ID: 920951460

View in Genome Browser
Species Human (GRCh38)
Location 1:210575151-210575173
Sequence ATTTCTCCCACCACAGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920951460_920951461 -1 Left 920951460 1:210575151-210575173 CCTGACTCTGTGGTGGGAGAAAT 0: 1
1: 0
2: 0
3: 22
4: 270
Right 920951461 1:210575173-210575195 TCATGCATCCCTTCCTCATATGG 0: 1
1: 0
2: 2
3: 15
4: 188
920951460_920951467 27 Left 920951460 1:210575151-210575173 CCTGACTCTGTGGTGGGAGAAAT 0: 1
1: 0
2: 0
3: 22
4: 270
Right 920951467 1:210575201-210575223 CTTATTGGCCCCTTTACTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 88
920951460_920951465 12 Left 920951460 1:210575151-210575173 CCTGACTCTGTGGTGGGAGAAAT 0: 1
1: 0
2: 0
3: 22
4: 270
Right 920951465 1:210575186-210575208 CCTCATATGGACATCCTTATTGG 0: 1
1: 0
2: 0
3: 8
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920951460 Original CRISPR ATTTCTCCCACCACAGAGTC AGG (reversed) Intronic
901447843 1:9319070-9319092 AATTCTCCCACCTCAGCCTCTGG - Intronic
902794780 1:18793985-18794007 AGATCACCCAACACAGAGTCAGG + Intergenic
904405574 1:30286109-30286131 ATTTTTCCCTCCCCAGGGTCGGG + Intergenic
904645452 1:31962404-31962426 AATTCTCCCACCTCAGTCTCCGG + Intergenic
904792017 1:33029782-33029804 AATCCTCCCACCACAGCTTCCGG + Intronic
905869897 1:41397380-41397402 AATTCTCCCACCTCAGCCTCCGG + Intergenic
905932602 1:41800234-41800256 ATTTCTCCCTCCCCTGAATCTGG + Intronic
908510539 1:64847188-64847210 ATGGCTCTCACCACACAGTCTGG - Intronic
908643933 1:66256069-66256091 AATCCTCCCACCTCAGACTCTGG - Intronic
911016845 1:93342767-93342789 ATTTCTCCCACATCATAGTCAGG + Intergenic
913460181 1:119077030-119077052 AATTCTCCCACCTCAGCCTCCGG - Intronic
913521533 1:119649205-119649227 ATTTCTGGGACCACAGACTCAGG + Intergenic
914316402 1:146516277-146516299 ATTTCTTCTACCCCAGAGGCTGG + Intergenic
914423177 1:147548735-147548757 AATTCTCCCACCTCAGCCTCTGG - Intronic
914497954 1:148217084-148217106 ATTTCTTCTACCCCAGAGGCTGG - Intergenic
916464994 1:165065007-165065029 ATTTCTTCCTACCCAGAGTCTGG + Intergenic
917099173 1:171428650-171428672 AGTTCTCCCACCTCAGCCTCTGG + Intergenic
917870824 1:179240467-179240489 ATTTCTCCCAGGCCAGAGTGCGG - Intergenic
918340315 1:183563200-183563222 TGTTCTCACACCACAGAGTCAGG + Exonic
918800806 1:188969218-188969240 ATTTCTCCCGCCTCAGCCTCCGG + Intergenic
919310503 1:195900986-195901008 ATTTTTCCCACCTCAGAGGGAGG - Intergenic
919621869 1:199872364-199872386 ATTTCTACCACCACCAAGTATGG + Intergenic
920670403 1:207999801-207999823 CTTTCTCCCAGCCTAGAGTCTGG + Intergenic
920736387 1:208536697-208536719 ATTTCTACCACCACTGAGTGCGG - Intergenic
920951460 1:210575151-210575173 ATTTCTCCCACCACAGAGTCAGG - Intronic
