ID: 920953768

View in Genome Browser
Species Human (GRCh38)
Location 1:210598630-210598652
Sequence AGAAAGATCACAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 8, 3: 61, 4: 337}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920953768_920953775 19 Left 920953768 1:210598630-210598652 CCCACAGTCACTGTGATCTTTCT 0: 1
1: 0
2: 8
3: 61
4: 337
Right 920953775 1:210598672-210598694 TCACTCCCCGTGGCTGCTGTTGG 0: 1
1: 0
2: 0
3: 19
4: 161
920953768_920953780 26 Left 920953768 1:210598630-210598652 CCCACAGTCACTGTGATCTTTCT 0: 1
1: 0
2: 8
3: 61
4: 337
Right 920953780 1:210598679-210598701 CCGTGGCTGCTGTTGGAGGATGG 0: 1
1: 0
2: 2
3: 43
4: 328
920953768_920953781 29 Left 920953768 1:210598630-210598652 CCCACAGTCACTGTGATCTTTCT 0: 1
1: 0
2: 8
3: 61
4: 337
Right 920953781 1:210598682-210598704 TGGCTGCTGTTGGAGGATGGAGG 0: 1
1: 1
2: 9
3: 80
4: 757
920953768_920953774 9 Left 920953768 1:210598630-210598652 CCCACAGTCACTGTGATCTTTCT 0: 1
1: 0
2: 8
3: 61
4: 337
Right 920953774 1:210598662-210598684 GTACAAGTTGTCACTCCCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 36
920953768_920953776 22 Left 920953768 1:210598630-210598652 CCCACAGTCACTGTGATCTTTCT 0: 1
1: 0
2: 8
3: 61
4: 337
Right 920953776 1:210598675-210598697 CTCCCCGTGGCTGCTGTTGGAGG 0: 1
1: 0
2: 4
3: 27
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920953768 Original CRISPR AGAAAGATCACAGTGACTGT GGG (reversed) Intronic
902245750 1:15119350-15119372 AGACAGACCACAGTGACACTTGG - Intergenic
902602021 1:17546553-17546575 AGAAAGATCTCAGGGCCTGCCGG - Intronic
904304477 1:29578805-29578827 AGAAAGCTCAGTGTGACTGCTGG + Intergenic
905904262 1:41606935-41606957 AGAAAGATCATACTGACTTTAGG - Intronic
907263954 1:53243669-53243691 TGAAAGAGCACAGGGACTTTAGG - Intergenic
908803792 1:67908748-67908770 AGAAAGCTCACTCTGACTGCAGG - Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910226558 1:84941999-84942021 AGGAAGATCAGTGTGGCTGTAGG - Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
912537995 1:110390174-110390196 AGCCTGATCTCAGTGACTGTGGG + Intronic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
913167558 1:116202350-116202372 AGAAAGCAAACAGTGACTTTAGG + Intergenic
914426013 1:147577344-147577366 AGAAAAGCCACAGGGACTGTAGG - Intronic
914698333 1:150106815-150106837 AAACAGAAGACAGTGACTGTGGG - Intronic
914844962 1:151278014-151278036 GGAAAGATGACAGTAAGTGTGGG - Intergenic
915011210 1:152687797-152687819 AGAAGGAGTTCAGTGACTGTGGG - Intergenic
915622763 1:157095913-157095935 AAAAAGATCACAGAGACACTTGG - Intronic
916744401 1:167673484-167673506 AGGAAGCTCACAGTGAGTGTTGG + Intronic
917037527 1:170765387-170765409 AGAAGGAGCACATTGACTCTTGG - Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917829624 1:178866456-178866478 AGAATGCTCACAGTCATTGTGGG + Intronic
918238713 1:182603603-182603625 AGAGAGATCAGTGTGACTTTAGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919506681 1:198407706-198407728 AGGAAGTTCACAGTGCCTGCAGG - Intergenic
919779848 1:201214677-201214699 AGAGACATCACAGTGACTCAGGG + Intronic
919971008 1:202578651-202578673 AGAAAACTCACAGTGATTGTAGG + Intronic
920031513 1:203040199-203040221 ACAGTGCTCACAGTGACTGTGGG + Intronic
