248 GTGAATGCGTTGGAGAAGCAAGG - Intergenic
1065735202 10:28745205-28745227 CTGAATGTGTTGGAAGAGCAAGG + Intergenic
1066253377 10:33655370-33655392 CTGACTGAGCCGGATGTGCAGGG + Intergenic
1067324013 10:45249181-45249203 CAGGAAGAGCTGCAGGAGCAGGG - Intergenic
1068885575 10:62093260-62093282 GTGAATGATCTGGAGGTGCCTGG - Exonic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1070593010 10:77813507-77813529 CTGTCTGAGCTGGAGGGTCAAGG - Intronic
1071259992 10:83910941-83910963 GGGAATGAGCTGGAGAAGCTTGG - Intergenic
1072904951 10:99444546-99444568 CTGACTAAGCTGCAGGAGAAGGG + Intergenic
1072984485 10:100128006-100128028 CTGAAGGAGCTGGAGCTGCAGGG + Intergenic
1073066904 10:100766495-100766517 CTGTTGGAGCTGGAGGAGGATGG - Intronic
1073136247 10:101222221-101222243 CTGAATGGGCTGGAGTCACAGGG - Intergenic
1074003109 10:109392155-109392177 ATGAATGAGCTGAAGAAGAATGG + Intergenic
1074827103 10:117222660-117222682 CTGAAGGAGCTCTGGGAGCAAGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076476666 10:130758432-130758454 CTGGGTGACCTGGAGTAGCAAGG - Intergenic
1078448596 11:11423929-11423951 CTCAATGAGCTGGGGGCGCCTGG + Intronic
1079169989 11:18084393-18084415 CTGAATGAGGTGGGGAACCATGG - Intronic
1080885357 11:36362899-36362921 CTGCCTGGGATGGAGGAGCAGGG + Intronic
1081936855 11:46910638-46910660 CTGAAAGAGCTTGAGGCACATGG + Intronic
1083649461 11:64193078-64193100 GTCAATGAGCTGAAGGAGAAAGG + Exonic
1084792598 11:71484059-71484081 CTGTCAGAGCTGGAGGAGGAGGG + Intronic
1084889640 11:72230356-72230378 CTTAATGAGCTGGCGGACTAGGG - Exonic
1087518120 11:99193343-99193365 CTGAATGACCTACATGAGCATGG + Intronic
1087809069 11:102590623-102590645 CTGAACTAGCATGAGGAGCAAGG + Intronic
1088792870 11:113241651-113241673 CTGAATGTGCAGGAGTAGAAGGG + Intronic
1089322106 11:117633351-117633373 CTGCAAGAGCTGGAGGGGTAGGG + Intronic
1089390090 11:118095659-118095681 CTGAATTTGCTCGAGGACCAGGG + Intronic
1089397174 11:118144053-118144075 CTCTATGAGCTGGTGGAGGAAGG + Exonic
1089713519 11:120335757-120335779 CTGCATGAGCCGGAGGCGCAGGG - Intergenic
1090071322 11:123546934-123546956 CAGAATGACCAGTAGGAGCAGGG + Intronic
1090762494 11:129849588-129849610 CTGTATGAGCTGTGGGAGCACGG - Intronic
1090827806 11:130400220-130400242 GGGGATGAGCTGGAGGAGCATGG + Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091889776 12:4044374-4044396 CTGAATGATCAGGAGGAGGCTGG - Intergenic
1091972288 12:4797414-4797436 CTGAGAGTGCTGGAGGAGGAGGG + Intronic
1092389708 12:8065221-8065243 CTGCATGAACTGAAGTAGCAGGG + Intronic
1093342385 12:17994313-17994335 ATCCATTAGCTGGAGGAGCAGGG - Intergenic
1093713917 12:22360059-22360081 CTGATTGGGCTGGAGGAGAGGGG - Intronic
1095539768 12:43295813-43295835 CTGAAGGAGCTGAAGAAACATGG + Intergenic
1096005643 12:48168850-48168872 CTGGAGCAGCCGGAGGAGCACGG + Intronic
1099398697 12:82175030-82175052 CTGAATGAGATGGTAGAGAATGG + Intergenic
1100274266 12:93057755-93057777 ATGAGTGAGCTTGAGGAGCATGG - Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102220699 12:111192452-111192474 AAGAAAGGGCTGGAGGAGCAGGG - Intronic