923265803 1:232312943-232312965 ATTTCTCCAACCATTGAGTCTGG - Intergenic
923520778 1:234733485-234733507 AAATCCCCCACCACAGAGCCTGG + Intergenic
923877754 1:238068191-238068213 AATTCTGCCACCAGGGAGTCAGG + Intergenic
1063126596 10:3141801-3141823 ACTTCTCCCACCACAGCCCCTGG - Intronic
1063272696 10:4529461-4529483 AATCCTCCCACCACAGGCTCTGG + Intergenic
1064023730 10:11829947-11829969 AATTCTCCCACCTCAGCCTCCGG + Intronic
1065785232 10:29206892-29206914 ATTTCTCCCCTGACAGAGTCTGG + Intergenic
1065928040 10:30453681-30453703 AGTCCTCCCACCAAAGAGTGAGG - Intronic
1066448410 10:35505424-35505446 ATTTGTCTCAACACTGAGTCTGG + Intronic
1068543672 10:58324123-58324145 AATTCTCCCACCCCAGCCTCTGG + Intergenic
1068981858 10:63071023-63071045 TTTCCTCCCACCACAGGGGCAGG + Intergenic
1071726682 10:88205260-88205282 ATATCACCCACCACAGAGAAAGG - Intergenic
1072181842 10:92991135-92991157 TTTTTTCCCAAGACAGAGTCTGG + Intronic
1072777031 10:98208241-98208263 TTTTCTTTCACCACAGAGTTAGG - Exonic
1074012793 10:109500511-109500533 ATTTCTGCCTCCTCAGAGTATGG + Intergenic
1075094609 10:119462690-119462712 AGTTCTCTCCCCACTGAGTCTGG - Intergenic
1076496855 10:130903255-130903277 CTATCTGCCACCACAGAGGCTGG - Intergenic
1077762535 11:5118821-5118843 AATTCTCCCACCTCAGCCTCTGG - Intergenic
1078161352 11:8842402-8842424 ATTTCTCCCTCTCAAGAGTCTGG + Intronic
1078772220 11:14361179-14361201 AATTCTCCCACCTCAGCCTCCGG - Intronic
1080945156 11:36964422-36964444 AATTCTCCCACCACAACCTCTGG - Intergenic
1081015620 11:37875984-37876006 AATTCTCCCACCACACACTGTGG + Intergenic
1081759935 11:45570085-45570107 GTCTCTCCTACCACAGAGTCAGG - Intergenic
1083663503 11:64262862-64262884 TGTTCTCCCACCTGAGAGTCGGG - Intronic
1084162917 11:67360156-67360178 AATTCTCCCACCTCAGCCTCCGG - Intronic
1085011477 11:73144183-73144205 ATTTCTCCTACCACAGGGCCTGG + Intergenic
1086396012 11:86415777-86415799 AGTTCTCCCACCTCAGCCTCTGG + Intronic
1087710966 11:101551808-101551830 ATGTCTCCCACCAGAGCCTCAGG + Intronic
1088498387 11:110456007-110456029 AGTTCTCTCATCACAGTGTCTGG + Intronic
1090257882 11:125298499-125298521 ACTTCACCCACCCCAGAGTCAGG - Intronic
1090470059 11:126972607-126972629 ATTTAGGCCACCACAGAGCCTGG + Intronic
1090656019 11:128846186-128846208 ATCTCTGCCACCCAAGAGTCAGG + Intronic
1091191693 11:133701091-133701113 CTTCCTCCCACCTCAGAGCCAGG + Intergenic
1091209110 11:133841784-133841806 CTCTCTGACACCACAGAGTCAGG + Intronic
1091856229 12:3742531-3742553 ATTTCTCCCAGCAGGGAGCCAGG - Intronic
1092645952 12:10572082-10572104 ATTTCTGCGAGCACAGAGTTGGG + Intergenic
1092672996 12:10884242-10884264 GTTTCTCCCAGCACAAAGTTGGG - Exonic
1092704714 12:11269694-11269716 GGTTCTCCCAGCACAGAGTTGGG - Exonic