920582552 1:207125347-207125369 AGAAAGATAACTCTGGCTGTGGG + Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920671692 1:208008584-208008606 AGAGAGATGAGAGTGACAGTGGG - Intergenic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921264753 1:213412889-213412911 AGAAAGAGCACTGTGGCTGGGGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922772883 1:228197776-228197798 AGAAAGATCAGAGTGAGCGGTGG + Intergenic
923686132 1:236154998-236155020 AGAAACATAACAGTGATGGTAGG + Intronic
1064964269 10:20999693-20999715 AGATAGGTCCCAGTGAGTGTAGG - Intronic
1065374462 10:25024090-25024112 AGAAAGAGCACAGATACTGTTGG + Exonic
1066400312 10:35069610-35069632 AGAGAAATAACAGTGACTGAAGG + Intronic
1066622645 10:37374576-37374598 AGAAACAGCACAGGGACTGTGGG + Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069026795 10:63551245-63551267 AGAAAGATCCCAGTGACCCAAGG + Intronic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069931187 10:71882806-71882828 AGAAAGAAAACAGGGCCTGTTGG - Intergenic
1070104297 10:73416803-73416825 AGAAAGATCACTCTGACTCAGGG - Intergenic
1071109722 10:82141642-82141664 AAAAAAATCACAGTGATTCTAGG + Intronic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072556922 10:96525290-96525312 AGAAAGATGAGAGGGACTGAAGG - Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073870918 10:107863245-107863267 ACAGAGACCACAGTGAGTGTGGG + Intergenic
1074430573 10:113390710-113390732 AGAAAGTTGACAGTGACTGGCGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1076222240 10:128743617-128743639 AGAAAGATCTCAGTGAAGATGGG + Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1078019335 11:7642228-7642250 AGAGGAAGCACAGTGACTGTAGG + Intronic
1078644577 11:13128693-13128715 AGAAAGATCACTCTGGCTGGAGG - Intergenic
1079151981 11:17908113-17908135 AGAAAGATCACTGTGATGGCAGG - Intronic
1080638613 11:34145028-34145050 AGACAGGTCACACTGACAGTGGG - Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1085122856 11:73978326-73978348 AGAAACTTCACAGTGGCAGTAGG + Exonic
1085379803 11:76105136-76105158 AGATAGATCACAGAAACTGTGGG + Intronic
1086198481 11:84170869-84170891 AGAAAAATCACAGTAACAATTGG - Intronic
1086221253 11:84446435-84446457 AGAAAGATTATAGTTTCTGTGGG + Intronic
1088720517 11:112588138-112588160 AGAAAAAACTCAGTGCCTGTGGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1091088725 11:132749014-132749036 AGAAACATCACAGTGTGTATTGG - Intronic
1092112099 12:5971117-5971139 AGAAATAGCAGAGGGACTGTGGG + Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093025266 12:14239984-14240006 AGAAAGATTGCTGTGGCTGTGGG + Intergenic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093680704 12:21998939-21998961 AGAAAAGTCAAAGTGACTGTGGG + Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095335061 12:41013944-41013966 TGAAAGATTACATAGACTGTTGG - Intronic
1095875734 12:47078902-47078924 CTGATGATCACAGTGACTGTGGG - Exonic
1096695883 12:53347957-53347979 AGAAAGAACACAAGGACTTTTGG - Intergenic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098835126 12:75415313-75415335 AAAAAGATTACTGTGGCTGTTGG + Intronic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099424005 12:82500736-82500758 AGAAAAATCACACTGACTGTTGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100893066 12:99147552-99147574 AGAAAGATCACTCTGGCTGTAGG + Intronic
1101012338 12:100463851-100463873 AGAAAGATGAAGGTCACTGTTGG - Intergenic
1101205798 12:102486148-102486170 AGAAAGTTCACAGTGATGGGGGG + Intergenic
1102161150 12:110770131-110770153 AGAAAGATCAGTGAGACTTTTGG - Intergenic
1102393621 12:112569596-112569618 TGAAACCTCACAGTAACTGTAGG + Intergenic
