ID: 920951290

View in Genome Browser
Species Human (GRCh38)
Location 1:210573913-210573935
Sequence CAGGGAAATGAGAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 740
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 676}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920951290 Original CRISPR CAGGGAAATGAGAGGGATGA AGG Intronic
900575517 1:3380437-3380459 CTGGGAAATGAGAGTGACAAGGG + Intronic
901789367 1:11646398-11646420 CAGGGAGATGGGTGGGAGGAAGG - Intergenic
902650059 1:17831229-17831251 CTGGGGAATGAGAGGGAGTAGGG + Intergenic
902654601 1:17858873-17858895 CAGGAAAATGATAGGGGTGGGGG + Intergenic
902667040 1:17946724-17946746 CAGAGAGATGGGAGGGATGGGGG + Intergenic
902730381 1:18365076-18365098 AAGGGAAAAGAGTGGGGTGAGGG + Intronic
903339294 1:22643944-22643966 CTGGGGAATGAGAGGGTTGGGGG + Intronic
903513834 1:23896623-23896645 GAGGGAGATGAGAGGCAGGAGGG + Intronic
904434934 1:30488471-30488493 AATGGTAATGAGAGTGATGATGG + Intergenic
904866001 1:33579421-33579443 CAGGGAAAGGAGAGGTTGGATGG + Intronic
905217356 1:36418260-36418282 GAGGGAAATGAGAGGTAAAAGGG + Intronic
905238379 1:36566014-36566036 CTGGGGAATGGGATGGATGATGG - Intergenic
905300525 1:36983536-36983558 CTGTGAAATGAGAATGATGATGG - Intronic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906769141 1:48468599-48468621 AAGGGAATTGCGAGGGGTGATGG + Intronic
907265959 1:53261434-53261456 GAGGGAAAGCAAAGGGATGATGG - Intronic
907390802 1:54157040-54157062 CAGAGAAGTGAGAGAGATGTCGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907946886 1:59143747-59143769 CAGGGTGATGAGAGATATGATGG + Intergenic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
910257675 1:85264575-85264597 GAGTGAGATGAGAGGGAGGAAGG + Intergenic
910486692 1:87722609-87722631 CAGGGAGTTGAGTGGGAAGATGG - Intergenic
910772959 1:90848188-90848210 CAAGGAAAAGAGTGGGATGGGGG - Intergenic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
911153572 1:94618461-94618483 CATGGAAAAGGGTGGGATGAAGG - Intergenic
912369633 1:109164131-109164153 ATGTGAAATGAGAGTGATGATGG - Intronic
912385122 1:109267654-109267676 CAGGGAAAAGATGGAGATGAGGG - Intronic
913442248 1:118910085-118910107 GAGGGGAATGAGAGGAAAGATGG - Intronic
913454265 1:119015010-119015032 CAGGTAAATGAGAGGGAAAGTGG - Intergenic
914901784 1:151715044-151715066 ATGGGAGAAGAGAGGGATGATGG - Intronic
915087564 1:153398512-153398534 CATGGGAATGTGAGGGCTGAAGG - Intergenic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915446037 1:155975590-155975612 GAGGGAGCTGAGAGGGCTGACGG - Intronic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
916199655 1:162258140-162258162 GAGGGGAATGTGAGGGCTGAGGG - Intronic
916935081 1:169619357-169619379 CAGGGCAATGAGAAGCAAGAAGG - Intronic
917119053 1:171629824-171629846 CAGGGACATTTGTGGGATGAAGG + Intergenic
917444216 1:175093141-175093163 CAGGGAAGTGAGAGGGACAGTGG - Intronic
917454481 1:175174289-175174311 CAGACAAATGATAAGGATGAGGG + Intronic
918039695 1:180906508-180906530 CAGGGAAATGACTGGGATTAGGG - Intergenic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918528016 1:185486281-185486303 TAGGAAAATGGGAGGGAGGAAGG + Intergenic
918735755 1:188061020-188061042 GAGGGAAGAGAGAGGGAAGACGG - Intergenic
919422149 1:197383163-197383185 CAGGGATATGTGTGGGATGAAGG - Intronic
919453505 1:197798660-197798682 CAGAGAATTGAGAGGGAACATGG - Intergenic
920004768 1:202825063-202825085 GTGGGAAATAAGAGGGAGGAAGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920872863 1:209808401-209808423 CAGGTGTATGAGAGGGATGAGGG + Intergenic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
921483368 1:215689036-215689058 CAAGGGAAAGAGAGGAATGAAGG + Intronic
921501491 1:215909639-215909661 AAGGGCATTGAGAGTGATGAGGG + Intronic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
923249675 1:232168169-232168191 CAGGGAAAAGGCAGGCATGAGGG - Intergenic
923411008 1:233709051-233709073 CAGGAAAAGGAGAGGAATGGAGG - Intergenic
1063069826 10:2649824-2649846 GCGGGAAGTGACAGGGATGAGGG - Intergenic
1063093833 10:2891485-2891507 CTGGGAAATGAGAAGAGTGAGGG + Intergenic
1063649252 10:7917229-7917251 GAGGGAAAAGAGAGCGAGGATGG + Intronic
1063872088 10:10428658-10428680 CAAGGAAAAGAGTGGGAAGAGGG - Intergenic
1064708182 10:18094670-18094692 AAGGCACATGAGAGGGAAGATGG + Intergenic
1064780328 10:18830603-18830625 CTGGGAAGTGAGAGGGGAGAGGG + Intergenic
1064800836 10:19069947-19069969 AAGGGAAATGAAAGGGAGAATGG - Intronic
1065268772 10:24004966-24004988 CAAGGAAAAGAGATGGATGGTGG + Intronic
1065407730 10:25388552-25388574 CAGGGCAATGGGTGAGATGAAGG - Intronic
1065638289 10:27753194-27753216 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638307 10:27753272-27753294 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638317 10:27753311-27753333 GAGGGAAAAGAGAGAGAGGAAGG - Intergenic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067279411 10:44860006-44860028 GAGGAAAGTGACAGGGATGAAGG + Intergenic
1067460406 10:46454056-46454078 AAGGGAAGAGAGAGGGAGGATGG + Intergenic
1067626786 10:47930547-47930569 AAGGGAAGAGAGAGGGAGGATGG - Intergenic
1068754683 10:60638562-60638584 AACAGAAATGAGAGAGATGATGG + Intronic
1069250943 10:66266064-66266086 AAGGGAAAAGAGAGAGAGGAAGG + Intronic
1069808853 10:71143767-71143789 CAGGGAAATGACTGGTATGCTGG - Intergenic
1069920388 10:71812386-71812408 CAGGGAAATGGGCAGGATGTGGG + Intronic
1070276011 10:75007406-75007428 CAAGGAAAAGAAAGGGGTGAAGG + Intronic
1070352655 10:75608333-75608355 CAGGGAAATGGGAAGGTTGTTGG + Intronic
1070479809 10:76870952-76870974 CAGGGAAATGAGAAACAAGAGGG - Intronic
1070726061 10:78791547-78791569 CAGGGAGGTGAGGGGGATTAAGG - Intergenic
1070786984 10:79167733-79167755 CAGGAAGCTGGGAGGGATGAAGG - Intronic
1071584996 10:86811456-86811478 CAGATAAATGAGAGGCAGGAAGG - Intronic
1071798314 10:89029566-89029588 CTGGGAATTGAAAGGGATGGCGG + Intergenic
1072050207 10:91696550-91696572 AAGGGAAGAGAGAGGGATGATGG + Intergenic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1072886946 10:99285559-99285581 AAGGGAAAGGTGAGGGATGGAGG + Intergenic
1072908221 10:99474978-99475000 CAAGAAAAGGAGAGGGAAGAGGG + Intergenic