1092708621 12:11310423-11310445 GTTCCTCCCAGCACAGAGTTGGG - Exonic
1092712829 12:11355578-11355600 GTTCCTCCCAGCACAGAGTTGGG - Exonic
1092716625 12:11395554-11395576 GTTCCTCCCAGCACAGAGTTGGG - Exonic
1093952627 12:25181214-25181236 AATTCTCCCACCTCAGCCTCAGG + Intronic
1094558397 12:31525885-31525907 AATTCTCCCACCTCAGCCTCTGG - Intronic
1095448077 12:42302315-42302337 AGTTATCCCTCGACAGAGTCAGG + Intronic
1095626925 12:44326055-44326077 AATTCTCCCACCTCAGCCTCTGG - Intronic
1097015485 12:55983761-55983783 GATTCTCCCACCACAGCCTCTGG + Intronic
1098452888 12:70640276-70640298 AATTCTCCCACCTCAGCCTCTGG + Intronic
1100422754 12:94453526-94453548 ATTTCTCCCATCAGAGAATAAGG + Intronic
1100458091 12:94772229-94772251 ATTTCTCCTAGCACAAATTCTGG - Intergenic
1100754327 12:97733610-97733632 ATTTCTCTCCACTCAGAGTCAGG + Intergenic
1100790019 12:98120142-98120164 AATTCTCCCACCTCAGCCTCTGG + Intergenic
1101572951 12:105971813-105971835 ATTGCACCCACCACAGTGGCTGG + Intergenic
1102038691 12:109786888-109786910 ATTTCTGCCACCAGAGCGGCAGG - Intronic
1102375290 12:112417161-112417183 AATTCTCCCACCTCAGCCTCCGG + Intronic
1102389403 12:112537310-112537332 AATTCTCCCACCTCAGCCTCTGG + Intergenic
1103347838 12:120263294-120263316 ATTCCTCCCACCCCAGGCTCCGG + Intronic
1104882309 12:132081122-132081144 TTTTCTCCCACCACAAAAACGGG + Intergenic
1104889516 12:132133500-132133522 AATTCTCCCACCTCAGGCTCCGG + Intergenic
1108807021 13:54170733-54170755 AGTCCTCCCACCTCAGCGTCTGG + Intergenic
1111142080 13:84132207-84132229 AATTCTCCCACCACATATCCTGG + Intergenic
1111656003 13:91154536-91154558 ATTTCTACTACCACTGAGTTAGG - Intergenic
1111780601 13:92718765-92718787 AATTCTCCCACCTCAGCCTCCGG - Intronic
1113958478 13:114112342-114112364 ATTTCTACCACGAGAAAGTCAGG + Intronic
1114886969 14:26864753-26864775 AATTCTCCCACCTCAGATTCTGG - Intergenic
1115617433 14:35109571-35109593 AATTCTCCCACCTCAGCCTCCGG + Intronic
1115779859 14:36757150-36757172 AATTCTCCCACCTCAGCCTCTGG - Intronic
1117247774 14:53902773-53902795 ACTCCTCTCACCACAGATTCAGG - Intergenic
1117329777 14:54701102-54701124 AATCCTCCCACCTCAGCGTCTGG + Intronic
1117365412 14:55022432-55022454 ATTTTTCCCCCCACAGAATAGGG + Intronic
1118218041 14:63828089-63828111 AATCCTCCCACCACAGCCTCTGG - Intergenic
1118905793 14:70022238-70022260 TTTTCTCCCAAAACGGAGTCAGG - Intronic
1119087791 14:71753298-71753320 ATTTCTCCTGGCACAGAATCAGG - Intergenic
1119782159 14:77283622-77283644 ATTTCCCTCACCACAGAATGAGG - Intronic
1119794838 14:77386534-77386556 ATTCCTCCCACCTCAGCCTCTGG - Intronic
1124032063 15:26020772-26020794 TTTTCTGGCAGCACAGAGTCTGG + Intergenic
1126029976 15:44487347-44487369 ATTCCTCCCACCTCAGCCTCTGG - Intronic