1103585731 12:121954087-121954109 AGAAAGGTTATAGTTACTGTTGG - Intronic
1107282071 13:38748181-38748203 AGACAGACCACATTTACTGTTGG - Intronic
1109460777 13:62654808-62654830 AAAAAGGTCCCAGTGATTGTTGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113303748 13:109053473-109053495 AGAAAGATCTCTATGACTGGAGG + Intronic
1113616541 13:111684695-111684717 AAACAGATCACAGTAACTGGGGG - Intergenic
1113622071 13:111769966-111769988 AAACAGATCACAGTAACTGGGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1118313572 14:64710049-64710071 AGACAGGTCCCAATGACTGTAGG - Intronic
1118982271 14:70726448-70726470 AGCAACATCAGAGTGACAGTTGG - Intronic
1119027234 14:71163896-71163918 AGAGAGATCACAGTCTATGTGGG - Intergenic
1119934806 14:78582099-78582121 AGACAGTTCAGAGTGATTGTGGG + Intronic
1120236837 14:81902391-81902413 AGAAAGCTTACAGTGACTTATGG - Intergenic
1120550401 14:85864394-85864416 AGCCAGACCACAGTGAATGTTGG + Intergenic
1121544955 14:94756371-94756393 AGAAAGAGCAGAGTGTCTGGTGG + Intergenic
1121880603 14:97497190-97497212 AGAAGGTACACAGTGAATGTTGG + Intergenic
1124107494 15:26753729-26753751 AGAAAGGAGACAGTGAATGTGGG + Intronic
1124249566 15:28097886-28097908 GGAAAGATCACTGTGGCTGGGGG - Intronic
1124685798 15:31780900-31780922 GGAAGGAATACAGTGACTGTAGG + Intronic
1124913152 15:33942958-33942980 AGAAAAATAAAAGTGAATGTTGG + Intronic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1126146379 15:45476633-45476655 ACAGTGATCACAGTGAATGTTGG - Intergenic
1126826493 15:52555272-52555294 AGAAAAATTACAGTGACAATTGG + Intronic
1127762009 15:62148574-62148596 GGAAAGATCACAATGGCTGATGG - Intergenic
1128117337 15:65118157-65118179 AGGAAGATGGCAGTGGCTGTAGG - Exonic
1128128047 15:65207297-65207319 AGAAAGCTCACCCTGACTGCAGG - Intronic
1129012368 15:72432624-72432646 AAAAAAATCTAAGTGACTGTGGG - Intergenic
1130579076 15:85118513-85118535 AGAAAGATCACATTGGCAGTAGG - Intronic
1131266794 15:90920250-90920272 AGCAGGATCAGAGTGACTCTGGG + Exonic
1133485806 16:6217384-6217406 TGAGAGATCACTGAGACTGTAGG - Intronic
1136119144 16:28118805-28118827 AGGAAGTGCTCAGTGACTGTTGG - Intronic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1142911313 17:3094481-3094503 TGACAGTTCTCAGTGACTGTGGG + Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1148344370 17:46893748-46893770 AGAAAGATTGCTGTAACTGTCGG + Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149587477 17:57802133-57802155 AGAAAGATAACAGTGTACGTAGG - Intergenic
1150367731 17:64605130-64605152 AGACAGATAACAGTGATTGGAGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150586069 17:66519229-66519251 CGAAAGTTCACAGGGATTGTTGG + Intronic
1150855428 17:68747703-68747725 AGAAAAATCACAATCTCTGTTGG - Intergenic
1151033083 17:70764457-70764479 AGAAAGTTCACAGTTCTTGTAGG + Intergenic
1152202515 17:78955321-78955343 AGCAAGATCCCAGTGACTGAGGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153368850 18:4290529-4290551 AGAAGGTTCACGGTCACTGTCGG + Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1156177687 18:34565996-34566018 AGCAAGCACTCAGTGACTGTGGG + Intronic
1156608794 18:38701525-38701547 AGAAAGATCACTGTGCATCTAGG + Intergenic
1156908839 18:42386850-42386872 AGAGAGATCACAATGACTTGGGG - Intergenic
1158217924 18:55119574-55119596 ACAAAGTTCACTGTGGCTGTGGG - Intergenic
1158578344 18:58659571-58659593 ACAATGATCACAGTGACTGCAGG - Intergenic
1159285042 18:66337554-66337576 GGGAAGAGCTCAGTGACTGTGGG - Intergenic