1102229918 12:111255499-111255521 CCAAAAGAGCTGGAGGAGCCAGG - Intronic
1103633499 12:122282957-122282979 CCGGATGAGCTGAAGTAGCACGG + Intronic
1104856725 12:131905643-131905665 CAGGCTGGGCTGGAGGAGCAAGG - Intronic
1105831242 13:24164623-24164645 CTAAATGAGATGGAGGTTCAGGG + Intronic
1106324008 13:28670360-28670382 CTGAATGATTTGGGGGAGCAGGG - Intronic
1107299319 13:38948517-38948539 ATGAATGGGCTAGAGGAGGAGGG - Intergenic
1107456006 13:40555132-40555154 GTGAATGAGCTGGAGAAGCAAGG - Intergenic
1111612007 13:90616946-90616968 CTGTTTGAGCTGGATGTGCATGG - Intergenic
1111776422 13:92669222-92669244 CAGAATGTTCTGGAGGAACATGG - Intronic
1113127860 13:107000222-107000244 CAGCAAGAGCTGGAGGAGAAGGG - Intergenic
1113578254 13:111409882-111409904 CTGACTGTGCTGGATGAGTAAGG + Intergenic
1113766882 13:112887519-112887541 CTGAAGGGCCTGGAGGAGCCTGG - Intergenic
1114785559 14:25593567-25593589 CTAAAAGAACTGGAGAAGCAAGG - Intergenic
1115208113 14:30935188-30935210 GTGAAGGAGCTGGAGAAGCACGG - Exonic
1118732129 14:68675820-68675842 GTGGCTGGGCTGGAGGAGCAGGG - Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119379338 14:74218606-74218628 CTGACAGAGCTTGAGGGGCAAGG - Intergenic
1120944630 14:89982527-89982549 CAGAAGGAGCTGGAGGCCCAGGG - Intronic
1122118102 14:99537592-99537614 GTGACTGGGCTGGAGGAGGAGGG - Intronic
1122470339 14:101961947-101961969 CTGAAAGGGCTGGGGCAGCAGGG + Intergenic
1122847056 14:104505890-104505912 CTGAAAGACATGGAGGAGGAGGG - Intronic
1122981917 14:105195927-105195949 CTGAACCAGCTGGAGCAGGATGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1125688036 15:41575256-41575278 CTGAATGAACAGGAGGGCCAGGG - Intronic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126469213 15:48989287-48989309 CTAAATAAGCTGGGGGAGGAGGG - Exonic
1131027790 15:89159431-89159453 GTGAATGTGCTGCAGCAGCATGG + Intronic
1131389791 15:92037747-92037769 CTGAATGAACTGCTGGAGCAAGG - Intronic
1132761138 16:1509162-1509184 CTGAAGCACCAGGAGGAGCAGGG + Intronic
1133644826 16:7754358-7754380 CAGATAGAGCTGGAGCAGCAAGG + Intergenic
1136428316 16:30183641-30183663 AGGAAGGAGCTGGAGGAGCCGGG - Exonic
1136631128 16:31489864-31489886 CTGACAAAGCTGGGGGAGCAAGG + Exonic
1137966119 16:52935612-52935634 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1141009808 16:80386999-80387021 CTGAATGACGTGGAGGAGGAGGG - Intergenic
1141350276 16:83288373-83288395 CTACATGAGGTGGAGGAGGAGGG + Intronic
1141556686 16:84841176-84841198 CTGACTGAGAGGGAGGAGTAAGG + Intronic
1141919518 16:87126687-87126709 CTGGCTGAGAGGGAGGAGCAGGG + Intronic
1142188250 16:88705038-88705060 CTAAGTGAGATGGAGGAGCAGGG + Intronic
1142827420 17:2522518-2522540 CTGAATGACATGGAGGACAAGGG - Intergenic
1143720556 17:8806123-8806145 CTGCATGAGCTGGGGGAGGGTGG + Intronic
1144680250 17:17188486-17188508 CAGCATGAGCTGGAGGGTCAAGG - Exonic
1144691714 17:17270563-17270585 CTGAATGAGGTGGAGGCACGGGG - Intronic