1127219354 15:56861431-56861453 AATTCTCCCACCTCAGCCTCCGG - Intronic
1127827442 15:62717492-62717514 GTCACTTCCACCACAGAGTCAGG - Intronic
1128230657 15:66032713-66032735 ATTTCTCCCACCAGATATCCTGG - Intronic
1129336753 15:74856697-74856719 ATTCCTCCCACCTCAGCCTCCGG + Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1131270326 15:90943321-90943343 AATTCTCCCACCTCAGCCTCTGG - Intronic
1131313079 15:91308254-91308276 TTTTATCTCCCCACAGAGTCTGG - Intergenic
1131603204 15:93871204-93871226 ATCTCTCCTACCACAGCCTCTGG + Intergenic
1133594923 16:7281969-7281991 AATCCTCCCACCTCAGCGTCCGG + Intronic
1134644537 16:15856001-15856023 TTTTCTTCCAGCACAGGGTCTGG - Intronic
1138904982 16:61320654-61320676 ATATCTCACACCCCAGAGTCTGG - Intergenic
1140450664 16:75068458-75068480 CTTTCTCCCACAGCAGAGTCGGG + Intronic
1143551246 17:7631708-7631730 ATTTCTCCCTCCAGGGACTCAGG + Exonic
1143896627 17:10141548-10141570 GTTACTCCCTCCACAGAGCCCGG + Intronic
1144271144 17:13617257-13617279 ATTCCTCCCACCTCAGTCTCTGG - Intergenic
1146302292 17:31698787-31698809 ATTTCTCCCATGTCTGAGTCTGG - Intergenic
1146726280 17:35158971-35158993 ATTTCACTCCCCACAGATTCAGG - Intronic
1147930155 17:43974473-43974495 TTTGCTCACACCACAGAGACTGG - Intronic
1148637593 17:49160541-49160563 ATTTCTCCCTCCAGTGAGTCTGG + Exonic
1150182697 17:63141459-63141481 AATTCTCCCACCTCAGCCTCTGG - Intronic
1151248717 17:72816923-72816945 ATTTCCCAGACCACAGAGTCTGG - Intronic
1151500794 17:74487374-74487396 AATTCTCCCACCTCAGCCTCTGG + Intergenic
1151603508 17:75121517-75121539 AATTCTCCCACCTCAGCCTCCGG + Intronic
1151863883 17:76786919-76786941 AATTCTCCCACCTCAGCCTCCGG + Intergenic
1152077230 17:78167307-78167329 AATTCTCCCACCTCAGCCTCTGG + Intergenic
1152181615 17:78825670-78825692 ATTTCTTCCACCGTAGACTCTGG + Intronic
1152389009 17:79991936-79991958 TTTTCTCCCACCCCAGAATTGGG - Intronic
1152495561 17:80668991-80669013 GCTTCTCACACCACAGAGGCTGG + Intronic
1152537880 17:80960916-80960938 ATTTCACCCAGCACAGAGCGAGG + Intronic
1153392640 18:4579458-4579480 ATTTCTCCCACTTCAGTATCCGG - Intergenic
1154201835 18:12305730-12305752 AATCCTCCCACCTCAGACTCTGG + Intergenic
1157423044 18:47561953-47561975 CTCTCTCCCACCACACAGCCAGG + Intergenic
1157722209 18:49933979-49934001 AATTCTCCCACCTCAGCCTCTGG + Intronic
1157830639 18:50854241-50854263 ATTTCACCCACCACACTGGCAGG - Intergenic
1160176963 18:76602628-76602650 ATTCATCCCACCACAGAGGAAGG - Intergenic
1161090878 19:2359646-2359668 GATCCTCCCACCTCAGAGTCTGG - Intergenic
1164567295 19:29336052-29336074 ATTTCTCCCACCCCAGTCTCTGG - Intergenic
1165726532 19:38116746-38116768 AATTCTCCCACCTCAGTCTCTGG - Intronic