1159803849 18:72930497-72930519 AGAAATATCAAAGTTACAGTAGG - Intergenic
1161785016 19:6319214-6319236 AGAAGGAGGACAGAGACTGTGGG + Intronic
1164129056 19:22345499-22345521 AGAATCATCACTGTGCCTGTCGG - Intergenic
1164893809 19:31850780-31850802 AGAAAAATCTAAGTGACTTTGGG + Intergenic
1165392036 19:35544402-35544424 CAAAAGATCCCAGTGACTGTGGG - Intronic
1167025623 19:46915346-46915368 AGAAAAATCTCAATGACTGTAGG - Intergenic
1168591060 19:57634458-57634480 AGAATGAACACAGTGACTAATGG + Intronic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925693283 2:6547677-6547699 AGAAAGATCCCAAAGACTGAAGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926977820 2:18532627-18532649 AGAAGGATCACTCTGACTGCAGG - Intergenic
926980848 2:18566498-18566520 AGAAAACTCATAGTGACTGTTGG + Intronic
927521478 2:23701360-23701382 AGAGAGATCACTGTGTCTGCAGG - Intronic
930077970 2:47422828-47422850 AGAAGCATCACAGTTACTGTTGG - Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
932989258 2:76766066-76766088 AGAAAGATCCCAGTATCTGGAGG - Intronic
933783573 2:85819569-85819591 AGCAAGAACCCAATGACTGTTGG + Intergenic
935720504 2:105974922-105974944 AAAAAGATCACTGTGCCTGCAGG - Intergenic
937085364 2:119168251-119168273 AAAAATAACACAATGACTGTTGG - Intergenic
938291759 2:130154395-130154417 AGGAAGCTCCCAGTGAATGTGGG + Exonic
938464791 2:131518568-131518590 AGGAAGCTCCCAGTGAATGTGGG - Intergenic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941241449 2:163043647-163043669 AAAAATATCCCAGGGACTGTTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942311803 2:174663416-174663438 AGAAAGATTACAATAAATGTGGG + Intronic
942548411 2:177089377-177089399 AGAAAGAACACTGTGAATCTGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
944129785 2:196335327-196335349 AGAGAAATTCCAGTGACTGTAGG - Intronic
944568348 2:201015272-201015294 AGAAAGGTTACAAAGACTGTAGG - Intronic
944613989 2:201441661-201441683 AGAAAGAGCACACTGTCTGGAGG - Intronic
946540085 2:220674971-220674993 AGAAAAATCACAGGGACATTAGG + Intergenic
946812286 2:223538669-223538691 AGCAAGCTCACAGTCACTGTTGG - Intergenic
947027403 2:225751960-225751982 AGAAAGACAACAGAGACTGTAGG - Intergenic
947989923 2:234478717-234478739 AGACTGAGCACAGTGACTCTAGG + Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
948726308 2:239936145-239936167 AGAGAGTGAACAGTGACTGTTGG + Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170561662 20:17563645-17563667 AGAAAGATCCCAGAAACTGGTGG - Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170878010 20:20268474-20268496 TGAAATACAACAGTGACTGTGGG - Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1173142440 20:40495901-40495923 AGAAGGAGCCCAGTGCCTGTTGG + Intergenic
1174286183 20:49475282-49475304 AGAAAGCTCTCAATAACTGTTGG - Intronic
1174371149 20:50088982-50089004 ATGCAGATCACAGTAACTGTTGG + Intronic
1175549412 20:59807351-59807373 AGGAAGATGACAGTGATTGATGG - Intronic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1179215200 21:39361515-39361537 AGACAGAGCACAGAGACTTTTGG + Intergenic
1179388379 21:40964134-40964156 AGAAACATTAAAGTGACTTTGGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181331619 22:22097158-22097180 AAAAAGATCGCATTGTCTGTGGG - Intergenic
1181685888 22:24527827-24527849 AAAAAGCTCACTGTGTCTGTAGG - Intronic
1182101044 22:27657592-27657614 CGAATGCTCACAGTGACTGTAGG - Intergenic
1183051725 22:35267831-35267853 AGAAAGATAACATGGACTGGTGG - Intronic