1073071480 10:100796760-100796782 AAGGGAAATGATGGGGATGCAGG - Intronic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075121169 10:119666069-119666091 CAGAAAAATGAGAGGCATGTGGG - Intronic
1075125571 10:119696474-119696496 AAAGGAAAGGAGAAGGATGATGG - Intergenic
1075282703 10:121154145-121154167 CGGGGAATGGTGAGGGATGAAGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075685652 10:124363666-124363688 GAGGAAAATGGGAGGGAGGAGGG + Intergenic
1076437904 10:130459256-130459278 CAGGGAAGTCAGAGGGGTGGAGG + Intergenic
1076534312 10:131167153-131167175 CAGGCACAGGAGAGGGATGCCGG - Intronic
1076550182 10:131273127-131273149 CAGGGTAATGGAAGGGATGCGGG - Intronic
1076865873 10:133166070-133166092 CAGGCACAGGAAAGGGATGAAGG - Intronic
1076931625 10:133535487-133535509 CATGGAAATGTGAAGGGTGAAGG + Intronic
1077700258 11:4434828-4434850 CAGGGGAATGAGGGGCATGAAGG - Intergenic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1078720657 11:13880678-13880700 CAAGGTAATGAGAGGGAAGCTGG - Intergenic
1079010219 11:16822036-16822058 CAGGGAAATGAGAGGTGGGTGGG - Intronic
1079112264 11:17611468-17611490 CAGGGAAGAGGAAGGGATGAAGG - Intronic
1079459640 11:20668993-20669015 GAGGGACCTGAGGGGGATGATGG - Intergenic
1079609510 11:22414585-22414607 CAGGGAATTGAGAGGGAAATTGG + Intergenic
1080915969 11:36659914-36659936 CAAGGAGAAAAGAGGGATGAAGG + Intergenic
1081611738 11:44567071-44567093 CAGGGACATGGTAGGGATGGGGG - Intronic
1081793131 11:45803132-45803154 TAGGGAAATGGGAGGGCTGCAGG - Intergenic
1081814327 11:45930022-45930044 TAGGGTAATGAGATGGATGGTGG - Intronic
1081837319 11:46166609-46166631 AATGGTAATGAGAGGGATCACGG + Intergenic
1081869770 11:46378026-46378048 CAGGGAAACGAGACAGAGGAAGG - Intronic
1082007642 11:47428670-47428692 CAGGTTGATGACAGGGATGAAGG - Intergenic
1082127440 11:48449795-48449817 CAGGGAAAAGAAAGAAATGAAGG - Intergenic
1082143681 11:48641034-48641056 AAAGGAAAGGAGAGGGAAGAAGG - Intergenic
1082181106 11:49120862-49120884 CAGGGAAATGGAAGGAAGGAAGG - Intergenic
1082812880 11:57489221-57489243 CAGGGAGAGGGGAAGGATGAAGG + Intronic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084785672 11:71440450-71440472 CAGGTGGATGAGATGGATGATGG + Intronic
1085034617 11:73292606-73292628 CAGGGGAAAGAGGGGGATGGGGG - Intronic
1085134421 11:74073022-74073044 CAGGCAAAAGAGAAGGGTGACGG + Intronic
1085261285 11:75206167-75206189 CTGGGAAACAAGAGGGATGAAGG - Exonic
1085346504 11:75771477-75771499 CAGGAATAGGAGTGGGATGATGG + Intronic
1085515334 11:77108273-77108295 CAGGGAAAAGAGAGCCATGCTGG + Intronic
1086083781 11:82934002-82934024 CAGGGAAATGATAGGCAGCAAGG - Exonic
1086212292 11:84335197-84335219 AAGGGAAAGGAAAGGAATGAAGG + Intronic
1086300401 11:85421225-85421247 CAGGGAAATGCAAGGGGTCAGGG - Intronic
1087161120 11:94949084-94949106 GAAGGAAGTGAGAGGGAAGAAGG + Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088238343 11:107749034-107749056 GAGGGAAATTAGGAGGATGAAGG + Intergenic
1088715397 11:112544379-112544401 AATGGCAATGAGAGGGAGGAAGG + Intergenic
1089303444 11:117512452-117512474 CAGGGAAAAAATGGGGATGAGGG + Intronic
1089356456 11:117857077-117857099 CAGGGACATGAGAGGGCAGGAGG + Intronic
1089569241 11:119392137-119392159 CAGGGAAAAGGGTGGGAGGAAGG - Intergenic
1089859445 11:121575731-121575753 GAAGGAAATGGCAGGGATGAAGG - Intronic
1089881720 11:121780510-121780532 AGGGGAAATGAGAAGGTTGAGGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1091968182 12:4763519-4763541 AAGGAAACTGAGAGGGTTGAGGG - Intronic
1092173939 12:6390353-6390375 CAGGGAGAAGAGAGGAAGGATGG + Intronic
1092210770 12:6645120-6645142 CAGGGAAATGGGAAGCATGTTGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1093006870 12:14060777-14060799 AATGGGACTGAGAGGGATGAAGG - Intergenic
1093145944 12:15567184-15567206 AAGGAAAATGAGAGGGGGGAAGG - Intronic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1094398295 12:30032611-30032633 GAAGGGAATGAGAGGTATGAAGG + Intergenic
1094533544 12:31300349-31300371 CAGGCAAAAGAGTGGGATGGGGG + Intronic
1094742166 12:33302239-33302261 CAGAGGAATGAGAGGCAGGAAGG + Intergenic
1096068019 12:48756476-48756498 AAGGCAAACGAGAGAGATGAGGG + Intergenic
1096666520 12:53169969-53169991 CATGGAGACGAGAGGGATGAAGG + Intronic
1096670713 12:53196821-53196843 CTGGGAGAGGAGAGGAATGAAGG + Intronic
1096749353 12:53748820-53748842 AAAGGAAATGAGAGTGATGGTGG + Intergenic
1096912092 12:54994695-54994717 GAGGGTAATGAGTGGGAGGAGGG - Intergenic
1097026463 12:56059624-56059646 CATGGAAATGAGACTAATGAAGG - Intergenic
1097169099 12:57102558-57102580 CAGGCAGGTGGGAGGGATGAAGG - Intronic
1097196992 12:57248314-57248336 CAGAGAAATGAATGGGATGGAGG + Intronic
1098406275 12:70129838-70129860 CTGGGAAATGATAGGAATGAAGG - Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099669830 12:85675593-85675615 AAGGGAAATGATAGGGAAGAAGG + Intergenic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100464366 12:94832344-94832366 CAGGGGAATGAGAGTAAAGAAGG + Intergenic
1100569441 12:95833238-95833260 CAAGGAATGGAGTGGGATGAAGG + Intergenic
1100703558 12:97175920-97175942 CAGAGAGATGAAAGGGAAGAAGG - Intergenic
1100974337 12:100106607-100106629 TAGGGGTAGGAGAGGGATGAGGG + Intronic
1101384499 12:104244824-104244846 CAGGGAAAAGAAAGGGGTGTAGG + Intronic
1101693578 12:107103484-107103506 AAGGGAATAGAGAAGGATGAGGG - Intergenic
1101732845 12:107440737-107440759 CAGGGAAATGGAAGGGAGGCAGG + Intronic
1102063560 12:109953762-109953784 CAGGTAGATGAGAGGAATGCTGG - Intronic
1102520778 12:113476552-113476574 CAGGGATGCGAGAGGGATGGCGG + Intergenic
1102687042 12:114732754-114732776 CAAGGAAATGAGAGGGCTGGGGG - Intergenic
1103249613 12:119488369-119488391 CAGGCAAATGAGAGGCTTCAAGG - Intronic
1103437491 12:120937976-120937998 CATGGAAATGAAAGGGAGGAAGG + Intergenic
1103486844 12:121288753-121288775 CCTGGAAAAGAGAGGGATGGTGG - Intronic
1104160688 12:126177336-126177358 CAGGGAAAAGGGTGGGAAGAGGG + Intergenic
1105296215 13:19089828-19089850 GTGGGAAATGAGAGAGAGGAGGG + Intergenic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1105963914 13:25368087-25368109 GAGGGAAAGGAAAGGGATTAGGG + Intergenic
1106040947 13:26092960-26092982 CCGAGAAATGACAGGGATGATGG - Intergenic
1106647442 13:31651505-31651527 CAGGGCCATGTGAGGGAAGAGGG - Intergenic