1145898246 17:28473370-28473392 CTGGAGGAGCTGGAGAAGGAAGG - Exonic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146620343 17:34392143-34392165 CTGAATAAGGTGCAGGAGTAGGG - Intergenic
1146645491 17:34574433-34574455 CTGAATGAAGTAAAGGAGCAAGG + Exonic
1146652057 17:34613041-34613063 CTGAATGGGCTGGAGGGGTGAGG + Intronic
1146718607 17:35107015-35107037 CTGAAGCAGCTGGAGGAGGCGGG + Exonic
1148126798 17:45241487-45241509 GTGGAGGAGCTGGAGGAGAAGGG + Exonic
1148670281 17:49404995-49405017 CTGGGGCAGCTGGAGGAGCACGG + Exonic
1148835598 17:50464141-50464163 CTGAATGAGCTGTAGGTGAAAGG + Intronic
1149156319 17:53633899-53633921 CTGAAGGATCTGGAGGAGTCTGG - Intergenic
1150150485 17:62804928-62804950 CTGAATAAACAGGAGGAGCGAGG - Intronic
1151413938 17:73949216-73949238 CTGCATGGGCTGGAGGAACAGGG + Intergenic
1151686860 17:75652585-75652607 CTGAATGAGCGGGCTGAGCTGGG + Intronic
1151717742 17:75840051-75840073 CTGCAGGAGGTGGAGGTGCACGG + Exonic
1151824159 17:76514306-76514328 CTGAATGAATTAGAAGAGCAGGG - Intergenic
1152353122 17:79794303-79794325 CCGAATGAGCTGGGGCAGGAGGG - Exonic
1152557851 17:81063459-81063481 CTGGATGAGCTCGAGGCCCAAGG + Intronic
1156372288 18:36482386-36482408 CAGAAGGATCTGGAGGATCAGGG + Intronic
1157106619 18:44780142-44780164 TTGCAAGAGTTGGAGGAGCAGGG - Intronic
1158445019 18:57511962-57511984 ATGAGTGAGGTGGAGGAGCAAGG + Intergenic
1159913207 18:74165716-74165738 CTGACAGATCTGGAGGAGCCGGG + Intergenic
1159913662 18:74169646-74169668 CTGAATCACCATGAGGAGCAGGG + Intergenic
1160337232 18:78053592-78053614 CTCACTCAGCTGAAGGAGCAAGG + Intergenic
1160818573 19:1047495-1047517 CTGGCTCTGCTGGAGGAGCAGGG + Exonic
1161478446 19:4498829-4498851 CTGAATGCCCTAGAGGAGCTGGG + Exonic
1161480958 19:4510481-4510503 CAGAATGAGTTGGAGGGGCTGGG - Exonic
1164840483 19:31389190-31389212 CTCTGGGAGCTGGAGGAGCATGG - Intergenic
1165121390 19:33561109-33561131 CTGAAGGAGCTGGAGGGGCCTGG + Intergenic
1165431646 19:35776332-35776354 ATGAATGAGCGGGAGCAGCATGG - Intronic
1165763658 19:38336850-38336872 CGGAACGAGGCGGAGGAGCAGGG + Intronic
1166369864 19:42294691-42294713 CTGAAAGAGCTGCATGACCAGGG - Exonic
1167580125 19:50336545-50336567 CTGGATGTACTGGTGGAGCAGGG - Intronic
1168047006 19:53801284-53801306 CTGAATGAGCTGGGGGACCTCGG - Exonic
1168503093 19:56909946-56909968 AGGAATGAGCTGGAGGAGTCTGG + Intergenic
925268723 2:2586580-2586602 CAGGAGGAGCTGGAGGAGCCGGG + Intergenic
925328368 2:3039927-3039949 CCGAAGGAGCTGGAGGAGAGAGG + Intergenic
925611315 2:5705604-5705626 GAGAATGGGGTGGAGGAGCAGGG + Intergenic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
925689842 2:6510714-6510736 CTGAGAGGGCAGGAGGAGCAGGG - Intergenic
927036183 2:19179067-19179089 TAGAATGAGCAGGTGGAGCAAGG - Intergenic
927139100 2:20117865-20117887 CTGGAAGAGCAGGAGGAGCCCGG + Intergenic
927139139 2:20118033-20118055 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927139149 2:20118066-20118088 CAGGAGCAGCTGGAGGAGCAGGG + Intergenic