1183247989 22:36708753-36708775 AGGATGAACACAGGGACTGTGGG - Intergenic
1183523467 22:38310089-38310111 AGAAAAAACACAGGGACTTTGGG - Intronic
1184639665 22:45863671-45863693 AGAAAGATCACTTTGGCTGCCGG - Intergenic
949274873 3:2267805-2267827 AGAAAGTTCCCTGTGACTCTTGG - Intronic
949575336 3:5333221-5333243 AGAAAGATCACTGTGGCTGCTGG + Intergenic
949626606 3:5874313-5874335 AGAAACATTTCAGTGGCTGTGGG - Intergenic
950815003 3:15691688-15691710 TCAAAGATTAAAGTGACTGTAGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951271801 3:20634248-20634270 TCCAAGATCAAAGTGACTGTAGG - Intergenic
952665877 3:35903291-35903313 AAAAAAATAATAGTGACTGTGGG - Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953200148 3:40771182-40771204 AGTAAGATCTCAGTGCCAGTGGG + Intergenic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
955225972 3:57060661-57060683 AGAATTTTCTCAGTGACTGTGGG - Exonic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957107657 3:75911243-75911265 AGAAAAATCTCAGTGAATGCTGG + Intronic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957963022 3:87283622-87283644 TGAAAAATCCCAGTGACTGGGGG + Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959533998 3:107465185-107465207 AGAAGGATCTCAGTAACTGGTGG + Intergenic
960223058 3:115138759-115138781 AGTAAGATCTCAGTAAATGTTGG + Intronic
960271333 3:115677565-115677587 AGAAAGATCATGGAAACTGTTGG - Intronic
960689911 3:120334920-120334942 AGGAAGATCATAGGGAGTGTAGG + Exonic
961023242 3:123528237-123528259 ATAAAGCTCACATTCACTGTAGG - Intronic
962411239 3:135143369-135143391 AGGATGGTCACAGTGACTGCAGG + Intronic
962493633 3:135918155-135918177 AGAAGGATCAGACTGACTGCTGG - Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964022557 3:152031448-152031470 AGAAAGATCACAGGCAATGCTGG - Intergenic
964052482 3:152412765-152412787 AGGAAGACCACAGTTAGTGTTGG + Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
966876374 3:184324225-184324247 CGGAAGTTCACAGTCACTGTTGG - Exonic
967322660 3:188209953-188209975 AGAACAACCAGAGTGACTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968017908 3:195356193-195356215 GGAAAGAGCACAGCAACTGTGGG + Intronic
968124990 3:196152342-196152364 AGACAGACCTCAGTGACTTTGGG + Intergenic
969544331 4:7814771-7814793 AGAAAGAGCACAGGGGCTGGGGG + Intronic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
970934596 4:21554259-21554281 AGAAAAATCAGAGTGGCTGGTGG + Intronic
971297385 4:25408985-25409007 AAAAAGAATACAGTGACTGCTGG + Intronic
971750426 4:30640063-30640085 AGAAAGTGCCCATTGACTGTAGG - Intergenic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972686735 4:41360103-41360125 AGTAGGTGCACAGTGACTGTTGG + Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
974019995 4:56684673-56684695 AGAAAAATAACACTTACTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974556944 4:63463644-63463666 AGAAATATTAAAGTGATTGTTGG + Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976104422 4:81601552-81601574 AGAAGGATCACAGTGTCCCTGGG - Intronic
976610474 4:87025517-87025539 AGAAGTAACACAGTGACTTTGGG + Intronic
977381120 4:96274851-96274873 AGAGAGACCACAGCAACTGTGGG - Intergenic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979673369 4:123384645-123384667 AGAAAGATCACCTTGGCAGTAGG - Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981816528 4:148837224-148837246 AGAAAGAACACACTGAAGGTGGG - Intergenic