1106810278 13:33351949-33351971 AATGGGAATGACAGGGATGATGG + Intergenic
1106944044 13:34805560-34805582 CAGGGAAATGAGAAGAATGTTGG - Intergenic
1106979517 13:35261147-35261169 CTGGGAAATGACAGGGATAAGGG + Intronic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109379408 13:61540214-61540236 TTAGTAAATGAGAGGGATGAAGG + Intergenic
1109738890 13:66525132-66525154 AAGGGAAATGAGAGCGACAAGGG - Intronic
1110019529 13:70453080-70453102 CAGGAAAAAGAGAGAGAGGAGGG - Intergenic
1110423281 13:75337262-75337284 CATGGAAAGGAAAGGCATGAAGG - Intronic
1110449063 13:75620331-75620353 AAGAGAAATGAGGGGAATGAGGG + Intergenic
1110709777 13:78637589-78637611 CAGGGAAATTAAAGGGAACAAGG + Intronic
1111029242 13:82574452-82574474 CAGGCAAAAGAGAGGGCTTATGG + Intergenic
1111043325 13:82780703-82780725 GAGTGACATGAGAGGTATGAGGG + Intergenic
1112311653 13:98322524-98322546 CTGACAAGTGAGAGGGATGATGG - Intronic
1112522471 13:100109256-100109278 CCAGGAAATGAGAGGCAAGAAGG + Intronic
1112727469 13:102320869-102320891 AAGGTGAATGGGAGGGATGAAGG - Intronic
1112880846 13:104104716-104104738 CAGGGAAATCAGAGGGAAAGGGG - Intergenic
1113266400 13:108622664-108622686 GATGGAAAAGAGAGGGATGGTGG + Intronic
1113754832 13:112803973-112803995 GAGGGGAATGAGGGGAATGAGGG - Intronic
1114191862 14:20445567-20445589 AAGGGAAATGAGGTGGATTATGG + Intergenic
1115161955 14:30406460-30406482 CAGGCAAGTGAGAGAAATGAAGG - Intergenic
1115214203 14:30998367-30998389 CTGGGAAATGAGATGTATGCAGG + Intronic
1115779637 14:36755439-36755461 CAGGGCACTGACAGGGATGAAGG - Intronic
1116495804 14:45558805-45558827 AAAGGAAATGAGAAAGATGAGGG - Intergenic
1117035910 14:51728659-51728681 CATGGCACTGAGCGGGATGAAGG - Exonic
1117282075 14:54251362-54251384 CAGAGAGAAGAAAGGGATGAGGG - Intergenic
1117619382 14:57568875-57568897 TATGGAGAAGAGAGGGATGAGGG + Intronic
1118378520 14:65198495-65198517 CAGGCAAAGGAGGGGGATGCTGG + Intergenic
1118482323 14:66179718-66179740 GAGGGAAATTAGAGGGGTGCTGG - Intergenic
1118523288 14:66611787-66611809 CAGGGCAATGATAGGGAGAATGG - Intronic
1118631396 14:67706933-67706955 CAGAGAAATTAGGGGGAGGAAGG + Intronic
1118719690 14:68585356-68585378 AATGGAAATGCGAGGGATAATGG - Intronic
1118979071 14:70701601-70701623 TAGGGAAAAGAGGGGGAAGAGGG + Intergenic
1119381562 14:74232710-74232732 CAAGGAAAGGAAAGGGATGTGGG - Intergenic
1119639212 14:76302110-76302132 TTGGGGAATGAGATGGATGATGG + Intergenic
1119931437 14:78551576-78551598 AAGGGAAATGAGAGGGGAGGAGG - Intronic
1119950430 14:78738822-78738844 CAGGGAAATAAGAAGGCAGATGG + Intronic
1120286647 14:82510951-82510973 CAGGGAAAAAAGAGGGAAAAAGG - Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1121006773 14:90495730-90495752 CAAGGAAAACAGTGGGATGATGG + Intergenic
1121343463 14:93118330-93118352 GAGGGAAATGGGAAGGAAGATGG + Intergenic
1121788704 14:96682493-96682515 GAGGGAATTAAGAGGGTTGATGG - Intergenic
1122102546 14:99424826-99424848 CAGGGAAGTGAGAGAGAAGCCGG + Intronic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124428804 15:29588309-29588331 CAGGGAAAAGAAAGGGATAGAGG + Intergenic
1124627092 15:31314419-31314441 CAGGGAGATGACAGGGATGATGG - Intergenic
1124827770 15:33115708-33115730 TAGGGATATGAGAGGCAGGAAGG - Intronic
1125084234 15:35711905-35711927 CACAGAAATGAGAGGGACAAGGG + Intergenic
1125584510 15:40810538-40810560 CAGGGAAAGGAGAGGGATCCAGG - Intronic
1125697676 15:41652368-41652390 CGGGGAAAGGAGAGGGGAGAGGG - Intronic
1125843206 15:42825147-42825169 AAGGAATATGAGAGGGAAGAGGG + Intronic
1126314582 15:47356628-47356650 CTGTGAAATGAGAGGGATGAAGG - Intronic
1126847433 15:52773956-52773978 TTGGGAAAGGACAGGGATGATGG + Intronic
1126892015 15:53216584-53216606 CAAGGAGAAGAGATGGATGATGG - Intergenic
1129601575 15:77001863-77001885 GAGAGAAAGGAGATGGATGAGGG + Intronic
1129914983 15:79260892-79260914 CAGGAACCTGGGAGGGATGAGGG + Intergenic
1130109758 15:80954474-80954496 CAGGGAAAGGAGTAGGATGTGGG + Intronic
1130999977 15:88932193-88932215 CAGGACAGTGAGAGGGATCATGG + Intergenic
1131062532 15:89412720-89412742 CAAGGGGATGAGAGGGCTGAGGG + Intergenic
1131086186 15:89577364-89577386 AAGTGCAATGAGAAGGATGAAGG - Intronic
1131382185 15:91973187-91973209 CTGGGAAATGAGAGAGCAGAGGG - Intronic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1131874025 15:96785717-96785739 GAGAAAAATGAGGGGGATGAGGG + Intergenic
1132394787 15:101464665-101464687 CAGGGAAATGGGAGGCTGGAGGG + Intronic
1132906405 16:2284888-2284910 CAGGTACATGAGGGGGATGATGG + Exonic
1133221157 16:4319729-4319751 CAGGGACTGGAGAGGGATCATGG + Intronic
1133622440 16:7539373-7539395 CTGGGAATAGAGAGAGATGAGGG - Intronic
1133732059 16:8586468-8586490 CATGGAAGTGAGGGAGATGAGGG - Intronic
1133741596 16:8655878-8655900 CAGGAAGAGGAGAGGGCTGAGGG + Intergenic
1134869358 16:17637913-17637935 CACTGAAATGAAAGGGAGGAAGG + Intergenic
1135235748 16:20754177-20754199 CAGTGAAATAAGAGGGGAGAAGG + Intronic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1136281172 16:29212322-29212344 CAGGGAACTGAGAGAGGGGAGGG + Intergenic
1137395100 16:48111477-48111499 CCAGGAAATGAGAAAGATGAAGG - Exonic
1137934861 16:52625113-52625135 AAGGGATATGTGAGGGCTGAGGG - Intergenic
1137977253 16:53042272-53042294 GAGAGAAAGGAGAGGGGTGAGGG - Intergenic
1138895980 16:61205408-61205430 CAGGGACTTCAGAGGGATCATGG - Intergenic
1138913250 16:61428970-61428992 CATGGAAATGAAAATGATGACGG + Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140689941 16:77472379-77472401 CAGGGAATGGAAAGGGATTAGGG - Intergenic
1140751238 16:78025946-78025968 CAGGAAGCTGAGAGGGATGGGGG + Intronic
1140752414 16:78037503-78037525 GAGAGAATGGAGAGGGATGAAGG - Intronic
1140927027 16:79592987-79593009 CATGGAAATCAGACGGCTGAAGG + Intronic
1140948850 16:79796639-79796661 AAGGGAAAAGGGAGGGTTGAGGG + Intergenic
1140967696 16:79983111-79983133 GAGGGAAGAGAGAGGGAGGAAGG - Intergenic
1141204922 16:81926146-81926168 CAGGGGCATGATAGGGACGACGG + Intronic
1141475679 16:84271648-84271670 CATGGAAGTGAGAGAGAAGAGGG + Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1141677192 16:85524077-85524099 CCCGGAAGTCAGAGGGATGAGGG - Intergenic
1142085535 16:88178245-88178267 CAGGGAAATGAGAGAGGGGAGGG + Intergenic