927139163 2:20118117-20118139 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927384328 2:22515729-22515751 CAGCAGGAGCTGGAGGAGAAGGG - Intergenic
927667388 2:25042122-25042144 CTGAATGGGCTGGCGGCGCCCGG + Exonic
927843026 2:26457319-26457341 CTGAAAGGGCTGGAAGGGCAAGG + Exonic
928202762 2:29261033-29261055 CTGAAGGCGCTGGAGCAGCCTGG - Intronic
929115816 2:38443137-38443159 CTGACTGATCTGGAGGAGCGGGG - Intergenic
929580630 2:43079823-43079845 CCAGATGGGCTGGAGGAGCATGG - Intergenic
932553170 2:72793571-72793593 CTGAACTAGCTGGAGGAGTCAGG + Intronic
933207300 2:79521850-79521872 CAGCATGAACTGGAGGGGCAGGG + Intronic
934092956 2:88570350-88570372 CTGGAAGAGCTGGGGGAGCAGGG - Intronic
934613680 2:95758432-95758454 CTGAGTGAGGCTGAGGAGCAGGG + Intergenic
934840595 2:97621803-97621825 CTGAGTGAGGCTGAGGAGCAGGG - Intergenic
934900546 2:98156358-98156380 CTGAATGATCTGGCAGAGCTGGG + Intronic
934946226 2:98543878-98543900 GTGTGTGAGCTGGAGGAGCTGGG + Exonic
935152628 2:100451207-100451229 GGGAAGGAGCTGGAGGAGAAGGG - Intergenic
935934918 2:108171228-108171250 TTGAATGTGCTTGAGGAGGAAGG - Intergenic
939590543 2:144058877-144058899 CTGAATGAGCTAAAGGGACAAGG - Intronic
940485022 2:154287400-154287422 CTGGGGCAGCTGGAGGAGCATGG - Intronic
943911350 2:193572006-193572028 ATGAATGAGTTGGAGCAGAAGGG - Intergenic
944709906 2:202326518-202326540 CTGAATGAGGTGCAGGAGATGGG - Intergenic
945772208 2:214058198-214058220 ATGATTAAGCTGGAGGAGGAAGG - Intronic
945833322 2:214810643-214810665 GTGAAAGATCTGGAGGAGGAAGG - Intergenic
946200609 2:218068821-218068843 CTGACTGAGGTGGAGAAGGAAGG + Intronic
947794062 2:232883398-232883420 GTGGAGGAGCTGGAGGACCAGGG - Exonic
947944717 2:234091740-234091762 GTGAATAAACTGGAGGAGGAGGG + Intergenic
947974658 2:234355301-234355323 CTGGATGAGCTGCAGGCTCATGG + Intergenic
948049583 2:234969459-234969481 ATGAATGGGCAGGAGGAACAAGG - Intronic
1168953288 20:1817249-1817271 CAGAAGGAGGTGGGGGAGCAGGG + Intergenic
1171210088 20:23310295-23310317 GTGGATGAGCTGAAGGAGAAAGG - Intergenic
1173101370 20:40091814-40091836 CAGCTGGAGCTGGAGGAGCAGGG + Intergenic
1173115022 20:40233090-40233112 GTGAAGGAGCTGGGAGAGCAAGG + Intergenic
1173976977 20:47194480-47194502 ATGGGTGAGCTGTAGGAGCATGG - Intergenic
1174171110 20:48618749-48618771 CTGAAGGAGCTGAAGGGGGAAGG - Intergenic
1174186000 20:48706827-48706849 CTGAAGGGGCTAGAGGAGCCAGG + Intronic
1174534041 20:51237134-51237156 CTGGAGGAGCTGGGGGAGCTCGG + Intergenic
1174585231 20:51603157-51603179 CTTTATCAGCTGGGGGAGCAGGG - Intronic
1175641491 20:60634052-60634074 GTGAATGAGCTGGTAAAGCAAGG - Intergenic
1175988364 20:62775611-62775633 GTGAATGAGCCCCAGGAGCAGGG + Intergenic
1176017551 20:62943555-62943577 CAGACTCAGCTGGCGGAGCAGGG + Exonic
1176020248 20:62959008-62959030 CTGCAGGAGCTGGAGGAGGAGGG + Intronic
1179353037 21:40631490-40631512 CTGAGTCAGCTGGAGGAAAACGG - Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1180099462 21:45577806-45577828 CTGAAGGACCTGGAGGAGCTTGG + Intergenic