1165902476 19:39175186-39175208 ATTCCTCCCACTCCAGAGTGGGG + Intronic
1167338529 19:48901110-48901132 ATTTTCCACACCTCAGAGTCAGG - Intronic
1168090714 19:54081419-54081441 CTCTCTCCCACCCCAGAGTGTGG + Intergenic
925771407 2:7286018-7286040 ATCTCTTCCAACTCAGAGTCAGG - Intergenic
925818235 2:7774181-7774203 ATTCCTCTCAACATAGAGTCTGG - Intergenic
926115469 2:10210329-10210351 AGTTCTCTCACTGCAGAGTCTGG + Exonic
927971280 2:27307465-27307487 CTTTCCCCCACCCCAGAGTTGGG - Exonic
928936021 2:36678914-36678936 AATTCTCAAACCACAGAATCAGG - Intergenic
929178819 2:39010582-39010604 ACTTCTCAAACCACAGAGTGAGG + Exonic
931366443 2:61623208-61623230 AATTCTCCCACCTCAGCCTCCGG - Intergenic
931446729 2:62333009-62333031 GTTCCTCCCTCCACAGTGTCAGG - Intergenic
932164676 2:69495205-69495227 ACTCCTCCCACCAAAGAGTACGG + Intronic
932966722 2:76484451-76484473 ATTTCTCCCATTAGAGAGTTTGG - Intergenic
934576815 2:95407136-95407158 GGTCCTCCCACCACAGAGCCAGG + Exonic
934639034 2:96015304-96015326 GGTCCTCCCACCACAGAGCCAGG + Intergenic
934794614 2:97090108-97090130 GGTCCTCCCACCACAGAGCCAGG - Exonic
936563410 2:113561960-113561982 AATTCTCCCACCTCAGCCTCCGG + Intergenic
938156126 2:128941780-128941802 AATTCTCCCATGACAGAATCTGG + Intergenic
940661745 2:156553931-156553953 ATTTCTCCCAACATAGAATGAGG - Intronic
943009456 2:182429556-182429578 ATTTCTAACAGCACTGAGTCGGG - Intronic
943331121 2:186560310-186560332 ATTCCTCCCACCTCAGCCTCTGG - Intergenic
943898115 2:193393934-193393956 AATTCTCCCACCTCAGCCTCTGG - Intergenic
946131127 2:217607760-217607782 ATTTCACTCAGCACAGAGCCTGG + Intronic
946819034 2:223611320-223611342 CTTTCCCTCACCACAGAGGCAGG + Intergenic
947144540 2:227052606-227052628 ATTTGTCCAGCCACAGAGTCTGG + Intronic
947975999 2:234366952-234366974 ATTTCTCCCCCCACAGTTTTAGG - Intergenic
948790218 2:240372935-240372957 ATTTCTCACAGCCCAGAGGCTGG + Intergenic
948964892 2:241371376-241371398 AATTCTCCCACCTCAGCCTCTGG - Intronic
1170393651 20:15902926-15902948 ATTTCCCCCACCACACACACAGG - Intronic
1173023043 20:39283948-39283970 ATTCATCCCAGCCCAGAGTCAGG - Intergenic
1173582485 20:44157436-44157458 ATGTCTCCCACCGCCCAGTCCGG + Intronic
1174598034 20:51700414-51700436 ATTCCTCCCACCTCAGTCTCCGG - Intronic
1175358372 20:58387458-58387480 AATCCTCCCACCTCAGACTCCGG - Intergenic
1175709120 20:61205227-61205249 AATCCTCCCACCACATGGTCAGG + Intergenic
1178486965 21:33025537-33025559 AATACGGCCACCACAGAGTCAGG - Intergenic
1182174083 22:28265366-28265388 ATTTCTCCCTCTACAAAGACTGG - Intronic
1182987294 22:34732196-34732218 AGTCCTCCCACCACAGCCTCTGG - Intergenic
1183013426 22:34966520-34966542 ATTTCTCCACCCGCTGAGTCTGG + Intergenic
1183299200 22:37050635-37050657 ACTTCTCCCAGCACAGGGCCAGG + Intergenic