1142549667 17:731164-731186 CCGTGAAATGAGAGGGAGGCTGG - Intergenic
1142869209 17:2809510-2809532 CGGGGAGCTGAGAGGGGTGAGGG - Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143473866 17:7192190-7192212 GAGGGAAAGGAAAGGGAAGATGG + Intronic
1145878560 17:28337800-28337822 CAGTGATATGAGAGTGATTAGGG - Intronic
1146430649 17:32790763-32790785 CAGGGCAAAGAGAGAGAAGAGGG + Intronic
1146573827 17:33974875-33974897 CAGGAAAAGCTGAGGGATGAGGG - Intronic
1147675378 17:42201870-42201892 GAGGGAAAGAAGAGGGATGAAGG + Intronic
1148383299 17:47216443-47216465 CAAGGAAATGATGGGGAGGAAGG - Intronic
1148525339 17:48327528-48327550 TAAGGAAAAGAAAGGGATGAAGG - Intronic
1150197619 17:63317313-63317335 CAGGGAAATGACAAGGAGGGGGG - Intronic
1150657197 17:67046993-67047015 CAGAGAAAAGAGAGGGAAAAAGG - Intronic
1151237129 17:72728803-72728825 GAGTGAACTGAGAGGGAAGAAGG - Intronic
1151594052 17:75066058-75066080 CAGTAAAATGAAAGGGAGGAGGG - Intergenic
1151937312 17:77270522-77270544 CAGGAAAAACAGAGGGCTGAGGG - Intergenic
1152146138 17:78570029-78570051 GAGGGAAAAGAAAGGGAAGACGG - Intronic
1152446875 17:80350044-80350066 GATGGAGATGAGAGGGATGCTGG - Intronic
1152565009 17:81096467-81096489 CAGGGAACTGCCAGGGATGCTGG - Intronic
1152627010 17:81392530-81392552 CAGGGACATGGGAGGGCAGAGGG - Intergenic
1153540409 18:6147996-6148018 CAGGGAGATCAGAGGTTTGATGG + Intronic
1156048830 18:32907392-32907414 CAGGGAAATAAGTGGGGCGATGG - Intergenic
1156393590 18:36676124-36676146 AAGGGAAATCAAAGGGATAAGGG - Intronic
1156475080 18:37400899-37400921 CTGGCAAATGACAGGGCTGAGGG + Intronic
1157168042 18:45376397-45376419 CAGGGGAATGAGGGAAATGATGG + Intronic
1157305794 18:46516695-46516717 GAGGGCAGTGATAGGGATGAAGG - Intronic
1157772150 18:50358633-50358655 GAGGGAAAAGAAAGGGAAGATGG - Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158873197 18:61708851-61708873 CAGGTGAACTAGAGGGATGAAGG - Intergenic
1159025613 18:63180113-63180135 GAGGAAAATGAAAGGGAAGAAGG - Intronic
1160175672 18:76592248-76592270 GAGGGGGATGAGGGGGATGAGGG - Intergenic
1160222954 18:76990471-76990493 CAGGGGATGGTGAGGGATGAGGG + Intronic
1160710002 19:547094-547116 GAGGGGGATGGGAGGGATGAAGG + Intronic
1161756619 19:6138587-6138609 GAGGGAAGAGAGAGGGAGGAAGG + Intronic
1161818713 19:6516212-6516234 CAGGGAAGTGGGAGGGACTAAGG + Intergenic
1161852618 19:6745508-6745530 CAGGAAAATGAGAGGGGTTAGGG - Intronic
1162156359 19:8680784-8680806 CAGAGACTTGAGAGAGATGAAGG + Intergenic
1163350974 19:16776993-16777015 GAGGGAAAGGAGAGGGAAGAGGG + Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164100453 19:22050372-22050394 CAGGGACATGACAGAGAAGAAGG + Intergenic
1164119554 19:22253939-22253961 TAGGAAAATGAGAGAGATTATGG - Intergenic
1164866846 19:31611510-31611532 AAGGGAAAGGAGAGAGAGGAGGG + Intergenic
1164876115 19:31691274-31691296 CAGGGAAATGAGACAAAGGATGG - Intergenic
1164876349 19:31693437-31693459 CAGGGAAATGACAGGGTTGCTGG - Intergenic
1165146535 19:33734636-33734658 CAGGGAGAGGAGAGGAAGGAGGG + Intronic
1165699320 19:37925469-37925491 CAGGAGAGTGGGAGGGATGAGGG + Intronic
1165940023 19:39410281-39410303 GAGGGAAGTGAGAGGGAGGAGGG - Intergenic
1166144194 19:40823098-40823120 CAGGGACATGCAAGGGATGGAGG - Intronic
1166521280 19:43481898-43481920 TGGGGAAATGAGAAGGATTAGGG + Intronic
1166891546 19:45997047-45997069 CAGGGGAATGAGAGAAGTGATGG - Intronic
1167164949 19:47792508-47792530 CAGGGAAATTTGGGGGCTGATGG - Intergenic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
1167841786 19:52127985-52128007 CACGGAAACATGAGGGATGATGG + Intronic
1167908629 19:52683468-52683490 CAGGGACCTGAGGGGCATGAAGG - Intronic
1167944684 19:52978680-52978702 CAGGGACCTGAGGGGCATGAAGG - Intergenic
1167988528 19:53338488-53338510 CAGGGACCTGAGGGGCATGAAGG + Intronic
1168001313 19:53448407-53448429 CAGGGAAAGGAGATGCATTATGG - Intronic
1168682569 19:58326798-58326820 GAGGGAAATGTGAAGGCTGAGGG - Intergenic
924967292 2:90743-90765 CAGGGAAACATGAGGGATCAGGG + Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927348374 2:22074691-22074713 AAGGGTAATGGGAGGGGTGAAGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927792672 2:26022641-26022663 GAAGGCAATGAGAGGGAAGAAGG - Intergenic
927894851 2:26775147-26775169 CAGGAAAAGAAGAGGGTTGAAGG - Exonic
928034178 2:27806359-27806381 CAGGGAAATGAGTGGGGCAAAGG - Intronic
928189915 2:29154631-29154653 CAGGGAAATCATAGAGAGGAGGG + Intronic
928286006 2:29990532-29990554 GAGGGAGATGAGAGGGAGGAAGG + Intergenic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928396914 2:30949636-30949658 CGGAGAAATGAGAGGCCTGATGG - Intronic
928505164 2:31944033-31944055 CAAGGAAATGACTGTGATGATGG - Intronic
929049368 2:37822718-37822740 CATGGAAATGCATGGGATGAAGG - Intergenic
929087649 2:38184147-38184169 CAGTGAAGTGAGAGAAATGAAGG - Intergenic
929094556 2:38251113-38251135 TATGGAAATGAAAGGGAGGAAGG + Intergenic
929640621 2:43575476-43575498 TAGGGAAATTTGGGGGATGATGG + Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929826808 2:45315274-45315296 CAACGAAATGAGAGGGACAAGGG + Intergenic
929832656 2:45359530-45359552 TAGGAAAATAAGAGGGGTGAGGG - Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930905870 2:56566737-56566759 CTGGGAAATAAAAAGGATGAGGG - Intergenic
931029534 2:58156447-58156469 CAGAGAAATAAGAGAGATTAAGG - Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
933474801 2:82776567-82776589 GAGGGAATTGAGGGGGTTGAGGG + Intergenic
935144620 2:100387060-100387082 CAGAGGAAAGAAAGGGATGATGG - Intergenic
935400320 2:102653601-102653623 CAGGGAAAAGAGAGAAAGGAAGG - Intronic
936267728 2:111023215-111023237 CAGGGAGATGAGAGGGGAGCGGG + Intronic
936603573 2:113924756-113924778 CAGGGGAATGAGAGGTATGGAGG - Intronic
936804683 2:116315897-116315919 AAGGGAAATAAGAGGAATAAAGG + Intergenic
937815654 2:126247888-126247910 CAGGCAAATGACAGGCATGGAGG + Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938308145 2:130268333-130268355 CAGGGAAGTGAAAAGGAGGAGGG - Intergenic
938447186 2:131388503-131388525 CAGGGAAGTGAAAAGGAGGAGGG + Intergenic
938811257 2:134855052-134855074 AAGGGAGAGGAGAGGGGTGATGG - Intronic
938856544 2:135317963-135317985 AGGGGAAATAAGAGGGATTAGGG + Intronic