1180195737 21:46192403-46192425 CTGCTTGAGCAGGAGCAGCAGGG - Intronic
1180618394 22:17143746-17143768 CAGAAAGCGCTGGAGGAGGAAGG + Intronic
1181341375 22:22182470-22182492 GTGAGTGAGCTGCAGGATCAGGG - Intergenic
1181629897 22:24145255-24145277 CTGAATGCACTGGAGGGGCTGGG + Intronic
1183408054 22:37640017-37640039 CGGGCAGAGCTGGAGGAGCAAGG + Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1185413661 22:50698372-50698394 TTGAAGGGGCTGGGGGAGCATGG + Intergenic
1185415758 22:50709304-50709326 CTGAATGAGCAGGATTAGCGGGG - Intergenic
949766827 3:7535981-7536003 CTGAAACATCTTGAGGAGCAGGG - Intronic
950634909 3:14307828-14307850 CAGTATGTGCTGGAGGAGGAGGG - Intergenic
951646657 3:24899389-24899411 CTGAAGGAGCTGGAAGCGCTGGG - Intergenic
952750014 3:36817425-36817447 CTGTATGTGCTGGAGGAGGTAGG - Intergenic
952967685 3:38631285-38631307 CCGAATGAGCTGGTGGGACAAGG + Intronic
953410611 3:42688596-42688618 TTGAATGACCTGGAGGAGACGGG - Exonic
954660239 3:52223198-52223220 CTGAAGGAGCTGGACATGCACGG - Exonic
956368723 3:68534846-68534868 CTGAAGGAGGAGGAGGAACAGGG + Intronic
960355518 3:116648219-116648241 CTGAATGAACTGGATGATCTTGG - Intronic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960636798 3:119792528-119792550 CTGGGGCAGCTGGAGGAGCACGG - Intronic
962652339 3:137509434-137509456 CTGAATGAGCTGGGGTGGCAGGG - Intergenic
964649856 3:158998430-158998452 CTGAATGAGCTGGGTGATCTTGG + Intronic
966182461 3:177199041-177199063 CTGAATGACCTAGTGGGGCAGGG + Intergenic
968548960 4:1212795-1212817 CTGACTGACCTGGAGGATCTGGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969233883 4:5851674-5851696 CTGAAGGTGATGGAGGAGAAAGG + Intronic
969843949 4:9904894-9904916 CTCAAAGAGCTGGAGATGCAAGG - Intronic
970208430 4:13680531-13680553 CTGAAGGAGCTGCAGGACCTGGG + Intergenic
972612566 4:40669099-40669121 CTGAAACAGCTGGAGTAGGAAGG + Intergenic
973804603 4:54513708-54513730 CTGGATAAGATGGAGGTGCATGG + Intergenic
975380929 4:73699863-73699885 CTGAAGGAGAAGGAGAAGCAGGG - Intergenic
976142581 4:82007808-82007830 CTGAAGGGGCTGGAGGAGCGTGG + Intronic
976894909 4:90097559-90097581 CTGAAAGAGGTGAAGGAGAAAGG + Intergenic
978236183 4:106463737-106463759 CTGAATTCACTTGAGGAGCAAGG + Intergenic
981598046 4:146449434-146449456 CTGAAGGAACAAGAGGAGCAGGG + Intronic
983645965 4:169991808-169991830 GTGGTTGGGCTGGAGGAGCAGGG - Exonic
984797048 4:183671399-183671421 CTGAAAAGGCTGGAGGAGAAAGG + Intronic
985095433 4:186408218-186408240 GTGAATGAGCAGAATGAGCATGG + Intergenic
985434177 4:189913094-189913116 CTGAAGATGCTGGAGAAGCAAGG + Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
987624668 5:20382891-20382913 TTGAATGACTTGTAGGAGCATGG - Intronic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
994055824 5:95413886-95413908 AAGAATGAGCTGGAGGAGCCAGG - Intronic
996784595 5:127224688-127224710 CTGAATGGGTTGGAGGAGGAAGG + Intergenic
996938709 5:128977521-128977543 GGGAATGAGCAGGAGGAGAAAGG + Intronic
997232879 5:132257034-132257056 CTGAATGTTCTGGGGAAGCAGGG + Intronic