1184737087 22:46405749-46405771 CTTTGTCCCACCACAGTGGCAGG + Intronic
1185011537 22:48317250-48317272 ATTTCTTCCTCCGCAGAGTGAGG + Intergenic
1185017444 22:48352939-48352961 CTTCCTCCGACCACAGAGTGTGG - Intergenic
950284343 3:11733102-11733124 ATTTCTCCTGCCACAGCCTCCGG + Intergenic
954925015 3:54226406-54226428 AATTCTCCCACCACAGCCTCTGG + Intronic
955545869 3:60029541-60029563 AATTCTCCCACCACACTGCCTGG + Intronic
956416277 3:69033575-69033597 ATTTCTCCCACGACGATGTCTGG + Exonic
957085399 3:75672291-75672313 ACTGCTCCCACCACAGGGACAGG - Intergenic
957785652 3:84878686-84878708 CTCTCTCCCACCACTGAGTATGG + Intergenic
964088248 3:152844515-152844537 ATATCTCCCACCTGAGAGTATGG + Intergenic
964370258 3:155992995-155993017 AATTCTCCCACCTCAGCCTCTGG + Intergenic
965425870 3:168522146-168522168 GTTTCTCTCCCCACAAAGTCAGG - Intergenic
967377579 3:188822542-188822564 ATTCTTTCCACCACAGAGTGTGG - Intronic
968089020 3:195888600-195888622 ACTCCTCCCCCCACAGAGGCTGG - Exonic
968378803 4:70441-70463 AATTCTCCCACCTCAGCCTCTGG + Intronic
969006154 4:4021466-4021488 GTTTGTCCCACAACAGAGTTGGG - Intergenic
969806795 4:9615824-9615846 GTTTGTCCCACAACAGAGTTGGG + Intergenic
970229467 4:13893890-13893912 ATTTCTCCTACCCTAGATTCAGG + Intergenic
975598624 4:76075577-76075599 ATCTCTCCCACCACAGTCACTGG - Intronic
976101853 4:81572906-81572928 TTTTCTCTGACCACTGAGTCTGG - Intronic
977689181 4:99884952-99884974 TTTTCTTCCAAGACAGAGTCTGG - Intronic
977790411 4:101093796-101093818 ATTTCACTCACAACACAGTCAGG - Exonic
980941819 4:139281773-139281795 AGTTCTCCCACCTCAGCCTCTGG - Intronic
981129333 4:141141096-141141118 AGTTCTCTCACCACATAGTAAGG + Intronic
981830353 4:148992694-148992716 ATTTCTACCACAAAAGTGTCAGG + Intergenic
982130271 4:152223100-152223122 ATTCCTCCCACCACGTACTCTGG + Intergenic
984256428 4:177394772-177394794 AATTCTCCCACCTCAGCCTCTGG - Intergenic
985216956 4:187663794-187663816 ATCTCTCCCACGAAAGAATCAGG + Intergenic
985445557 4:190019406-190019428 ACTGCTCCCACCACAGGGACGGG + Intergenic
985723813 5:1505297-1505319 ACTGCTTCCACCACAGAGTGCGG + Intronic
985723821 5:1505370-1505392 ACTGCTTCCACCACAGAGTGCGG + Intronic
986030935 5:3891991-3892013 ATTTCTCTCTCCACCAAGTCAGG - Intergenic
992197414 5:74353801-74353823 ATTTCAGCCACCACACAGTCAGG - Intergenic
993121880 5:83784958-83784980 ATTTCTCCAGCCCCAGATTCTGG + Intergenic
994209397 5:97071633-97071655 ATCTCTCACACTACAGTGTCAGG - Intergenic
994269513 5:97760388-97760410 CTTTCTCCCACTACTGAGGCAGG - Intergenic
994468703 5:100174227-100174249 TTGTCTCTCACCACTGAGTCTGG + Intergenic
997333263 5:133083204-133083226 AATTCTCCCACCTCAGCCTCCGG - Intronic
998059804 5:139111025-139111047 ACCTCACCCACCACAGTGTCAGG + Intronic