938969814 2:136421793-136421815 CAGGGAAGTCAGAGGGAAAAAGG - Intergenic
939501840 2:142996537-142996559 CAGTGAAAGAAGAGGGATGTTGG + Intronic
942042003 2:172076025-172076047 CAGAGGAACGAGAGGTATGATGG + Intronic
942343162 2:174971680-174971702 CAAGTAATTGAGAGGGATCAAGG + Intronic
943740383 2:191400754-191400776 AAGGGAACTGAGACGGCTGAAGG + Exonic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
943801248 2:192060893-192060915 GAGGGAAATTTGAGGGGTGAGGG + Intronic
944394913 2:199255587-199255609 AAGGGAACCAAGAGGGATGATGG - Intergenic
944427551 2:199599078-199599100 GAGGGAAATGAGAGACAGGATGG + Intergenic
944439524 2:199727921-199727943 AAGGGAAATGAGAGAGATGATGG - Intergenic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
944890157 2:204109096-204109118 CCTGGAAATGAGATGGCTGAGGG + Intergenic
947593460 2:231397288-231397310 CAGGGAAATGAAAGGCATTGGGG + Intronic
948325064 2:237110261-237110283 CACAGAAATGAAAGGAATGATGG + Intergenic
949043337 2:241859247-241859269 CAGGGAGATGGGGGGGATGGGGG - Intergenic
1169131396 20:3167962-3167984 CTGCGAAATGGGAGGAATGAAGG + Intronic
1169765619 20:9144764-9144786 GAGGGGAATGAGGGGGAGGAGGG + Intronic
1169879140 20:10328024-10328046 CTGGAGAATGAGAGGGATGTGGG - Intergenic
1169969077 20:11249161-11249183 CAGGGAAGAGAAAGGGATAAGGG - Intergenic
1171031642 20:21682056-21682078 CACGAAACTGAGAGGGAGGAGGG - Intergenic
1171223581 20:23421769-23421791 CATGGCAATGGGATGGATGAAGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171462718 20:25308059-25308081 CAGGGAACTGAGAGGTAGGCAGG + Intronic
1172434785 20:34921301-34921323 CAGGGGAATGGGAGAGAGGAAGG - Intronic
1172790471 20:37501774-37501796 CAGGGAATTGAGAGAAAAGATGG + Intronic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1172948559 20:38706891-38706913 CAGGGAAAGGTGAGGGAGAAGGG - Intergenic
1173575025 20:44107352-44107374 CAGGGAGAAGAGAAGGATGTGGG - Intergenic
1173864317 20:46304650-46304672 GAGGGAAATGTGGGGGAAGAAGG + Intronic
1173961205 20:47073923-47073945 CGGGGAAGTGAGAGAGATGCGGG - Intronic
1174760993 20:53207238-53207260 GAGGGAAATTGGAGGGCTGAGGG + Intronic
1175294679 20:57900241-57900263 GAGGGAAACGAGTGGGAGGAAGG - Intergenic
1175490803 20:59380072-59380094 CAGGGACAGGGGAGGGATCAGGG + Intergenic
1175683338 20:61007490-61007512 CAGGGAACTGGGAGGGATCAAGG - Intergenic
1175841073 20:62027887-62027909 CAGGGAACTGAGAGGGGTCAAGG - Intronic
1176031037 20:63011800-63011822 CTAAGAAATGAGAGGGATGGGGG + Intergenic
1177264288 21:18763634-18763656 CAGGAAAATGAGTGTGGTGAAGG - Intergenic
1177690457 21:24499955-24499977 AAGGGAAGTGGGAGGAATGAAGG - Intergenic
1177770062 21:25504186-25504208 CTGGGAAGTGAGAAGGATTAAGG - Intergenic
1178225369 21:30710928-30710950 AAGGGAAAGGAGAGGCAAGAAGG + Intergenic
1178461805 21:32809130-32809152 CTGGGAAAGGAGAGGCATCACGG + Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1179406742 21:41132552-41132574 CAGGGAAATGAGACAGAGAAAGG + Intergenic
1180700060 22:17776360-17776382 CAGGGAAATTCCGGGGATGATGG + Intergenic
1180763064 22:18223550-18223572 CCGGGAGCTGAGAGGGATGCTGG + Intergenic
1180772579 22:18400997-18401019 CCGGGAGCTGAGAGGGATGCTGG - Intergenic
1180803959 22:18650613-18650635 CCGGGAGCTGAGAGGGATGCTGG - Intergenic
1180806804 22:18718836-18718858 CCGGGAGCTGAGAGGGATGCTGG + Intergenic
1181217760 22:21344646-21344668 CCGGGAGCTGAGAGGGATGCTGG + Intergenic
1181572785 22:23776700-23776722 CCTGGAAATGAGGGTGATGATGG + Intronic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1182593577 22:31400457-31400479 GAGGGAAATGAGCTGGATGGAGG + Intronic
1182751423 22:32644854-32644876 CCGGGAAAGGGGAGGGATGGGGG + Intronic
1182974161 22:34606904-34606926 CAGGGAGACTAGAGAGATGATGG - Intergenic
1183315022 22:37132329-37132351 CAGGGGTGTGAGTGGGATGAGGG - Intronic
1183899479 22:40994138-40994160 CAGGGAAATGACAGAGAGGTTGG + Intergenic
1184392777 22:44214505-44214527 CGGGTAAAGGAGAGGGATCATGG - Intronic
1184458772 22:44625671-44625693 CAGGGAGATGAAAGGGATGGGGG + Intergenic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
1184699328 22:46159761-46159783 TTGGAAAATGAGAGGCATGAAGG + Intronic
1184902181 22:47453316-47453338 CAGGAAGAAGGGAGGGATGAGGG - Intergenic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1203234417 22_KI270731v1_random:141985-142007 CCGGGAGCTGAGAGGGATGCTGG - Intergenic
949548089 3:5089763-5089785 ATGGGAAATGAGAGGGAAGGGGG + Intergenic
950185032 3:10939596-10939618 GAGAGAACTGAGAGGGAGGATGG - Exonic
950566397 3:13772226-13772248 CAGTGAAGTGAGACGGATGATGG + Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952003059 3:28808976-28808998 CAGGGAAATGATATGGGAGAAGG - Intergenic
952077114 3:29710657-29710679 CACTGAAATGAGACGGATTATGG - Intronic
952993286 3:38852168-38852190 AAGGGCAATGAGAGGAAGGAGGG + Intronic
953256621 3:41296916-41296938 CAGGAAGAAGAGAGGGATGGAGG + Intronic
953637893 3:44678001-44678023 CAGGGCAATGAGGTAGATGATGG + Intergenic
953753807 3:45630089-45630111 AAGGGAAGTGAGAGGAATAAGGG - Intronic
954533307 3:51339157-51339179 GAGGGAAATGAGTGAGGTGAGGG - Intronic
954633426 3:52058878-52058900 CAGGCTAATGTGAGGGATGGCGG - Intergenic
955695583 3:61632798-61632820 CAGGGAGGGGAGGGGGATGAAGG - Intronic
955973178 3:64456229-64456251 CAAGGCAGAGAGAGGGATGAAGG + Intergenic
957397484 3:79660963-79660985 GAGGGAAATTAGAAGGCTGAAGG - Intronic
957729680 3:84117587-84117609 CAAGGAGATGAAATGGATGAAGG - Intergenic
957861000 3:85948973-85948995 CATGGAAATGTGAGGCATGGTGG + Intronic
958659885 3:97052932-97052954 GAGCAAAATGTGAGGGATGAAGG + Intronic
959361173 3:105394322-105394344 AAGGGACATGCGAGGGATGAGGG + Intronic
959667833 3:108941516-108941538 CAGGGGAATGAAATGGAGGAGGG - Intronic
959738148 3:109685025-109685047 CAGGCAAGAGAGGGGGATGAAGG - Intergenic
959765344 3:110020520-110020542 CAAGGACTTGAGTGGGATGAAGG - Intergenic
959944889 3:112115878-112115900 TAGGGAAGGGTGAGGGATGATGG - Intronic
961039665 3:123668751-123668773 AAGCGAGATGAGAAGGATGAGGG - Intronic
961351515 3:126307456-126307478 GAGAGAAATGAGCGGGATGGTGG + Intergenic
961397937 3:126610054-126610076 CAGGGCAGTGACAGGGATGGCGG - Intronic
962253083 3:133850933-133850955 CAAGGAAATAACAGGGATGACGG + Intronic