982159828 4:152556901-152556923 GGAAAAATCTCAGTGACTGGGGG - Intergenic
982170779 4:152659795-152659817 AGAAAAAACACAGTGTATGTGGG - Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
986809682 5:11343017-11343039 AAAATGATCTCAGTGACTGCTGG + Intronic
986953566 5:13121990-13122012 AAAAAGAGCACAGTGTCTGAGGG - Intergenic
988930201 5:36029672-36029694 AGGATGAACACAGTGACTGAAGG + Intergenic
989286415 5:39705142-39705164 ATAAAGCTCACAGTGGCTGAAGG + Intergenic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
991514264 5:67416439-67416461 AAAAAGACCACAGTGACTATAGG + Intergenic
992821681 5:80504148-80504170 AGAAAGATCACAGGAAGTGCAGG - Intronic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994021002 5:95025951-95025973 AGAAGGGTCCCAGTGACTTTAGG + Intronic
995136004 5:108680493-108680515 AGTAAGATCAGATTGACTGGGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
998012503 5:138706667-138706689 AAAAACATCACAGTGAGTGAAGG + Intronic
999567447 5:152880769-152880791 AGAAAGATCATAGTGACTTCAGG - Intergenic
1001202843 5:169735106-169735128 GGAAAGATCACTCTGACTGTAGG - Intronic
1004065753 6:12242209-12242231 TGTAAAATCACACTGACTGTTGG - Intergenic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008481293 6:51988514-51988536 AGAAATAAAACAGTGGCTGTTGG - Intronic
1009371053 6:62904564-62904586 AGAAAGAACAAAGTGACTAGAGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010094262 6:72021578-72021600 AGAAAGAACACAGTGTCAGTTGG + Intronic
1010731085 6:79392054-79392076 TGAAAGATGACAGAGACTGTGGG - Intergenic
1012329211 6:97963428-97963450 AGAAAGATAACATTGAATGCTGG - Intergenic
1013341545 6:109220608-109220630 AGAAAGTAAACAGTGACAGTAGG + Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016862590 6:148735785-148735807 AGAAAGATGACAGACACTTTAGG - Intergenic
1021585985 7:22208951-22208973 ATAATGATCAGAGTGGCTGTAGG - Intronic
1022189753 7:28005984-28006006 ATAAAGATGACAGTGACTCATGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023085260 7:36564029-36564051 AGGCAGATCACAGCTACTGTGGG - Intronic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024945193 7:54800916-54800938 AGAAATGGCACAGTGAGTGTGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025977600 7:66381245-66381267 AGAAAGATTACAGTGAGTCATGG - Intronic
1026226047 7:68442052-68442074 ATAAACATTACAGTGATTGTAGG - Intergenic
1026298270 7:69075115-69075137 GGAAAGAACATAGTGACTCTGGG - Intergenic
1026771755 7:73206299-73206321 TTAAAGAGCAGAGTGACTGTGGG + Intergenic
1027012623 7:74759695-74759717 TTAAAGAGCAGAGTGACTGTGGG + Intronic
1027075417 7:75186358-75186380 TTAAAGAGCAGAGTGACTGTGGG - Intergenic
1027708261 7:81563409-81563431 AGAAATATCACTGTGACAGTAGG + Intergenic
1028641593 7:93047821-93047843 AGAAAGATCACAGTGGGGCTAGG + Intergenic
1031009409 7:116509910-116509932 AGAAAGATGGCAGTGATTATGGG - Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033229229 7:139583696-139583718 AGAAAGTGCCCAGTGACTGCAGG - Intronic
1033270746 7:139930762-139930784 AGAAAGATCCCACTGACTACAGG + Intronic
1033973381 7:147070328-147070350 AGAAAAAGCACATTGCCTGTCGG + Intronic
1034066898 7:148145716-148145738 AGAAAGATCACACAGCCTGTGGG + Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034257296 7:149731645-149731667 AGAAAGAGCACAGAGACCTTGGG - Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035990426 8:4483994-4484016 AGAAACATCCCATTGCCTGTTGG + Intronic