998555086 5:143115225-143115247 AATTCTCCCACCTCAGCCTCCGG - Intronic
1001644886 5:173272965-173272987 CTTTCTCCCATCACACAGGCTGG - Intergenic
1002019226 5:176351650-176351672 AATTCTCCCACCTCAGCCTCTGG - Intronic
1002966261 6:1969644-1969666 CTTCCTCCCATCTCAGAGTCTGG + Intronic
1004893297 6:20122458-20122480 ATTCCTCCTAGCACAGAATCTGG + Intronic
1005288030 6:24349908-24349930 TTTGCACCCACCTCAGAGTCAGG - Intronic
1005329605 6:24736813-24736835 AATTCTCCCACCTCAGCCTCCGG - Intergenic
1005362153 6:25041088-25041110 ATTTTTCTCACAACAGAGACAGG + Intronic
1007910423 6:45508029-45508051 ATTTGTCCAATCACACAGTCTGG + Intronic
1007947470 6:45839249-45839271 ATTTCACCCACAACAGTGACTGG + Intergenic
1012905358 6:105058271-105058293 CTTCCTCCCACCACATAGTTGGG + Intronic
1016809623 6:148247431-148247453 ACTTCTGCCATCACAGCGTCAGG - Intergenic
1017566045 6:155687976-155687998 ATTTCTTCCACCCCAGTGTGGGG + Intergenic
1018095170 6:160379820-160379842 ATTTCTCCCATCATTGAATCTGG + Intronic
1019508880 7:1407330-1407352 GATTCTCCCACCTCAGACTCCGG + Intergenic
1021434576 7:20599740-20599762 TTTTCTCCCTCCACAAAGCCAGG - Intergenic
1021689467 7:23217999-23218021 ATTTCTCCCACACCCGAGTTTGG - Intergenic
1022882451 7:34602117-34602139 AATTCTCCCACCTCAGTCTCTGG - Intergenic
1023598365 7:41856056-41856078 ATCACTCCCATCACAGGGTCTGG - Intergenic
1023950283 7:44838545-44838567 AATTCTCCCACCTCAGCCTCCGG - Intronic
1026053835 7:66968076-66968098 ATTTCCCACACCCCAGAGTATGG - Intergenic
1026343249 7:69452260-69452282 AATTCTCCCACCTCAGCCTCCGG + Intergenic
1028276646 7:88865424-88865446 ATTTCTCCCACCTCAGCCTCAGG - Intronic
1030032246 7:105380235-105380257 AATTCTCCCACCTCGGACTCTGG + Intronic
1030156442 7:106460380-106460402 GTTTCTCCCAAGACAGAGTGGGG - Intergenic
1030190748 7:106807911-106807933 ATTTTTCCTTCCATAGAGTCAGG + Intergenic
1031082920 7:117275791-117275813 ATTTTTCCCACCTCAGTGGCAGG + Intergenic
1032234460 7:130108121-130108143 GATTCTCCCACCTCAGCGTCTGG - Intronic
1033241456 7:139683004-139683026 TTCTCTCCCACCAGAAAGTCTGG - Intronic
1033546882 7:142409414-142409436 ATTTCTACAACCATAGTGTCTGG - Intergenic
1033596078 7:142859229-142859251 ATTTCTCCTGCCACAGAGATGGG - Intronic
1034574592 7:151986086-151986108 ATATCACCCAGCACAGAGCCTGG - Intronic
1035030443 7:155853622-155853644 AATTCTCCCACCTCAGCCTCCGG - Intergenic
1036018382 8:4813290-4813312 ATCACTCCCCCCACAGAGCCGGG + Intronic
1038050258 8:23802378-23802400 ATTTCTCCAAGCACAGATACAGG - Intergenic
1038546282 8:28427888-28427910 AATTCTCCCACCTCAGCCTCTGG - Intronic
1039072635 8:33660465-33660487 AATCCTCCCACCACAGCCTCTGG - Intergenic
1039315745 8:36369640-36369662 ATTTCTCTCACCAAAAAGTGGGG - Intergenic