962383220 3:134913252-134913274 CAGGGGCATGGGAGGGGTGAGGG + Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963978254 3:151507151-151507173 CAGGGAAAGCAGAGGAATAAAGG - Intergenic
964209847 3:154214547-154214569 CAGGGACAAGAGCGTGATGAAGG + Intronic
964408046 3:156370510-156370532 CAGGACACTAAGAGGGATGAGGG + Intronic
964861705 3:161209662-161209684 CAGGGAAAAGGTAGGGATCAAGG + Intronic
964926915 3:161970196-161970218 TAGGAAAAAGAAAGGGATGAAGG - Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965892487 3:173531841-173531863 CAAGGAGATGAGTGGCATGAGGG - Intronic
967553829 3:190831508-190831530 TAGGGAAAGGAGGGGGAAGAAGG - Intergenic
968005435 3:195239360-195239382 AGAGGAAATGAGAGGGATGGGGG + Intronic
968112825 3:196063462-196063484 GAGGGAAGTGGGAGGGATGGAGG - Intronic
968331320 3:197872958-197872980 CTGGGCAGTGAGAGGGAAGATGG + Intronic
968551582 4:1226243-1226265 CAGGGACAAGCCAGGGATGAGGG - Intronic
968889332 4:3359280-3359302 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
969137400 4:5041163-5041185 CAGGGAAATGGGTGGGTTCATGG + Intergenic
969629933 4:8330117-8330139 CAGGGGACTGAGAGGGAAGTGGG + Intergenic
970481840 4:16484080-16484102 CAAGGAGGTGAGTGGGATGATGG + Intergenic
970760647 4:19482026-19482048 CAGAGAAATGAATGAGATGAGGG + Intergenic
970957103 4:21825859-21825881 CAGGAAAATGTGAGAGAGGATGG + Intronic
971394495 4:26215807-26215829 CAAGGAGGTGAGAGGGATGCGGG - Intronic
971395341 4:26221932-26221954 CAGGGCGGTGAGAGGGATGGGGG + Intronic
971588318 4:28433201-28433223 CAGGGAAATGACAGGGAACATGG - Intergenic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972565522 4:40265676-40265698 GAGGGAAGGGAGAGGGAGGAGGG + Intergenic
973582369 4:52357054-52357076 GAAGGAAAAGAGAGGGAAGACGG - Intergenic
974107540 4:57487256-57487278 CAGGGGAATGTGAGGGTTGAGGG - Intergenic
975293616 4:72706620-72706642 AAGGAGAATGAGAGGGAAGAAGG + Intergenic
975621402 4:76300229-76300251 GAGGGAAATATGAGGGAGGAAGG - Intronic
975667623 4:76748618-76748640 TAGGGAAATATGAGAGATGACGG - Intronic
975989214 4:80239774-80239796 GTGGAAAATGAGAGGGAAGAAGG - Intergenic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977641637 4:99364061-99364083 AAGGGTAGTGAGAGGGATGGAGG - Intergenic
977905952 4:102478097-102478119 CAGGGAAATGCAAGGGATAGAGG + Intergenic
978850929 4:113335528-113335550 CTTTGAAATGAGAGGCATGAGGG - Intronic
979589853 4:122465775-122465797 CAGGGAAGTGAAAGGGGTTAGGG - Intergenic
980035021 4:127873196-127873218 CACGGGATTGTGAGGGATGATGG - Intergenic
980182727 4:129421912-129421934 CAGCGAAATCTGATGGATGAAGG + Intergenic
980846264 4:138329277-138329299 AAGGGAAAGGAAAGGAATGAAGG + Intergenic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
981342365 4:143636248-143636270 CTGGGAAATGAGAGTAAAGAGGG + Intronic
981606332 4:146545376-146545398 CAGAGAATTGAGAGGGAGCATGG - Intergenic
981812139 4:148788225-148788247 TAGGGAAGGGAGAGGTATGAAGG + Intergenic
982197867 4:152934743-152934765 CAAGGAGATCAAAGGGATGAGGG + Intergenic
983046380 4:162991470-162991492 CAGGGAAATGTGAGTTTTGAGGG - Intergenic
984376271 4:178934675-178934697 AAGGGAAATGAGAAGGAGAAAGG - Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985766959 5:1785164-1785186 CAGGAAACTGAGCGGGAGGAAGG - Intergenic
985810536 5:2080502-2080524 CTGAGAAATGACAGAGATGATGG + Intergenic
985861742 5:2476877-2476899 GAGAGAAATGAGAGGGAGGGAGG + Intergenic
985909539 5:2868092-2868114 CAGGGAAGTTACAGGCATGATGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986979851 5:13434774-13434796 CAAGGAAAAGAGTGGGATAAGGG + Intergenic
987034130 5:14003498-14003520 CAGAGAGGTGAGAGGGAGGAAGG - Intergenic
987222339 5:15803533-15803555 GAGGGAGATGAGAGGAAGGATGG - Intronic
988396100 5:30699348-30699370 ATGAGATATGAGAGGGATGAGGG + Intergenic
988785564 5:34563263-34563285 CTGTGAAATTAGAGGGCTGAGGG + Intergenic
988996402 5:36718817-36718839 CAGGGAAATGAGCCAGATGTGGG - Intergenic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989302160 5:39907495-39907517 CCGGGAAATGCAAGGGATCAGGG + Intergenic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
990504822 5:56433823-56433845 AAAGGAACTGAGAGGGAGGATGG + Intergenic
991456470 5:66809652-66809674 CAGGGAGAAGAGAGAGATAAAGG - Intronic
991720721 5:69492747-69492769 GAGGGAAAGGAGAGGGAGAAGGG + Intronic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992767286 5:80012979-80013001 CTGGGAGATGATGGGGATGAGGG - Intronic
993386398 5:87267954-87267976 CAGGCAGATGAGAGGGGTGGGGG - Exonic
993937002 5:94016901-94016923 CTAAGAAATGAGAGGGATCAAGG + Intronic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
995570232 5:113472091-113472113 CCGGGAAATGCAAGGGATCAGGG - Intronic
996375497 5:122802357-122802379 GAGGGAAATGATGGGGAGGAGGG + Intronic
996607060 5:125335583-125335605 CAGGAAAGTGAGAGGGTTGGTGG + Intergenic
997065837 5:130557249-130557271 CAGAGCACTGAGAGGGATCATGG + Intergenic
997365224 5:133321322-133321344 CAGGGCACGGAGAGTGATGAAGG - Intronic
997444888 5:133933723-133933745 CAGGGAAAGAAGAGGAATGAAGG - Intergenic
997603813 5:135158261-135158283 AAGGAAAAAGAGAGGGATGTAGG - Intronic
997987788 5:138517470-138517492 CAGGTAAGTGGGAGGGATGGGGG + Intronic
998533952 5:142911700-142911722 CAGAGAAATGGGAGGGAATAGGG - Intronic
998751406 5:145325697-145325719 CAGGTAAATGAAAGGGAATAAGG - Intergenic
999129054 5:149268570-149268592 CAGGGCAAGGATAGGAATGAAGG - Intergenic
999184781 5:149698931-149698953 CAAAGTAATGAGAGAGATGAGGG - Intergenic
999512020 5:152262257-152262279 CAAGGTAATGAGAGTGATGTGGG + Intergenic
999522476 5:152364874-152364896 CAGTCAAATGAGAGGAAAGATGG - Intergenic
999622209 5:153485100-153485122 TAGGGAGATTGGAGGGATGAGGG + Intergenic
1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG + Intronic
1000454701 5:161435608-161435630 AAAGGAAGTGAGAGGGAAGAGGG + Intronic
1000742965 5:164993484-164993506 GAGGGAAGTGAGAGAGGTGAAGG + Intergenic
1001317904 5:170657351-170657373 CTGGGAAATGAGGGTGAGGAGGG + Intronic
1001334534 5:170786231-170786253 CAGGGAAAGGACAGGGATTGGGG + Intronic
1001455097 5:171854231-171854253 TAGGGAAGTGAGAAGGAAGAGGG - Intergenic
1001752997 5:174145775-174145797 CAGGGAATTGGGAGGAATGTGGG + Intronic
