ID: 920951047

View in Genome Browser
Species Human (GRCh38)
Location 1:210572064-210572086
Sequence CCGTGCCAGTGTAACATTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 38}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920951047 Original CRISPR CCGTGCCAGTGTAACATTTA CGG (reversed) Intronic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
921528408 1:216247136-216247158 CCCTGCCAGTGTAACCTCCATGG - Exonic
921617479 1:217286998-217287020 CTGTGCCAATGGAACTTTTAAGG + Intergenic
1071079231 10:81790355-81790377 CCCTGACCGAGTAACATTTAAGG + Intergenic
1071691070 10:87819930-87819952 CCGTGCCTGTTTAGTATTTAAGG + Intronic
1072455516 10:95572043-95572065 TCTTGCTAGTATAACATTTAAGG + Intergenic
1076019093 10:127055777-127055799 CCATGCCAGTGGATCACTTAGGG - Intronic
1079760654 11:24325456-24325478 CTGTGCATGAGTAACATTTAAGG + Intergenic
1081516001 11:43830708-43830730 CTGTGCCAGTATTACATTTCAGG + Intronic
1087975973 11:104546990-104547012 CAGTACCACTTTAACATTTATGG - Intergenic
1088631457 11:111777750-111777772 CCTTGCCAGTGAAATATTTGTGG - Intergenic
1092447034 12:8567518-8567540 CAGTGACACTGTAACATTTTGGG - Intergenic
1101421067 12:104551566-104551588 CTGTGCCAGTGTAACTTAGAAGG + Intronic
1118525428 14:66635228-66635250 ATGTGGCAGTGTAACATCTAAGG - Intronic
1120737912 14:88076124-88076146 CTGTGCCAGTGTATCAGTTTGGG + Intergenic
1124139993 15:27068677-27068699 CCCTGCCAGTGCAACATGTAAGG - Intronic
1129682833 15:77667607-77667629 CCTTGTCAGTGTGACATTAATGG + Intronic
1130935379 15:88465982-88466004 CAGTGACATTGTAACATTTTTGG - Intronic
1141383077 16:83593279-83593301 CCTTTCTAGTCTAACATTTAAGG - Intronic
1155578493 18:27276450-27276472 CTGGACCAGTGTAACATTTAAGG + Intergenic
1157372031 18:47122693-47122715 CTGTGCCAGTGTGACATTGGAGG - Intronic
1159101762 18:63966117-63966139 CTGTGCCAGTGTTCCACTTAGGG - Intronic
928185388 2:29105535-29105557 CCATCTCAGTGTAACATTCAAGG + Intronic
947050822 2:226040754-226040776 CTGTGAAAATGTAACATTTAAGG - Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
967009084 3:185414704-185414726 CATTGCCAGTTTAATATTTAGGG - Intronic
969893540 4:10281604-10281626 ACATGCCAGTGGCACATTTAGGG - Intergenic
971485908 4:27159993-27160015 CTGTGACAGGGTAACATTTAAGG - Intergenic
972724375 4:41733490-41733512 CTGTTCCATTGTAACATTTTTGG + Intergenic
981419060 4:144528116-144528138 CAATGCCAGTGTACCGTTTATGG + Intergenic
985870374 5:2549551-2549573 CCGTGCCAGTGTGCCATCTTGGG + Intergenic
990620549 5:57554596-57554618 CCCTGGCAGAGTAACATTAATGG - Intergenic
993506850 5:88719538-88719560 CCGTCCTAGAGTAACATTTTAGG - Exonic
995835950 5:116399752-116399774 CCTTGGCAGTGTAAAATGTAGGG - Intronic
1032421488 7:131783272-131783294 CCAGGCCATTGTACCATTTATGG - Intergenic
1039987586 8:42460806-42460828 GTGTGCCAGTGTTACATTGATGG - Intronic
1041481546 8:58326440-58326462 CTGTTCCAGTATAGCATTTAAGG - Intergenic
1045112176 8:98946661-98946683 TTGTGGCAGTGTAACCTTTATGG + Intronic
1045735733 8:105294703-105294725 CTGTTCCAGTGTATCATTTTTGG - Intronic
1046350974 8:113011727-113011749 TCATGCCAGTATAAGATTTAAGG - Intronic
1047286757 8:123493872-123493894 CAGCCCCAGTGTAACATTTATGG - Intergenic
1061461272 9:130741293-130741315 CCATGCCGGAGTAACAGTTACGG + Intronic
1197100093 X:122642733-122642755 CTGAGGCACTGTAACATTTAGGG - Intergenic
1197605751 X:128583136-128583158 CTGTGCCATTGTAACATGTATGG - Intergenic