998188159 5:139998945-139998967 CTGAAAGAGGTGGTGGGGCAAGG - Intronic
998199437 5:140107902-140107924 GTGAGTGAGCGGGAGAAGCAGGG + Intronic
1000268468 5:159660051-159660073 CTGGATGAGATGGAAGAGGAGGG + Intergenic
1001740742 5:174050981-174051003 GTGAAAGAGCTGGAGTGGCAAGG - Intronic
1001989086 5:176101052-176101074 CTGGAAGACCTGGAGGAGCATGG + Exonic
1002227784 5:177737085-177737107 CTGGAAGACCTGGAGGAGCATGG - Exonic
1002457817 5:179355773-179355795 CTCAGTGAGATGGAGGACCAGGG - Intergenic
1007563692 6:42831676-42831698 CTGAATGTGGAGGAGGAGAAAGG - Intronic
1010295501 6:74191756-74191778 CTAAAAGAACTAGAGGAGCAAGG - Intergenic
1010360431 6:74987060-74987082 CTGCAGGAGCTGGAGCAGCCGGG - Intergenic
1010786312 6:80004845-80004867 CTAAACGAGCTGGAGGGGGAGGG + Intronic
1011186231 6:84679162-84679184 CTGCATGAGCTGGGTGACCAAGG - Intergenic
1011783626 6:90818715-90818737 TTGAATGAGTTGGAAAAGCAAGG + Intergenic
1013240443 6:108240554-108240576 TTGATAGAGCTGGTGGAGCATGG - Intronic
1013424672 6:109999956-109999978 CTGAGTAAGATGGAGGAACATGG - Intergenic
1015159492 6:130136564-130136586 ATGAATGGGCAGCAGGAGCAGGG - Intronic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1016435813 6:144035961-144035983 TTTAAGGAGGTGGAGGAGCAGGG + Intronic
1016562971 6:145417894-145417916 CTGAAGGAGCTGAAGGAGTGTGG - Intergenic
1016892063 6:149016690-149016712 CTGCATTAACAGGAGGAGCAGGG - Intronic
1017008178 6:150043335-150043357 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
1017074036 6:150600858-150600880 TTGAATGTGCTGGCGGAGCGGGG + Intronic
1018253658 6:161896628-161896650 CGGGAGGAGCTGGGGGAGCAGGG + Intronic
1018291005 6:162292636-162292658 CTGAATCAGCTGGAGGAAGGTGG + Intronic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1019166927 6:170103258-170103280 CTGATGGAGGTGGAGGAGCGAGG - Intergenic
1019442062 7:1052496-1052518 TTGGAGGTGCTGGAGGAGCAGGG + Intronic
1019568058 7:1694432-1694454 CACAAAGAGCTGGAGGAGGATGG + Intronic
1019597225 7:1863748-1863770 CTGACGGGGCTGCAGGAGCACGG - Intronic
1021020804 7:15596206-15596228 CTGATGCAGCTGAAGGAGCAAGG - Intergenic
1021807387 7:24370869-24370891 ATTAATGAGCTGGAGGAGGTGGG + Intergenic
1022111348 7:27234304-27234326 CTGCAGGAGCTGGAGGAGGGTGG - Intergenic
1022606122 7:31815793-31815815 CAGAAGGAACTGGATGAGCAGGG + Intronic
1022887180 7:34658363-34658385 CTCACTCAGCTGCAGGAGCAAGG + Exonic
1023461963 7:40407985-40408007 CTGAATGACTTGGAGAAGCTTGG - Intronic
1024982955 7:55172959-55172981 TGGAATGAGGTGGAGGAACAAGG - Intronic
1027999970 7:85481428-85481450 CTGAATCAGTTGGAGGCACATGG + Intergenic
1033172688 7:139097795-139097817 CTGAAAGGGCTGGAGGAGTGGGG + Intronic
1033274542 7:139961461-139961483 CATAATGAGCTGGAGGAGGTGGG - Intronic
1035070166 7:156138615-156138637 CTGAATGTGCTGATGGAGGAGGG + Intergenic
1035300965 7:157896937-157896959 CTGAGAGGGCTGGAGGGGCAAGG - Intronic
1036665262 8:10733385-10733407 CTGGAAGACCTGGAGGAGAAAGG + Intronic
1038047391 8:23777196-23777218 GTGACTGATCTAGAGGAGCAGGG + Intergenic