1001854081 5:174995623-174995645 CAGGGAGGAGAGAGGGGTGAGGG + Intergenic
1001855551 5:175007549-175007571 AAGGGAAAAGGGAGGGAAGAAGG - Intergenic
1002214951 5:177624544-177624566 CAGGGGAGGGAGAGGGATGTTGG + Intergenic
1002366486 5:178716595-178716617 CTGGGGAAGGAGGGGGATGAAGG + Intronic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003426723 6:6002828-6002850 AAGAGAAATAAAAGGGATGAGGG - Intronic
1003763571 6:9210245-9210267 GAGGGAAATGACAGGAGTGATGG + Intergenic
1004527437 6:16422503-16422525 CTTGGAAAAGAGAGGCATGAAGG + Intronic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1004902058 6:20204156-20204178 GAGGGAAATTAGAGGGGAGAGGG - Intronic
1004920239 6:20369329-20369351 CAGGAAAAGGAGAAGGATCAGGG + Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005068861 6:21845736-21845758 CAGGGGAAGGTGAGGGATGTGGG + Intergenic
1005310951 6:24558449-24558471 CAGGGAAATGAGAGTTACAAGGG - Intronic
1005316385 6:24606541-24606563 CATGGACAAGGGAGGGATGAAGG + Intronic
1005515909 6:26553904-26553926 CATGGAAAGGGGAGGGAAGACGG + Intergenic
1005993746 6:30919732-30919754 AAGGGAAGGGAGAGGGATCAAGG - Intronic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1006351444 6:33524196-33524218 CAGGGAGGGGAGAGGGCTGAAGG + Intergenic
1006377899 6:33681842-33681864 CAGGGCAATGAGGGTGATGGGGG + Intronic
1006389432 6:33749805-33749827 CTGTGAAATGAGGGGAATGATGG - Intergenic
1006389802 6:33751675-33751697 CTGTGAAATGAGGGGAATGATGG - Intergenic
1006874328 6:37282239-37282261 CCGGGCAACGAGGGGGATGATGG - Exonic
1007018690 6:38496698-38496720 CAGGAAAATGAGAGGGTAAAGGG + Intronic
1007073196 6:39050855-39050877 CAGGGAAGAGAAAGGGGTGAAGG + Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007772127 6:44200732-44200754 CTGGACAGTGAGAGGGATGAGGG - Intergenic
1008219824 6:48842528-48842550 CAGAGAAGTGAGAGGGAGCAGGG - Intergenic
1008419711 6:51284017-51284039 GAGGGAGAAGGGAGGGATGAAGG + Intergenic
1008567234 6:52781375-52781397 CAGGGACATGGGAGTGATCAAGG - Intergenic
1008612080 6:53193663-53193685 CAGGGAATTTTGAGGGGTGATGG - Intergenic
1010625836 6:78135367-78135389 CAGGGAAAGGAAAGGGAAAAGGG + Intergenic
1010928393 6:81770981-81771003 CAGGGAAATGAGAAGGAAAGGGG + Intergenic
1011391748 6:86861484-86861506 CAGGAAAGAGAGAGAGATGAGGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013301406 6:108808412-108808434 CAGGGAAATGAAAGGCAAGTAGG + Intergenic
1013618603 6:111867913-111867935 AAGGGAAATGACAGAGCTGAAGG - Intronic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1015090185 6:129346827-129346849 CAAGGAACTTAGAGTGATGAAGG + Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017485765 6:154900714-154900736 CAAGGAAAGGAGGGGGAAGATGG + Intronic
1017535899 6:155348318-155348340 CAGGGCATTGAGAGGGAACATGG - Intergenic
1017646075 6:156541029-156541051 GAGGGAATTCAGAGGGAAGAGGG + Intergenic
1017960799 6:159218851-159218873 CAGGGAGCTGAGAGGGAGCAAGG + Intronic
1018147021 6:160900798-160900820 CAGGGTACTGAGAGGGAGCATGG + Intergenic
1018529654 6:164749395-164749417 CAGAGAAATGGGAGGGCTGTGGG + Intergenic
1018611764 6:165654254-165654276 CAGGACAATGAGGAGGATGACGG - Intronic
1018779480 6:167049372-167049394 CAGGGAGCTGAGAGGAATGGCGG - Exonic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018881827 6:167890945-167890967 AAGGGAAAGGAGAGAGCTGACGG + Exonic
1019019220 6:168903374-168903396 CAGGTCAATGAAAGGTATGAAGG + Intergenic
1019151732 6:170010953-170010975 AAGGGAAAGGAGAGGGAATAAGG + Intergenic
1019906686 7:4070271-4070293 CCGGGAAATGAGGGTGACGAGGG - Intronic
1019910624 7:4098627-4098649 GAGGGATGTGAGAGGGAGGATGG + Intronic
1020011490 7:4808002-4808024 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1021929029 7:25561447-25561469 GAGGGAAATTGGAGGGATTAAGG - Intergenic
1022322856 7:29303475-29303497 CTGGGAAATAAGAGGGAAGGGGG - Intronic
1023202277 7:37711732-37711754 CAGGGACAAGAGAGGGATACAGG - Intronic
1023362949 7:39434220-39434242 CAGGGAAATGGGAAAGAGGATGG + Intronic
1023623542 7:42095519-42095541 AAGGGAAATGAATGGGATGGAGG + Intronic
1026567551 7:71501919-71501941 TAGTGAAATGGGAGGGAAGAAGG - Intronic
1026578740 7:71596531-71596553 TAGTGAAATGGGAGGGAAGAAGG + Intronic
1026774116 7:73220656-73220678 CAGGGCGATGTGACGGATGAAGG - Intergenic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1027014973 7:74774042-74774064 CAGGGCGATGTGACGGATGAAGG - Exonic
1027073058 7:75171911-75171933 CAGGGCGATGTGACGGATGAAGG + Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029150431 7:98476603-98476625 CTGAGAAATGAGAGGGAGCAGGG - Intergenic
1029248707 7:99220855-99220877 GGGGGAAAGGAGAGGGAAGAAGG + Intergenic
1029438956 7:100577019-100577041 GAAGGGAATTAGAGGGATGATGG + Intronic
1029551616 7:101239740-101239762 CAGGGAAAGGACAGCGAGGATGG + Exonic
1030207882 7:106968229-106968251 GTGGGAAATGAGGGGCATGAAGG + Intergenic
1030321989 7:108178977-108178999 CAGGGAAATGACAAAGAAGATGG - Intronic
1030962420 7:115943229-115943251 GAGGGGAATGAGTGGGATGGTGG + Intronic
1031259802 7:119504120-119504142 CAGGCAAATGAGAGAAATAAAGG - Intergenic
1031843616 7:126777226-126777248 CAGAGAAGTGAAAGGGAAGAGGG + Intronic
1031923027 7:127615113-127615135 CAGGGACAGGTGAGGCATGATGG + Intronic
1032125561 7:129189880-129189902 GAGGAAAAGGGGAGGGATGACGG + Intronic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1033256581 7:139806748-139806770 CAGACAGATGAGAGGGAGGATGG - Intronic
1033569131 7:142609928-142609950 GAGGGAGATCAGAGGGATTAAGG + Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034033806 7:147798958-147798980 CAGGCAAAGAAGATGGATGATGG + Intronic
1034371050 7:150597279-150597301 CAGGGAAGTGCAAGGGGTGAGGG + Intergenic
1034404203 7:150891345-150891367 AGGGGAAGGGAGAGGGATGAGGG + Intergenic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035239687 7:157521492-157521514 CAGGGCAGTGAGTGGGAGGAGGG + Intergenic
1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG + Intergenic
1036077575 8:5518884-5518906 CAGAGAAATGAGAGGGCAGCTGG - Intergenic
1037569569 8:20147189-20147211 AAAGGGAATGAGAGAGATGATGG + Intronic
1037791009 8:21941672-21941694 TAAGGAAATGGGAGGGATGCTGG + Intronic
1037812455 8:22095144-22095166 AAGGGAAAAGTGAGGGATGCAGG - Intronic