1040841515 8:51790324-51790346 ATTTCCTCCACCACAAAGTGAGG + Intronic
1042029657 8:64462238-64462260 ATTTCTCCCTCCACGGTGTAAGG + Intergenic
1042825017 8:72971423-72971445 GATTCTCCCACCACAGCCTCTGG - Intergenic
1044303294 8:90609654-90609676 ATTTTTCCCATCACAGAGACTGG + Intergenic
1044621049 8:94191011-94191033 CTTCCTCCCACCACAGAGACCGG + Intronic
1044719079 8:95128570-95128592 AATTCTCCCACCTCAGCCTCCGG + Intergenic
1044935233 8:97287551-97287573 AGAGCTCCCACCACAGAATCTGG + Intergenic
1047143654 8:122171841-122171863 ATTACTCCAAACACAGTGTCAGG - Intergenic
1049410467 8:142471754-142471776 CTTCCTCCCGCCACAGAGGCGGG - Intronic
1049889319 9:53765-53787 AATTCTCCCACCTCAGCCTCCGG - Intergenic
1050279418 9:4034781-4034803 ATTCCTCACACCCCAGAGTATGG + Intronic
1050867892 9:10527242-10527264 ATGCCTCCCACTACAGAGGCAGG + Intronic
1052141966 9:24997117-24997139 ATTGCTCCCACTACAAAGGCTGG - Intergenic
1053730811 9:41055050-41055072 AATTCTCCCACCTCAGCCTCCGG - Intergenic
1054207589 9:62144699-62144721 ATTTCTACCTGCACACAGTCTGG + Intergenic
1054630763 9:67443655-67443677 ATTTCTACCTGCACACAGTCTGG - Intergenic
1054867899 9:70021463-70021485 TTTTCCCCCACCACAAAGGCTGG + Intergenic
1055215936 9:73862049-73862071 AATTCTCCCACCTCAGCCTCCGG + Intergenic
1055629806 9:78212120-78212142 ATTTCTCCCACCTGAAAGTCTGG - Intergenic
1055681368 9:78718997-78719019 AATTCTCCCACCTCAGCCTCCGG + Intergenic
1055932294 9:81571889-81571911 ATTTCTCTTACCACACAGGCAGG + Intergenic
1058627564 9:106950982-106951004 AATTCTCCCACCTCAGCCTCCGG - Intronic
1059060670 9:111032574-111032596 ATTTCTCCCTCCAAAGACCCAGG + Intronic
1059248886 9:112870715-112870737 GATTCTCCCAGCACAGTGTCAGG - Exonic
1185497758 X:570660-570682 CTTGCTCCCATCACAGAGGCTGG + Intergenic
1185790690 X:2926877-2926899 AATCCTCCCACCTCAGAATCAGG - Intronic
1186681570 X:11880312-11880334 ATTTCTCCTAACACAGTGCCTGG + Intergenic
1188028391 X:25235333-25235355 ATTTCCCCCACCCCAGACCCTGG - Intergenic
1189998685 X:46663851-46663873 AATTCTCCCACCTCAGCCTCTGG - Intronic
1190328091 X:49218935-49218957 CTTTCTCACACCCCAGATTCTGG - Exonic
1191604452 X:63045268-63045290 ATTCCTGTCACCACAGAATCAGG - Intergenic
1192928174 X:75778253-75778275 ATTTGTCCTTCCACAGAGACTGG + Intergenic
1194134235 X:90119988-90120010 AATTCTCCCACCTCAGCCTCTGG - Intergenic
1194597777 X:95880208-95880230 ACTTCTCCCACCCCAGAAGCTGG + Intergenic
1197094365 X:122575329-122575351 ATTTCTCCCACATCCGAGTTAGG + Intergenic
1197144233 X:123153871-123153893 AATTCTCCTACCTCAGACTCTGG + Intergenic
1199458260 X:148053804-148053826 AACTCTACCTCCACAGAGTCTGG - Intergenic
1201252842 Y:12076895-12076917 ATTTCTCACACCTCAGAGAGGGG + Intergenic