1038492895 8:27982754-27982776 CAGGACGAGCTGGAGGAGCTGGG + Intronic
1039781495 8:40791218-40791240 CAGAAGGGACTGGAGGAGCATGG + Intronic
1040386653 8:46918900-46918922 CTGGGTGAGCTCCAGGAGCAGGG - Intergenic
1042677436 8:71337440-71337462 GTGAAGGAGTTGGAGGAACAGGG - Intronic
1043553495 8:81402473-81402495 CAGAAAGCCCTGGAGGAGCAGGG - Intergenic
1043922116 8:85995428-85995450 GTGAATGTGCTGAAGGAGCAGGG - Intronic
1043973927 8:86564093-86564115 CTGAAGGAGGTGAGGGAGCAAGG - Intronic
1046240744 8:111487753-111487775 CTAAAAGAGCTAGAGAAGCAAGG - Intergenic
1046809580 8:118517844-118517866 CAGAATGGGCTGGGGGAGGAGGG + Intronic
1047523683 8:125615051-125615073 CTCACTCAGCTGAAGGAGCAAGG - Intergenic
1049291768 8:141807041-141807063 ATGCATGAGCTGGAGGAGTGCGG - Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049474331 8:142789736-142789758 CTGCCTGGGCTGGAGGAGCTGGG + Intergenic
1051191279 9:14515852-14515874 CTGAATGAGGTCGGGCAGCATGG - Intergenic
1053103390 9:35390311-35390333 CTAAATAAGCTGGAGGAGAAAGG - Intronic
1053144718 9:35704590-35704612 CTGAGAGGGCTGGAGGAGGATGG + Intronic
1053723266 9:40971253-40971275 CTGAAGATGCTGGAGAAGCAAGG + Intergenic
1054342698 9:63880739-63880761 CTGAAGATGCTGGAGAAGCAAGG - Intergenic
1056325880 9:85478683-85478705 CTGAAACAGCTGGATTAGCAAGG + Intergenic
1057211043 9:93201306-93201328 CACACTGGGCTGGAGGAGCAGGG + Intronic
1058767344 9:108194647-108194669 GAGAATGAGCTGGAGGAGGCAGG - Intergenic
1061045144 9:128160744-128160766 CTGAAGGAAGTGGTGGAGCAAGG - Intronic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1061223295 9:129265024-129265046 CTGGATGAGATGGAGGAGCAGGG - Intergenic
1062104524 9:134746286-134746308 CGGAAAGAGCTGGAGCAGGAGGG - Intronic
1062187017 9:135223640-135223662 CAGAAGGTGTTGGAGGAGCAGGG + Intergenic
1062312743 9:135948033-135948055 CTTGATGAGCTGGGGGAGCCTGG + Intronic
1185887116 X:3792718-3792740 AAGAAGGAGCTGGAGGAGGAGGG + Intergenic
1187111832 X:16309951-16309973 CTGCAGGAGGTGGAAGAGCATGG + Intergenic
1188691236 X:33131579-33131601 CTGATTGATTTGAAGGAGCATGG - Intronic
1188803404 X:34559016-34559038 CTGACTGAGATGGAGTAACAGGG - Intergenic
1188813404 X:34681239-34681261 CTGAATGAGATGGGTGAGCTTGG + Intergenic
1191626769 X:63278511-63278533 TTGAATGAGTTGGAGGAGAGGGG - Intergenic
1195574200 X:106431534-106431556 CTGAAGGGGCTGGAGGAGGAAGG - Intergenic
1196007646 X:110852913-110852935 CTGTAGGAGGTGGGGGAGCAGGG - Intergenic
1196043200 X:111228514-111228536 CACAATGACTTGGAGGAGCAGGG + Intergenic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1197202618 X:123761479-123761501 CTGAATAACCTTGTGGAGCAAGG - Intergenic
1199143514 X:144337420-144337442 CCAAATGAGCTGGAGGAAAAGGG - Intergenic
1199601550 X:149544180-149544202 CGGAGTGAGCCAGAGGAGCAGGG + Intronic
1199648827 X:149935304-149935326 CGGAGTGAGCCAGAGGAGCAGGG - Intronic
1200085142 X:153600398-153600420 CTGCAGAAGCTGGAAGAGCAAGG - Intergenic
1200814610 Y:7518463-7518485 CAGAATGTGCAGGAGAAGCATGG + Intergenic