1038162349 8:25051999-25052021 AAAGGAAAGGAGACGGATGATGG + Intergenic
1039963800 8:42269652-42269674 AAGAGAAAGGAGAGGGAAGAGGG + Intergenic
1041785768 8:61631902-61631924 CATGGAGTGGAGAGGGATGAAGG + Intronic
1043050838 8:75383672-75383694 CTGGGAAATGACAGGAATGCAGG + Intergenic
1043300588 8:78726087-78726109 AAGGGAAATGTGAGGGAGGGTGG + Intronic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045357930 8:101405766-101405788 GAGGGAGATGAGAGGGAAGAGGG - Intergenic
1045375451 8:101569058-101569080 CACAGAAATGAGAGGCAGGAAGG + Intronic
1046438337 8:114225401-114225423 CAGAGAAAGGAAAGGGAGGAAGG - Intergenic
1046920480 8:119722884-119722906 GAGGAAAAAGAGAGGGATGGAGG + Intergenic
1046927073 8:119803366-119803388 CATGAAAATGAGAGAGAAGAAGG + Intronic
1047458472 8:125038696-125038718 CAGGGAACTGAATGGAATGAAGG + Intronic
1048041150 8:130729851-130729873 CAGGGAAATGAGAAGCATAGAGG + Intergenic
1048750529 8:137668616-137668638 CTGGGAACTGAGAAGGTTGAAGG + Intergenic
1048798790 8:138176850-138176872 CAAGGCAGTGAGAGGGTTGAGGG - Intronic
1050272182 9:3958101-3958123 CAGGGAACTGAGAGAGTGGAAGG - Intronic
1051226510 9:14904944-14904966 CAGGTAAATGAGGTGGTTGATGG - Intronic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051496965 9:17734191-17734213 CAGGTAAATTAAAGGGTTGAGGG - Intronic
1051857861 9:21589743-21589765 GAGGGAAAGGAGAGAGATAAGGG - Intergenic
1052113045 9:24613391-24613413 TCAGGAAATGAGAGGGATTATGG + Intergenic
1052467176 9:28843606-28843628 CAGAGAAAGGGGAGGGATGGAGG + Intergenic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1053603420 9:39632878-39632900 AGGGGAAATAAGAGGGATGCTGG - Intergenic
1053860424 9:42381302-42381324 AAGGTAAATAAGAGGGATTACGG - Intergenic
1053861050 9:42386598-42386620 AGGGGAAATAAGAGGGATGCTGG - Intergenic
1054250117 9:62709546-62709568 AGGGGAAATAAGAGGGATGCTGG + Intergenic
1054564228 9:66744075-66744097 AGGGGAAATAAGAGGGATGCTGG + Intergenic
1054752551 9:68922606-68922628 AAGGGAAAGGAGGTGGATGAAGG - Intronic
1054847932 9:69816745-69816767 CATGGAAAAGTAAGGGATGAGGG + Intergenic
1055166297 9:73199512-73199534 AAGGGCACTGAGAGGGAGGATGG + Intergenic
1055958717 9:81799008-81799030 GAAGGAAATGAGAGGGAACAGGG + Intergenic
1056217062 9:84415305-84415327 AAGGGAAATGAAAGGGAGGATGG - Intergenic
1056306841 9:85298924-85298946 TGGGGAAATGAGAGAGAGGAAGG + Intergenic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1056487459 9:87073149-87073171 CAGGGAAGTGAGGGGGATCATGG + Intergenic
1057189370 9:93077909-93077931 CATGGACATGAGCAGGATGATGG - Exonic
1057225973 9:93293299-93293321 CAGGGACAGGGGAGTGATGAAGG + Intronic
1057286404 9:93758326-93758348 CAGGGAAGGGAGAGGGACTAAGG - Intergenic
1057596012 9:96417272-96417294 AGAGGAAACGAGAGGGATGAGGG - Intronic
1057704982 9:97389729-97389751 GAGGGAACTGAGAGGGTGGAAGG - Intergenic
1058601862 9:106679065-106679087 CAGGGAAGTGAGAGAGAGAAAGG - Intergenic
1059286287 9:113174624-113174646 CAGAGAATAAAGAGGGATGATGG + Intronic
1059404464 9:114091573-114091595 GTGGGAAATTAGAGGGAGGAAGG - Intronic
1059934788 9:119298815-119298837 AAGGGAAAGGAGAGGGTTGTGGG - Intronic
1060433553 9:123572116-123572138 AAGGGAAATTTGGGGGATGATGG - Intronic
1060439859 9:123628313-123628335 CAGTGACATGGGAGGGAGGAAGG + Intronic
1060896299 9:127219771-127219793 CAGGCAAAGGAGTGAGATGATGG - Exonic
1061203647 9:129150926-129150948 CAGGGAAATGTAAGGCATGAGGG + Intergenic
1062269513 9:135702184-135702206 CAGGGCAACGCGAGGGAAGAAGG + Exonic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062707262 9:137952572-137952594 CAGGGGTATGACAGGGATAAGGG - Intronic
1186014064 X:5170602-5170624 TAGGGAAATGAGTGGTATTAGGG - Intergenic
1186058856 X:5681690-5681712 GAGGGAAGTGAGAGGAAAGAAGG + Intergenic
1186289451 X:8080714-8080736 CAAGGAAATGGGTGGAATGAGGG + Intergenic
1187002316 X:15195131-15195153 CAGGGAAATGAGAAACATTAGGG - Intergenic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1188085287 X:25895507-25895529 CAGGGAAAGGAAAGGGGAGAAGG + Intergenic
1190106452 X:47564557-47564579 AAGGGTAATGAGAGGCATGACGG - Intronic
1191041631 X:56087431-56087453 CAGGAACAAGAGAGGGGTGAGGG - Intergenic
1192254254 X:69442608-69442630 CAGAGAACTGAGAGGGAACATGG - Intergenic
1193376021 X:80762573-80762595 TGGGGAAAGGAGAGGGATAAAGG + Intronic
1194359580 X:92932975-92932997 CAGGGAAATGAAGGAAATGAAGG - Intergenic
1194465996 X:94236359-94236381 AAGGGAAAGGAGAGAGAGGAAGG - Intergenic
1195236087 X:102900072-102900094 CAGGGGAAAGGGAGGGATGGAGG - Intergenic
1195301797 X:103536979-103537001 CAGGGAAGGGAGAGGGATTGAGG + Intergenic
1195731829 X:107976246-107976268 GAGGGAAATGAGAGGGAGGGAGG + Intergenic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196740931 X:119025214-119025236 GAAGGAAAAGAGAGGAATGAAGG + Intergenic
1197734826 X:129843176-129843198 CAGGGAAACGAGAAGGTAGAAGG + Intronic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1199234524 X:145475518-145475540 CAGGGAAAGAAGAGGAATAAAGG + Intergenic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1199599885 X:149535568-149535590 AAAGGAGAGGAGAGGGATGAGGG - Intergenic
1199615067 X:149649579-149649601 CAGGGAAGTGACAAGGATGTAGG + Intergenic
1199650755 X:149944683-149944705 AAAGGAGAGGAGAGGGATGAGGG + Intergenic
1199661336 X:150053710-150053732 AAGGAGAATGAGAGGGATGATGG - Intergenic
1199852453 X:151735449-151735471 AAGTGAAATGGGAGGGATGGGGG - Intergenic
1200128398 X:153828969-153828991 CCGGGAACTGAGAGGGAAGAAGG + Intronic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1200667778 Y:6048798-6048820 CAGGGAAATGAAGGAAATGAAGG - Intergenic
1200988709 Y:9328389-9328411 CAGGGAAGTGTGAGTGATGATGG - Intergenic
1202119275 Y:21507799-21507821 CAGGGAAGTGTGGGTGATGATGG + Intergenic
1202121727 Y:21531339-21531361 CAGGGAAGTGTGGGTGATGATGG + Intronic
1202157278 Y:21898043-21898065 CAGGGAAGTGTGGGTGATGATGG - Intronic
1202159725 Y:21921584-21921606 CAGGGAAGTGTGGGTGATGATGG - Intergenic
1202161841 Y:21941999-21942021 CAGGGAAGTGTGAGTGAAGACGG - Intergenic
1202229515 Y:22644374-22644396 CAGGGAAGTGTGAGTGAAGACGG + Intergenic
1202313641 Y:23551791-23551813 CAGGGAAGTGTGAGTGAAGACGG - Intergenic
1202557162 Y:26118804-26118826 CAGGGAAGTGTGAGTGAAGACGG + Intergenic