1036201927 8:6777198-6777220 GTATAGATCACAGTAACTGTAGG - Intergenic
1037892088 8:22628851-22628873 AGAAAGAGCTCCGTGGCTGTGGG - Intronic
1038559046 8:28553679-28553701 TGGAAGATCACAATGACTGTTGG - Intronic
1039188920 8:34949891-34949913 AAAAAGATCACCGTGACCTTTGG + Intergenic
1040675003 8:49738333-49738355 AGAAAGAAAACAGTGAAGGTAGG + Intergenic
1041052100 8:53944948-53944970 AAAAAGACAACAGTAACTGTTGG + Intronic
1042961023 8:74303809-74303831 AGAAAGATCACTCTGGCTGCAGG - Intronic
1044002986 8:86907782-86907804 AGATATATCACACTGAATGTGGG - Intronic
1045364075 8:101459521-101459543 AGAAAAATTAGTGTGACTGTTGG + Intergenic
1046272314 8:111913029-111913051 ATTAAGATCACAGTGACAGGAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047338291 8:123956464-123956486 AAGAGGATCACAGTTACTGTGGG + Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049037502 8:140087774-140087796 AGAATGGTCACTGTGACTGCTGG - Intronic
1049353511 8:142176720-142176742 TGGAAGACCACAGGGACTGTGGG - Intergenic
1049900685 9:160907-160929 AGAAAAATTCCAATGACTGTTGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051423461 9:16911812-16911834 TGAAAGATCACAGTGACCTAAGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053743724 9:41171190-41171212 AGAAAAATTCCAATGACTGTTGG - Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054349000 9:64001007-64001029 AGAAAAATTCCAATGACTGTTGG - Intergenic
1054483547 9:65694116-65694138 AGAAAAATTCCAATGACTGTTGG + Intronic
1054684619 9:68260068-68260090 AGAAAAATTCCAATGACTGTTGG + Intronic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056848652 9:90062124-90062146 AGAAAGATGACAGTGAGTGCAGG - Intergenic
1058057459 9:100463438-100463460 AGAAAGCTAAAGGTGACTGTGGG - Intronic
1058549771 9:106102165-106102187 ATAAAAATCACAGTGTCTGTAGG - Intergenic
1058818139 9:108704412-108704434 GGCAAGATCACAGTGACCCTGGG + Intergenic
1059219264 9:112597375-112597397 AGAAAGATTAGAGTTACTGGAGG + Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059969808 9:119654223-119654245 AGTAAGATAACAATGACAGTTGG + Intergenic
1060024980 9:120163176-120163198 AGAAAGTTCAAAGTAAATGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1060564176 9:124575043-124575065 AGGAACATCACAGTGACTCAAGG - Intronic
1060658219 9:125387531-125387553 ATAAAGGGCACAGGGACTGTGGG - Intergenic
1203769878 EBV:44275-44297 AGAGAGTGCACAGTGACAGTGGG + Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188609004 X:32072475-32072497 AGAAAGAACACAATGACTGTGGG - Intronic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1191033811 X:56004587-56004609 AGCCAGCTCACAGTGACTGTAGG + Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192134944 X:68588515-68588537 AGGAAGAACACAGTGACTAGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194934484 X:99931769-99931791 AGAAAGATCAGAGTGCCTGGAGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1197051919 X:122069780-122069802 AGAAATATCACTGTCTCTGTAGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1198722071 X:139633731-139633753 AGAAAGATCACTTTGGCTTTGGG + Intronic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1199008224 X:142728068-142728090 AGAAATATCCCAGTGCCAGTTGG - Intergenic
1199411086 X:147523881-147523903 AAAATTATCAGAGTGACTGTGGG + Intergenic
1199639700 X:149848167-149848189 AGAGGGATCACAGTCTCTGTGGG + Intergenic
1199815537 X:151393871-151393893 AGTAAGCTCACAGTAAATGTTGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic