ID: 920958736

View in Genome Browser
Species Human (GRCh38)
Location 1:210645129-210645151
Sequence GAGGTTACACAACTTGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1551
Summary {0: 1, 1: 4, 2: 38, 3: 261, 4: 1247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920958736 Original CRISPR GAGGTTACACAACTTGTTCA AGG Intronic
900009460 1:92611-92633 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900025570 1:269187-269209 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900035333 1:402960-402982 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900056954 1:638713-638735 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900350613 1:2232759-2232781 GAGGTTAAGCAACTCGTCCAAGG - Intronic
901176468 1:7302988-7303010 GAGATTACAGAATTTGTTCAGGG - Intronic
901582138 1:10253252-10253274 GAGGTTAAATAAGTTATTCATGG - Intronic
901707000 1:11081552-11081574 GAGGTTAAGGAACTTGTCCAAGG - Intronic
901759381 1:11460768-11460790 GTGGTTAAGCAACTTGTTCAAGG + Intergenic
901882317 1:12201495-12201517 GAGGTTAAGTAACTTGTCCAAGG + Intronic
901882562 1:12202790-12202812 GAGGTTAAACAGCTTCTTCAAGG + Intronic
902187837 1:14738819-14738841 GAGGTTAAGCAACTTGCTGAAGG + Intronic
902203361 1:14850498-14850520 GAGGTTAAGCAACTTGCCCACGG + Intronic
902296750 1:15472815-15472837 GAGGTTGCACGACTCGTGCAGGG + Intronic
902449191 1:16485795-16485817 GAGGAGCCACAACTTGTTTAAGG - Intergenic
902468583 1:16632501-16632523 GAGGAGCCACAACTTGTTTAAGG - Intergenic
902538726 1:17137169-17137191 GAGGTTAGGTAACTTGTGCAAGG - Intergenic
902556802 1:17251611-17251633 GAGGTTAAACAACTTGTCCAAGG + Intronic
902649648 1:17828352-17828374 GAGGTTAAATAACTTGCCCAAGG - Intergenic
902668479 1:17955530-17955552 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
902741446 1:18441337-18441359 GAGGTTAAACAACTGGCCCAGGG - Intergenic
902786161 1:18734002-18734024 GAGGTTACACAGCTGGTAAACGG + Intronic
902835203 1:19042958-19042980 GAGGTTAAATAACTTGCCCAAGG + Intergenic
902844311 1:19097629-19097651 AAGGTTACACAGCTTGTTCAAGG + Intronic
902936173 1:19766460-19766482 GAGGTTAAGCGACTTGATCAAGG + Intronic
903186119 1:21630118-21630140 GAGGTTAAGTAACTTGTCCAAGG + Intronic
903188735 1:21644410-21644432 GAGGTTAAGTAACCTGTTCAAGG - Intronic
903313315 1:22478207-22478229 GAGGTTACATAACTCACTCAGGG - Intronic
903374230 1:22855824-22855846 GAGGTTAGGTAACTTGCTCATGG + Intronic
903411122 1:23143852-23143874 GAGGTTATGCAATTTGCTCAGGG + Intronic
903605121 1:24569903-24569925 GAGGTTAAGTAACTTGTCCAAGG - Intronic
903729493 1:25481406-25481428 AAGATTACACACCTTGTGCAGGG + Intronic
903814550 1:26055231-26055253 GAGGGTAAGCCACTTGTTCAAGG - Intronic
903865754 1:26396508-26396530 GAGATTAAACAATTTGCTCATGG - Intergenic
903893631 1:26587475-26587497 GAGGTTAAATAACTTACTCAAGG + Intergenic
903992128 1:27280056-27280078 GAGGTTAAAGAACTTGCTCAAGG + Intronic
904052385 1:27647505-27647527 GAGTTTATGCAGCTTGTTCAAGG - Intergenic
904282250 1:29428852-29428874 AAGGTCACACAACTGGTGCATGG - Intergenic
904370672 1:30045705-30045727 GAGGTCACATGACTTGCTCAAGG + Intergenic
904497912 1:30897753-30897775 GAGGTTAAATAATTTGTGCAAGG - Intronic
904609959 1:31720453-31720475 GAGGTTACTTAACTTGTCCAAGG + Intergenic
904785686 1:32980931-32980953 GAGGTTACATTACTTGCCCAGGG + Intergenic
904789507 1:33008267-33008289 GAGGTGAGATAACTTGTCCAAGG + Intronic
904868370 1:33600750-33600772 GAGGTTATACAACTCACTCAAGG + Intronic
904900105 1:33850367-33850389 GAGGTAAAGAAACTTGTTCATGG + Intronic
904917359 1:33979844-33979866 GAGGTTAAAGAACTTGCCCAAGG - Intronic
904960126 1:34326148-34326170 GAGGTTAAGTAACTTATTCAAGG + Intergenic
905008868 1:34733241-34733263 GAGGATAAACAACTTGTTCAAGG - Intronic
905023568 1:34834853-34834875 GAGTTCAAACAACTTGCTCAAGG + Intronic
905233250 1:36528821-36528843 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
905234612 1:36537369-36537391 GAAGTTAAGCAACTTGCTCAAGG + Intergenic
905234913 1:36539545-36539567 GAAGTTAAGCAACTTGCTCAAGG + Intergenic
905312749 1:37061647-37061669 GAGGTTAAGTTACTTGTTCATGG - Intergenic
905314720 1:37074888-37074910 GAGGTTAAGCGACTTGTCCAGGG - Intergenic
905395952 1:37666681-37666703 GAGGTCACACAGCTGGTACATGG + Intergenic
905471507 1:38195688-38195710 GAAGCTAAACAACTTATTCAGGG - Intergenic
905486366 1:38299779-38299801 GGGTTTAAACAACTTGCTCAAGG + Intergenic
905514091 1:38548802-38548824 GAGGTTAAATAGCTTGCTCAAGG - Intergenic
905542751 1:38773293-38773315 GAAGTTTAGCAACTTGTTCAAGG - Intergenic
905644287 1:39614106-39614128 GGGCTCACACAACCTGTTCAGGG + Intergenic
905709605 1:40090015-40090037 GAGGTTAAATACCTTGTCCAAGG + Intronic
905813885 1:40932811-40932833 GAGGTCAAGTAACTTGTTCAGGG - Intergenic
905835916 1:41120773-41120795 GAGGCTAAGAAACTTGTTCATGG + Intronic
905948487 1:41924572-41924594 GAGGTTATATAACTTGCCCAAGG - Intronic
906364202 1:45191671-45191693 GAGGTTAAGTAACTTGTCCAAGG + Intronic
906414461 1:45609775-45609797 AAGGTTACATGACTTGTTTAGGG + Intronic
906417821 1:45635207-45635229 GAAGTTCCACAATTTGTTCAAGG + Intronic
906460405 1:46031842-46031864 GAAGTTAAGCAACTTGCTCAAGG - Intronic
906613932 1:47222343-47222365 GAGGTTACCCAGCTTGATCAAGG - Intronic
906705394 1:47891064-47891086 GAGATTAAGCAACTTGTCCAAGG - Intronic
906707624 1:47906356-47906378 GAGGTTAAAGAACTTGCTAAAGG + Intronic
906730250 1:48074711-48074733 GAGGTTAAACAACTTGTCCATGG - Intergenic
906791669 1:48663863-48663885 GAGGTTATATAACTTGTTCAAGG + Intronic
906944323 1:50282924-50282946 AAGGTTAAATAACTTGTCCAAGG + Intergenic
906945902 1:50293948-50293970 GAGGTTACATAACTTCCCCAAGG - Intergenic
906946827 1:50301532-50301554 GAGGTCACACACCTTGTTAGTGG - Intergenic
907188450 1:52629859-52629881 GAGGTTAAGTAACTTGCTCAGGG - Intergenic
907235118 1:53039308-53039330 AAAGTTAAATAACTTGTTCAAGG - Intronic
907314767 1:53561183-53561205 GAGGCTACACCACTTGTGTAAGG + Intronic
907555185 1:55337233-55337255 GAGGGGACACACCTTGTCCAAGG + Intergenic
907796366 1:57721932-57721954 GAAGATACATAACTTGTCCAAGG + Intronic
907806957 1:57830412-57830434 TAGGTTATAAAACTTGTCCAAGG + Intronic
907824027 1:57998240-57998262 GGTGTTAAATAACTTGTTCAAGG - Intronic
907841440 1:58161718-58161740 GAGGTTCACTAACTTGTTCAAGG + Intronic
907945439 1:59132040-59132062 GAGGTCACATAACTTGTCCAAGG + Intergenic
908285644 1:62596259-62596281 GAGGTTAAGTAACTTGTCCAAGG + Intronic
908324724 1:63012597-63012619 GAGGTTACATAACTTGTCCAAGG - Intergenic
908408643 1:63841211-63841233 GAGGTTAAGTAACTTGCTCAAGG + Intronic
908411930 1:63875124-63875146 GAGGTTAAACAACTTGCCTAGGG - Intronic
908415602 1:63910588-63910610 GAGGTTAGTTAACTGGTTCAGGG - Intronic
908465741 1:64392218-64392240 GAGGTTAAATAACCTGTCCAAGG + Intergenic
908591129 1:65635930-65635952 GAGGTTAGTGTACTTGTTCATGG + Intronic
908720844 1:67124092-67124114 GAGGTTAAACAATTTGCACAAGG - Intronic
908804567 1:67916786-67916808 GAGGTTAAACAACTTGCCCAAGG - Intergenic
908915851 1:69125600-69125622 GAGGTTGAATAACTTGTCCAAGG + Intergenic
908953809 1:69596262-69596284 GAGGTTAGATAACTTGATCAAGG + Intronic
909475012 1:76072869-76072891 GAGGTTAAGAAACTTGATCAAGG + Intergenic
909562122 1:77018658-77018680 GAGGTTAAATTACTTTTTCAAGG - Intronic
909667992 1:78157591-78157613 AAGGTTACACAACTTTTTAGGGG + Intergenic
909981898 1:82113076-82113098 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
910041254 1:82854155-82854177 GAGATTAAACAACTTGCTCAAGG + Intergenic
910175435 1:84425374-84425396 GAGGTTAAGTAATTTGTTCAAGG - Intergenic
910255746 1:85245614-85245636 GAGGTTATGTAATTTGTTCAAGG - Intergenic
910256763 1:85256406-85256428 TAGCTTACATAACTTGTCCAAGG - Intronic
910529878 1:88223741-88223763 GAGGTTTAATGACTTGTTCAAGG - Intergenic
910544861 1:88403673-88403695 GAGTTTATATAACTTATTCAAGG + Intergenic
910688608 1:89942911-89942933 GAAGTTACACAATCTGTCCAAGG + Intergenic
910937062 1:92493031-92493053 GAGGTTAAGGAACTTGTTTAAGG - Intergenic
911073585 1:93851449-93851471 GAGGTTAAGTAACTTGTGCAAGG + Intergenic
911173615 1:94796311-94796333 AAGGTTAGATAACTTGCTCAAGG + Intergenic
911329381 1:96509768-96509790 GAGATTAAATAACTTGTCCAAGG + Intergenic
911693422 1:100861199-100861221 GAGGTTAAATAATTTGTTCAAGG - Intergenic
911757286 1:101573512-101573534 GAGTTTCCACCACTTGTTCAAGG - Intergenic
912122865 1:106494250-106494272 GAGGTTAAACAAGTTGTTCGAGG - Intergenic
912134434 1:106642746-106642768 CAGGTTAAACAACTTGCCCAAGG - Intergenic
912146477 1:106799984-106800006 GAGGTTATGTAACTTGTTCAAGG + Intergenic
912383344 1:109259376-109259398 AAGGTTAAGTAACTTGTTCAAGG - Intronic
912505685 1:110154254-110154276 GAGGTTAAATAATTTGTTCAAGG + Intronic
912507748 1:110167831-110167853 TTGGTTAGATAACTTGTTCAAGG + Intronic
912569908 1:110613747-110613769 GAGCTTAAGCATCTTGTTCAGGG + Intronic
912665791 1:111578329-111578351 AAGGTTACACAGCTAGATCAAGG + Intronic
912680160 1:111724018-111724040 GAAGTTAAGCAACTTGTCCAAGG - Exonic
912954799 1:114147707-114147729 CAGGTTAAATAACTTGCTCAAGG - Intronic
913017230 1:114751465-114751487 GAGATTAAATAACTTGTTCATGG - Intronic
913050332 1:115112104-115112126 GAGGTTAAGCGACTTATTCAAGG + Intergenic
913251832 1:116918276-116918298 GAGGTTAGAAAACCTGTCCAAGG - Intronic
913271519 1:117098404-117098426 GAGGTTAAATAACTTGCCCAAGG + Intronic
913494624 1:119417114-119417136 GAGGTTAATCAACTTGTCGAAGG + Intronic
913497363 1:119440705-119440727 GAGGTTAATTAACTTGTTCAAGG + Intergenic
913508415 1:119540484-119540506 GAGGTTAATCAACTTGTCCAAGG + Intergenic
913678226 1:121162988-121163010 GAGGTTAAAGAACTTGTTCGTGG - Intergenic
913708018 1:121447772-121447794 GAGGTTAAATAATTTGTGCAAGG + Intergenic
914030066 1:143950628-143950650 GAGGTTAAAGAACTTGTTCGTGG - Intronic
914159383 1:145117323-145117345 GAGGTTAAAGAACTTGTTCGTGG + Intergenic
914457189 1:147847105-147847127 GAGATTAAACAGCTTGTTCCTGG - Intergenic
915042049 1:152976759-152976781 GAGGTTAAGGAACTTGTTCTAGG - Intergenic
915042386 1:152980120-152980142 AAGGTTAGGCAACTTGCTCAAGG + Intergenic
915098680 1:153483148-153483170 GAGGTGACATAATTTGTTTAAGG - Intergenic
915315868 1:155028906-155028928 GAGGTTAAGCAACTTGCTGAAGG + Intronic
915472936 1:156136616-156136638 GAGGTTAAATAACCTGCTCAAGG - Intronic
915894998 1:159805030-159805052 GAACTTAGACAACTTGTTCAAGG + Intronic
916431110 1:164729676-164729698 GAGGTTAGGCAACTTGCTGAAGG + Intronic
916446508 1:164877156-164877178 AAAGTCACACAACTGGTTCAAGG + Intronic
916490044 1:165294070-165294092 GAGCTTACACACCTTGTGCAAGG + Intronic
916490602 1:165299046-165299068 GAGGCTAAATAACTTGTCCAAGG + Intronic
916813834 1:168331224-168331246 GAGGTTAAGAAACTTGTTTAAGG + Intergenic
916857207 1:168762187-168762209 GAAGTTAAGCAACTTGTCCAAGG - Intergenic
916933340 1:169602478-169602500 GAGGTTAAATAACTCGTCCAGGG - Intronic
917121670 1:171649872-171649894 GAGGTTATTCAGCTTGTCCATGG - Intronic
917188669 1:172390328-172390350 GAGGTTAAACAGCTTGCCCAAGG + Intronic
917759306 1:178138533-178138555 GAGGTTATACAGCTCGTTCAAGG - Intronic
917952526 1:180055025-180055047 GAAGTTAAGTAACTTGTTCAAGG - Intronic
918449042 1:184641514-184641536 GAGGTTAGACAGCCTGATCAAGG - Intergenic
918553252 1:185768876-185768898 GAGGTTAAATATTTTGTTCAAGG - Intronic
918653162 1:186990953-186990975 GAAATTGCACAGCTTGTTCATGG - Intergenic
919059326 1:192610722-192610744 GAGATTGCACAATTTGCTCAAGG - Intergenic
919095812 1:193034537-193034559 AATTTTACACAAATTGTTCAAGG + Intronic
919131614 1:193458041-193458063 GAGGCTATACACCTGGTTCAGGG - Intergenic
919415815 1:197307872-197307894 GAGTTTAAGTAACTTGTTCAAGG - Intronic
919688704 1:200508838-200508860 GAGGTTAAGCAACGTGTTCAAGG - Intergenic
919878509 1:201887814-201887836 GAGGTTAAAGAACTTGTTCAAGG - Intergenic
919982247 1:202649543-202649565 GAGGTAAAATAACTTGTCCAAGG + Intronic
920289078 1:204904035-204904057 GATGTTAAATAACTTGTCCAAGG - Intronic
920339797 1:205268683-205268705 AAGGTCAAACAAGTTGTTCAGGG - Intronic
920390425 1:205596929-205596951 GAGGTTAGAGAACTTGTCTAAGG + Intronic
920465533 1:206181512-206181534 GAGGTTAAAGAACTTGTTCGTGG - Intergenic
920573225 1:207033889-207033911 GAGGTTAAAAATCTTTTTCAAGG + Intronic
920582745 1:207127502-207127524 GAGGTTAAAAGACTTGCTCAAGG + Intronic
920702701 1:208229987-208230009 AAGGTTAAATAACATGTTCAAGG - Intronic
920765217 1:208825997-208826019 GAAGTTACATGACTTGTTTAAGG - Intergenic
920870239 1:209788103-209788125 GAGGTTAAAGGACTTGTTCAAGG + Exonic
920958736 1:210645129-210645151 GAGGTTACACAACTTGTTCAAGG + Intronic
921027248 1:211297367-211297389 GAGGTTAACCAACTTGTTCAAGG + Intronic
921189639 1:212698886-212698908 GAGGTTAAACAAATTGCTCAAGG + Intronic
921413316 1:214860040-214860062 GAGCTCACACAACCTGTTCTGGG + Intergenic
921448256 1:215271701-215271723 TAAGTCACACAACTTGTCCAAGG - Intergenic
921548137 1:216498496-216498518 GAAGTTAAATAACTTGCTCAAGG - Intergenic
921587279 1:216963007-216963029 GAAATTATAGAACTTGTTCAGGG - Intronic
921879838 1:220243491-220243513 GAGATTACATAACTCGCTCAAGG + Intronic
921949038 1:220909876-220909898 GAAGTGACACAATTTGATCATGG - Intergenic
922246583 1:223804768-223804790 GAGGTTATGCAATTTGTTCAGGG - Intronic
922257865 1:223908520-223908542 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
922984168 1:229852960-229852982 GAGGGTAAAAGACTTGTTCAAGG + Intergenic
923216122 1:231849457-231849479 GAGGTTAGACAACATGCCCAAGG + Intronic
923373320 1:233334378-233334400 GAAGTTATATAACTTGCTCAAGG - Intronic
923538818 1:234873565-234873587 GAGGTTAAACGACTTGTCCAAGG - Intergenic
923554363 1:234989276-234989298 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
923703482 1:236322568-236322590 GGGCTTACACAACCTGTTCCAGG + Intergenic
923784442 1:237054071-237054093 GAGGTGAAATGACTTGTTCAAGG + Intronic
923928460 1:238663663-238663685 GAAGTTAAAGAATTTGTTCAAGG - Intergenic
924161308 1:241235227-241235249 GAGGTGACACAACTAATTCCAGG + Intronic
924339062 1:243011299-243011321 GAGGTTAGGTCACTTGTTCAAGG - Intergenic
924439826 1:244076949-244076971 AAGGTCACACAGCTTGTTAATGG + Intergenic
924686489 1:246296595-246296617 GAGATTACACACAATGTTCAAGG - Intronic
924697210 1:246413004-246413026 GAGGTTAAACAGTTTGCTCAAGG + Intronic
924796492 1:247296344-247296366 GAGGTTAGAAAACTTGCTTAGGG - Intergenic
924944010 1:248832908-248832930 GAGATTAAATAACTTGTCCAAGG + Intergenic
1063235311 10:4108619-4108641 GAGTTTAAGCAATTTGTTCAAGG - Intergenic
1063724965 10:8626814-8626836 GAGGTTAAATAACTTTTTCAAGG - Intergenic
1063991384 10:11567887-11567909 GAAGTTCCATAACTTGCTCAAGG + Intronic
1064327128 10:14361924-14361946 GAAGTTAAACAACATGTCCAGGG + Intronic
1065139568 10:22707274-22707296 GAGGCAAAATAACTTGTTCAAGG + Intronic
1065249610 10:23797377-23797399 GAGAATAAACAACTTGCTCAAGG + Intronic
1065353819 10:24819856-24819878 GAGGTTAAACCACTTGTCCATGG + Intergenic
1065432854 10:25676865-25676887 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1065482598 10:26210797-26210819 GAGTGTACACATCGTGTTCAAGG - Intronic
1065627477 10:27646764-27646786 GAGGTTATGCAACTTGCCCAGGG + Intergenic
1065798514 10:29329515-29329537 GAGGAGACACAACGTCTTCAGGG - Intergenic
1065961610 10:30738442-30738464 GAGGTTAGAAAACCTGCTCAAGG - Intergenic
1065984370 10:30935193-30935215 GGTGTTAAATAACTTGTTCAAGG + Intronic
1066084730 10:31964984-31965006 GAGGTTGCATAACTTGCTCAAGG - Intergenic
1066545603 10:36497066-36497088 GAGGTTACAAAATATGTTTAAGG - Intergenic
1067009424 10:42695974-42695996 GAGGTCACAAAATGTGTTCAGGG - Intergenic
1067243921 10:44520006-44520028 GAGATTAGGCAACTTGTCCAAGG - Intergenic
1067314294 10:45147277-45147299 GAGGTCACAAAATGTGTTCAGGG + Intergenic
1067320868 10:45219618-45219640 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
1067546511 10:47196138-47196160 GAGGTTAAGCAACTTGCTCAAGG + Intergenic
1067919298 10:50436960-50436982 GAAATTACACAACATGCTCAAGG - Intronic
1067965278 10:50905618-50905640 GAGGTCACACAATTAGTTGAGGG - Intergenic
1067991531 10:51218957-51218979 GAGGTTAAATAACTTGCCCAAGG - Intronic
1068594731 10:58890501-58890523 GAGGTTCCATAACTTGCTCAAGG + Intergenic
1068626567 10:59255290-59255312 GAGGTTACACATTTTTTTCAGGG - Intronic
1068731838 10:60366712-60366734 GAAGTTATACTACTTGCTCAAGG - Intronic
1068874414 10:61981070-61981092 GAGATTAAGCAACCTGTTCAAGG - Intronic
1068934927 10:62626270-62626292 CAGGTTACAGAACTGGCTCAGGG - Intronic
1069127246 10:64651561-64651583 GAGGTTACAAAACTTGTCCAAGG - Intergenic
1069580420 10:69562392-69562414 GAGGTTCAGCAACATGTTCAAGG - Intergenic
1069628994 10:69886343-69886365 GAGGTTAGACAACTTGCTGAGGG + Intronic
1069814521 10:71185243-71185265 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1069830161 10:71278074-71278096 GAGGTTAAGCAACTTGTCCAAGG - Intronic
1069839505 10:71330355-71330377 GAGGTTACCCAGCTGGGTCAGGG - Intronic
1069854980 10:71435173-71435195 GAGGCTAAACAACTTGCTCAAGG - Intronic
1069885308 10:71619887-71619909 GAGGTCACACAGCTAGTACATGG - Intronic
1069899457 10:71698914-71698936 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1069914426 10:71778610-71778632 GAGGTTAAGCAACTTGCTCAGGG - Intronic
1069933682 10:71900620-71900642 GTGGTGACATGACTTGTTCAAGG - Intergenic
1069944294 10:71975290-71975312 GAGGTTAGGCAACTTGTCCAAGG + Intronic
1069995223 10:72337648-72337670 AAGGTTATATAACTTGTTTAGGG + Intronic
1070175471 10:73965902-73965924 GAGGTTTCTCACCTGGTTCAGGG + Intergenic
1070276681 10:75013821-75013843 GAGGTCACACAGCTGGTACATGG + Intronic
1070530826 10:77335789-77335811 GAGGTTAAGCAACTTTTCCAGGG + Intronic
1070718910 10:78743092-78743114 GAGGTTAAATAACTTGTCCAAGG + Intergenic
1070764304 10:79047757-79047779 GAGGCTAAGTAACTTGTTCAAGG + Intergenic
1070790657 10:79187405-79187427 GAGGTTACACAACTCGCCCAAGG - Intronic
1070909966 10:80109400-80109422 GAGGTGAAATAATTTGTTCAAGG - Intergenic
1071167927 10:82828431-82828453 GAGGTTAAACGACTTGTCCCAGG + Intronic
1071462640 10:85913351-85913373 GAGGTTAAATCACTTGTTCAAGG - Intronic
1071483118 10:86079643-86079665 GAGGTTGCATGACTTGGTCAAGG - Intronic
1071574836 10:86717492-86717514 GAGTTTGAACAACTTGTTTAAGG - Intronic
1071700301 10:87924901-87924923 GAGATTACATAACTCGTCCAAGG - Intronic
1071711370 10:88053159-88053181 GAGATTAAACAACTTTTGCAGGG - Intergenic
1071711594 10:88055142-88055164 GAGGTTAAGCAATTTGTTCAAGG + Intergenic
1071777318 10:88803810-88803832 GAGGTTAAACAAGTTGAACAAGG + Intronic
1071958977 10:90789828-90789850 GAGATTACATAATATGTTCAAGG - Intronic
1071970754 10:90904390-90904412 GAGGTTACATAATTTGCCCAAGG - Intronic
1072205672 10:93203347-93203369 GAGGTTATGCAACTTCTCCAAGG - Intergenic
1072717897 10:97763528-97763550 GAGGTCACACAGCTTGCACATGG - Intergenic
1072720684 10:97779064-97779086 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1072745823 10:97938497-97938519 AAGGTTACACAACTTGTTAGTGG + Intronic
1072767011 10:98103347-98103369 GAGGTTAAAAGACTTGTTCAAGG - Intergenic
1072925901 10:99616791-99616813 GAAGTTATATAACTTGTCCAAGG - Intronic
1073028233 10:100504140-100504162 GAGGTTAAATGAATTGTTCAAGG + Intronic
1073066854 10:100766079-100766101 GAAGTTAAATAACTTGCTCAAGG + Intronic
1073246033 10:102090854-102090876 GAGGTTAAATAACTTGCTCAGGG + Intergenic
1073341947 10:102751782-102751804 GAGGTTATGTAACTTGCTCAAGG - Intronic
1073560489 10:104492265-104492287 GAAGTTAAATAACTTGTTCAAGG + Intergenic
1073811442 10:107156327-107156349 AAGCTTAAACAACTTGCTCAAGG - Intronic
1074273891 10:111982674-111982696 GAGGTCACACAACTAGTTAGTGG - Intergenic
1074280628 10:112048347-112048369 GAGGTTACACAACTGATTAGAGG + Intergenic
1074290464 10:112134447-112134469 AAGGTTACAAAACTGCTTCAAGG - Intergenic
1074695512 10:116046677-116046699 GAGATTACATAACTTGCCCAAGG - Intergenic
1074840909 10:117350163-117350185 GAGGTTAAGTAACTTGCTCAGGG + Intronic
1074876204 10:117615334-117615356 GAAGTTAAACAACTTGCCCAGGG - Intergenic
1074959237 10:118424495-118424517 GAGGTTATTTAACTTGTGCAAGG - Intergenic
1075213207 10:120509284-120509306 GAGGTTACATGATTTGCTCAAGG + Intronic
1075275926 10:121092384-121092406 GAGGTTATATAACTTGCTCAAGG + Intergenic
1075387125 10:122062959-122062981 GAGGTTAAGGAACTTGTTCTAGG + Intronic
1075416244 10:122266679-122266701 GAGGTTCCACAGCAAGTTCATGG + Intergenic
1075893218 10:125972050-125972072 GAAGTTACATAACTTGCCCAAGG - Intronic
1076108254 10:127841721-127841743 GAGGTTACATAACTTGCACAGGG - Intergenic
1077497493 11:2893208-2893230 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1077633848 11:3828474-3828496 GAGGTTAAGCAATTTTTTCAGGG - Intronic
1077975964 11:7249494-7249516 GTGGTTAAACAATTTGTTCAAGG - Intronic
1078409099 11:11096867-11096889 GTGGTTAAACAACTTGCCCAAGG - Intergenic
1078440478 11:11361324-11361346 GAGGTGATATAACTTGCTCAAGG - Intronic
1078594042 11:12671665-12671687 GAGGCTATATAACTTGTCCATGG - Intergenic
1078671263 11:13367790-13367812 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1078759447 11:14240390-14240412 GTGGTTACACAACATCTGCAGGG - Intronic
1078952907 11:16155313-16155335 GAGGTTAAATAATTTGTCCAAGG - Intronic
1078952923 11:16155518-16155540 GAGGTTAAACAACTTGCCCAAGG - Intronic
1079094162 11:17500348-17500370 GAGGTTAAAGTATTTGTTCAAGG - Intronic
1079257635 11:18846307-18846329 GAGGTTAAGAAACTTGTCCAAGG + Intergenic
1079327260 11:19504943-19504965 GAGGTTAAATGACTTGTCCATGG + Intronic
1079338833 11:19595496-19595518 GGGGTTTTACAACTTGATCAAGG + Intronic
1079391264 11:20023980-20024002 GAGGTTAAATAACTTGATTAAGG + Intronic
1079497432 11:21061519-21061541 GAGGTTAAATACCTTGTCCAAGG - Intronic
1079525979 11:21388296-21388318 GAAGTTATATAACTTGATCAAGG - Intronic
1079780126 11:24591668-24591690 TAGGTTACATGACTTGCTCAAGG - Intronic
1080042886 11:27777490-27777512 AAGGTCACACACCTAGTTCATGG + Intergenic
1080103728 11:28489714-28489736 GAGGTGAAATAACATGTTCAAGG - Intergenic
1080142240 11:28936271-28936293 GAGCTTACACATCTTGTACAAGG + Intergenic
1080148501 11:29019952-29019974 GAAGTTAAGTAACTTGTTCAAGG + Intergenic
1080217523 11:29862189-29862211 GAGGTCAAATAACTTGCTCAAGG + Intergenic
1080495872 11:32818336-32818358 GATGTTAAACAACTTGCTCAAGG - Intergenic
1080544846 11:33306603-33306625 AAGGTCAAACAACTTGCTCAGGG - Intronic
1080558177 11:33436675-33436697 ATGGTTTAACAACTTGTTCAAGG + Intergenic
1080607794 11:33878037-33878059 GAGGTTAAGCAACTTGTGGATGG - Intronic
1080686135 11:34516439-34516461 GAGGTTAAGTAACTTGTTCACGG + Intergenic
1080823475 11:35828521-35828543 GAGGTTAAAATACTTGTTAAAGG - Intergenic
1080892402 11:36420422-36420444 GAGGTAAAGCAACTTGCTCAAGG - Intronic
1081333638 11:41835780-41835802 AAGGTTACCCAAATTGCTCAAGG - Intergenic
1081385097 11:42462705-42462727 AAGGTTATACAATTTGCTCAAGG + Intergenic
1081659803 11:44881101-44881123 GAGGTTAAGTTACTTGTTCAAGG - Intronic
1081670094 11:44937894-44937916 GAGGTTAGGCAACTTGCCCAAGG - Intronic
1081677087 11:44976613-44976635 GAGGTCACACAGCTTATACATGG + Intergenic
1081744141 11:45461301-45461323 GGGGTTAAATAACTTGCTCAAGG + Intergenic
1081847423 11:46251066-46251088 GAGGTAAAATCACTTGTTCAAGG + Intergenic
1082230339 11:49757725-49757747 GAGATTAAACAACTTACTCAAGG - Intergenic
1082732319 11:56815146-56815168 GATGTTACACATCTTGTACCAGG + Intergenic
1082801869 11:57420806-57420828 GAGGTTAAAAAGCTTGTTGAAGG - Intronic
1082873103 11:57961765-57961787 GAGGTTAAATAACTTGCTCAGGG - Intergenic
1083328165 11:61884162-61884184 GAGGTTAAGCTACTTCTTCAAGG + Intronic
1083627695 11:64079981-64080003 GAGGGAAAGCAACTTGTTCAAGG - Intronic
1083735865 11:64680561-64680583 AAGGTTAAAGAACTTGCTCAAGG - Intronic
1083775464 11:64892532-64892554 GAGGTTACGCTACTTGCTCAAGG - Intergenic
1083941465 11:65898534-65898556 GAGGTTAAATAACTTGCCCATGG - Intronic
1084077725 11:66794449-66794471 AAGGTTAAACAGCTTGTCCAAGG - Intronic
1084345303 11:68543178-68543200 GAGGTTAAGTAACTTGTCCAAGG + Intronic
1084438301 11:69156818-69156840 GAGGTTGCACAACTTGCCCGAGG + Intergenic
1084531581 11:69730844-69730866 GAGGTTAAGCCACTTGTCCAAGG + Intergenic
1084914521 11:72418449-72418471 GATGTTAGACAACTTTTCCAAGG + Intronic
1085076051 11:73593435-73593457 GAGGTTAAATGACTTGTTTAAGG - Intronic
1085084411 11:73657255-73657277 GAGGTTACCTAACTTGATCAGGG + Intronic
1085187303 11:74586825-74586847 GAGGTTAAATAACTTGCCCAAGG - Intronic
1085198333 11:74685520-74685542 GAGGTTAAGGAACTTTTTCAAGG - Intergenic
1085308732 11:75503443-75503465 GAGGCTAAGCAACTTGTTCAAGG + Intronic
1085340846 11:75730485-75730507 GAGGTTGCCTGACTTGTTCAAGG - Intronic
1085498253 11:76992813-76992835 GAGGTTAACTAACTTGTCCAGGG - Intronic
1085534085 11:77207794-77207816 GAGGTTAGGTAACTTGTCCAAGG + Intronic
1085587720 11:77726871-77726893 GAGGATATACAACTTGTCCAGGG - Intronic
1085740395 11:79073682-79073704 GAGGTTAAATAACTTGCCCAAGG - Intronic
1085803761 11:79615709-79615731 GAGGTTTAAGAACTTGCTCAGGG - Intergenic
1085943273 11:81232434-81232456 GATGTTAAACAACATGCTCAAGG + Intergenic
1086051618 11:82598612-82598634 GAGGTTATGTAACTTGTCCAAGG - Intergenic
1086087095 11:82966508-82966530 GAGGCAAAATAACTTGTTCAAGG + Intronic
1086094269 11:83034815-83034837 GAGGTTCCATAACTTGTCCAAGG + Intronic
1086176114 11:83893084-83893106 GAAGTAAAACAACTTGTTAATGG - Intronic
1086189163 11:84057833-84057855 GAGGTTAAGCAATTTGCTCAAGG + Intronic
1086299114 11:85405668-85405690 GAGGTTAAATATTTTGTTCAAGG + Intronic
1086325157 11:85691372-85691394 GAAGTTAGATAACTTGTCCAAGG + Intergenic
1086619712 11:88871237-88871259 GAGATTAAACAACTTACTCAAGG + Intronic
1088053109 11:105542650-105542672 GAAGTTAAACAGCCTGTTCATGG - Intergenic
1088506134 11:110529338-110529360 AAGGTTAAACAACCTGCTCAAGG - Intergenic
1088702005 11:112421830-112421852 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1088822449 11:113468196-113468218 GAGGTTAATTAACTTGCTCATGG + Intronic
1089529549 11:119117475-119117497 GAGGTTACATAACTTGCCCAAGG - Exonic
1090203469 11:124872122-124872144 CAGGTTAAACAGCTTGTTCAGGG + Intronic
1090255167 11:125278828-125278850 GAGGTCACATAACTTGTCCAAGG + Intronic
1090281470 11:125459713-125459735 GAGGTTACATGACTTGTCCAAGG - Intronic
1090298962 11:125617338-125617360 GAGGTTAAATAACTTGCCCAAGG + Intronic
1090411863 11:126514704-126514726 GTGGTTAAATAACTTGCTCACGG + Intronic
1090462845 11:126907263-126907285 TAGGTTCCACATCGTGTTCAGGG - Intronic
1090588022 11:128235201-128235223 GAGGTGAAATAACTTGTTCTAGG - Intergenic
1090642892 11:128744525-128744547 GAGATTAAAGAACTTGTCCAAGG + Intronic
1090833084 11:130433178-130433200 GAGGTTAGAGAACTTGCTTATGG + Intergenic
1090848390 11:130549043-130549065 GAAGTGAAACAACTTGTTCAAGG + Intergenic
1091068535 11:132541333-132541355 GAAGTCACACAACTTGCTCAAGG - Intronic
1091227356 11:133965516-133965538 GAGGTTACGCAACTTGCTTAAGG - Intergenic
1091433549 12:456180-456202 GATGTTAAATAACTTGCTCAAGG - Intergenic
1091612259 12:2021242-2021264 GAGCTTAAATAACTTGCTCAGGG + Intronic
1091639667 12:2226363-2226385 GAGGTTAAATAACTTGGCCAAGG + Intronic
1091747403 12:3001123-3001145 GAGGTTAAATAACTTGCCCAAGG - Intronic
1092103654 12:5905300-5905322 AAAGTTACATAACTTGATCAGGG - Intronic
1092199263 12:6569836-6569858 AAAGTTAAACAACTTGCTCAAGG + Intergenic
1092763721 12:11833377-11833399 GAGGTTAAGTAACTTGTACAAGG + Intronic
1092779055 12:11968509-11968531 AAGGTTAAGCACCTTGTTCAAGG + Intergenic
1092844327 12:12569981-12570003 GAGGTTAAACGACTTGCCCAAGG + Intergenic
1092861971 12:12725978-12726000 GATGTAACCCAACTCGTTCACGG + Exonic
1092972333 12:13708717-13708739 GAGGTTAATCAACTTATCCAAGG + Intronic
1093324000 12:17750330-17750352 GAGGTTAAATAACTTGTCAAAGG + Intergenic
1093411675 12:18875853-18875875 GAGGTTACAGTCCTTGTTCATGG - Intergenic
1093423979 12:19007121-19007143 GAGTTTAAATAACTTGTTCAAGG - Intergenic
1093630714 12:21405873-21405895 GAGGTTAATTAACTTGTCCAAGG - Intronic
1093799338 12:23353137-23353159 GAAGTTAATCAACTGGTTCAAGG - Intergenic
1094004184 12:25729891-25729913 GAGGTTAAATAACTTGTCCAAGG + Intergenic
1094179324 12:27574782-27574804 GGGGTTAAATAACTTGTCCAAGG - Intronic
1094489663 12:30951684-30951706 GAGGTTAAATAACTTGCCCAAGG + Intronic
1094689041 12:32750746-32750768 GAAGTAACAAAGCTTGTTCATGG - Exonic
1094749545 12:33389949-33389971 GAGGTTAAGTAGCTTGTTCAAGG - Intronic
1095454593 12:42369651-42369673 GAGATTAAATAACTTGGTCAAGG + Intronic
1095833236 12:46609827-46609849 AAGGTTAAATAACTTGTCCAAGG - Intergenic
1096073098 12:48786856-48786878 GAGGTTAAATAACTTGCCCAAGG - Intronic
1096420180 12:51450383-51450405 GAGATTAGATAAATTGTTCAAGG + Intronic
1096571238 12:52524510-52524532 GAGGTTAGGCAACTTGCTCAGGG - Intergenic
1096582612 12:52597875-52597897 GTGGTTGCTCAACTAGTTCATGG + Intronic
1096862148 12:54537316-54537338 GAGGTCACACAACTACTTAATGG - Intronic
1097287779 12:57890839-57890861 GAGATTAAATAACTTGTTCAAGG + Intergenic
1097329223 12:58315060-58315082 GAGGTTAAGCAACTTACTCAAGG + Intergenic
1097388358 12:58978450-58978472 GAGGTCAGAAAACTTGGTCAAGG - Intergenic
1097404277 12:59170249-59170271 GAGGTTAAGCAACTTGACCAAGG - Intergenic
1097695415 12:62770341-62770363 GAGGTTAGGCATTTTGTTCAAGG + Intronic
1097812981 12:64038082-64038104 GAGGTTATGTAACTTGTCCAAGG - Intronic
1097979209 12:65719835-65719857 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1098051070 12:66453779-66453801 GAGTTTACAGAAGTTGCTCAGGG + Intronic
1098131654 12:67357599-67357621 GAGGTTAAGCAATTTGCTCACGG - Intergenic
1098179522 12:67831363-67831385 GAGGTTAAATAACTTGTCCAAGG - Intergenic
1098357149 12:69622603-69622625 GAAGTTAAACTACTTGCTCAAGG - Intergenic
1098597211 12:72287994-72288016 GAGGTTAAGTAACTTGTCCAGGG + Intronic
1098602000 12:72343023-72343045 GAGGTTATATAACTTGCACAAGG + Intronic
1098602635 12:72350478-72350500 TAGGTTAAACAGCTTGTCCAAGG + Intronic
1098868974 12:75795220-75795242 GATGTTAAATAACTTGCTCAAGG - Intergenic
1098891700 12:76016144-76016166 AGGGTCACACAACTTGTTAACGG + Intergenic
1099154640 12:79158976-79158998 GAGGCAACACAGTTTGTTCAAGG + Intronic
1099615195 12:84925417-84925439 GAAGTGACACAACATTTTCAAGG + Intergenic
1099653841 12:85464118-85464140 TAGGTTTCACAAAGTGTTCAAGG - Intergenic
1100276450 12:93076129-93076151 GAGGCTACATAACTTTTCCAAGG + Intergenic
1100665798 12:96751753-96751775 GAAGTTAAATGACTTGTTCAAGG - Intronic
1100679659 12:96905809-96905831 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1100727516 12:97424577-97424599 GAGGTCACACAACTTGTAAGGGG - Intergenic
1100739181 12:97572184-97572206 GAGGTTAAATAACTTCTCCAAGG - Intergenic
1100860213 12:98797359-98797381 GAGGTTGAATAACTTGCTCAAGG - Intronic
1100891207 12:99128027-99128049 GAAGTTAAACAACTTGCCCAAGG - Intronic
1100987478 12:100217057-100217079 AAGGCTACATTACTTGTTCAAGG - Intronic
1101019172 12:100534697-100534719 GAGGTTAAACTACTTGTTCAAGG + Intronic
1101289722 12:103355609-103355631 GAGGTTAAACAGTTTGTACAAGG + Intronic
1101385126 12:104250533-104250555 GAGGTTATGCAACTTCCTCAGGG - Intronic
1101593360 12:106141452-106141474 GAGGTTACACAGTTTGTAAATGG + Intergenic
1101769092 12:107732004-107732026 GAGCTTACATAACTTGGCCAAGG + Intergenic
1101811407 12:108111218-108111240 GATGTTAAATAACTTGTCCAAGG - Intergenic
1101819395 12:108172188-108172210 GAGGTTAGGTAACTTGTTCAAGG + Intronic
1101822273 12:108193080-108193102 GAGATTAGGTAACTTGTTCAGGG - Intronic
1101844377 12:108350696-108350718 GAGGTTTCATAACTTGCCCAAGG - Intergenic
1101930270 12:109008084-109008106 GAGGTTACACCAATGGTTCCAGG + Intronic
1101944440 12:109125751-109125773 GAGGTGAGGAAACTTGTTCAAGG + Intronic
1101993628 12:109508303-109508325 GAGGTTAAGAAACTTGCTCAGGG - Intronic
1102441273 12:112965633-112965655 GAGGTTAGATGACTTGTCCAAGG + Intronic
1102624750 12:114226069-114226091 AAGGTTAAGTAACTTGTTCAAGG - Intergenic
1102769827 12:115465881-115465903 GAGGTCATGTAACTTGTTCAAGG - Intergenic
1102776068 12:115520133-115520155 GAGGTTAATCAACTTGTCCAAGG - Intergenic
1103125735 12:118420849-118420871 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1103152570 12:118653945-118653967 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1103224887 12:119278308-119278330 GAGGTTGAACAACTTGCTCAAGG - Intergenic
1103225190 12:119281345-119281367 GAGGTTAAGCAACTTGTCTAAGG - Intergenic
1103605762 12:122084982-122085004 GAGGTTACACAACTTGTCCACGG + Intronic
1103967856 12:124651690-124651712 GAGGTTAGGCAACTTGCGCAAGG + Intergenic
1103978648 12:124721181-124721203 GAGGTTAGGTAACTTGCTCAAGG - Intergenic
1104082327 12:125441054-125441076 GATTTTAAATAACTTGTTCAAGG - Intronic
1104425649 12:128675380-128675402 GAGGTCACGCAACTTGTACATGG + Intronic
1104680391 12:130747172-130747194 GAGGTGAAACAACTTTTCCAAGG - Intergenic
1104948951 12:132430129-132430151 GAGGTTAGATAACTTGCTCCAGG - Intergenic
1105068002 12:133216860-133216882 GGGGTCACACCACTTGGTCATGG + Intergenic
1105669990 13:22602763-22602785 GAGGTTACATAACTTACTCAAGG - Intergenic
1105865124 13:24452186-24452208 GAGGTTAAGGAACTTGCTCAAGG + Intronic
1106141851 13:27018461-27018483 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1106496098 13:30277379-30277401 GAGGTTAAATAGCTTGCTCAAGG + Intronic
1106752538 13:32790017-32790039 GAGGTTATACAACTTGCTCAAGG - Intergenic
1107242914 13:38259233-38259255 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1107370966 13:39747081-39747103 GAGGTTAAATTACTTGTTCAAGG + Intronic
1107429024 13:40322085-40322107 GAAGTTACATAATTTGTCCAAGG - Intergenic
1107552734 13:41492491-41492513 GAGGTTAAAGAGCTTGCTCAAGG - Intergenic
1107578250 13:41750972-41750994 GAGGTTAAACAATTTGGCCAAGG - Intronic
1107591833 13:41916061-41916083 GAGGTTAAATAACTTGATTAAGG - Intronic
1108072484 13:46642398-46642420 GAGGTTAGGTAACTTGTCCAAGG - Intronic
1108110543 13:47066873-47066895 GAGGCTAAAAAACTTGTTCAAGG + Intergenic
1108117398 13:47144545-47144567 GAGGTTACAGAACTTGCTCCAGG - Intergenic
1108375135 13:49807245-49807267 GAGGTTAAACAATTTGCCCAGGG + Intergenic
1109785292 13:67166415-67166437 GAGGTTAAGTGACTTGTTCAAGG - Intronic
1110183174 13:72641720-72641742 GAGGTTATAAAACTTCCTCAAGG - Intergenic
1110255848 13:73433142-73433164 GTGGTGAAACAACTTGCTCAAGG - Intergenic
1110373455 13:74765675-74765697 GAGGTTAAGAAACTTGTCCAAGG + Intergenic
1110499089 13:76205008-76205030 CAAGTTACACATCTGGTTCATGG + Intergenic
1110621416 13:77599926-77599948 GAAATTACACAACTTGCCCAGGG - Intronic
1110963105 13:81656338-81656360 GAGGTCACTCAACATGATCAAGG - Intergenic
1112016278 13:95334036-95334058 GAAGTTAGACAACTTGCCCAAGG + Intergenic
1112310845 13:98316427-98316449 GAGGTTAAAGAACTTGTTCCAGG + Intronic
1112632161 13:101173448-101173470 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1113092313 13:106628637-106628659 GAGATTAAACAACTTGTAGAAGG - Intergenic
1113374057 13:109747538-109747560 AAGGTTAAACACCTTGCTCAGGG - Intergenic
1114368332 14:22054960-22054982 GAAATTAAACAACTTGCTCATGG + Intergenic
1114412847 14:22517045-22517067 GAGATTAAGTAACTTGTTCAAGG - Intergenic
1114710885 14:24777120-24777142 GAGGTTAAATAACTTATTGAAGG - Intergenic
1114740984 14:25096774-25096796 GAAATTAAACAACTTGCTCAAGG - Intergenic
1115175888 14:30560982-30561004 GAGGTTAAACAGCTTGCCCAGGG - Intronic
1115284138 14:31699490-31699512 GAGGTTAAATAACTTGGGCAGGG + Intronic
1115424814 14:33246081-33246103 GAGGTTACACAGCTGGTTACTGG - Intronic
1115762702 14:36591122-36591144 GAAATTACAAAACTTGATCAAGG - Intergenic
1115783877 14:36802541-36802563 GAGGTTAAATAATTTGTCCAAGG + Intronic
1116511058 14:45747304-45747326 GAGGTTAAATAACATGTCCAAGG + Intergenic
1116812261 14:49550435-49550457 GAAGTTACACAACCTGGCCAAGG + Intergenic
1117150637 14:52884253-52884275 AAGGTTAAATAACTTGTCCAAGG + Intronic
1117555831 14:56882690-56882712 GAAGTTACGTATCTTGTTCAAGG - Intergenic
1117628545 14:57665474-57665496 GATGATAAATAACTTGTTCAAGG + Intronic
1117804613 14:59478737-59478759 GAGGTTACGTAACTTGCCCAAGG + Intronic
1117884648 14:60347720-60347742 GAGGTTAATTAACTTATTCAAGG - Intergenic
1117950344 14:61076483-61076505 AAGGTTAAATGACTTGTTCAAGG + Intronic
1117991473 14:61438125-61438147 GATGTTAAACAACTTGCCCAGGG + Intronic
1118152789 14:63207748-63207770 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1118270696 14:64339483-64339505 GAGGTGACAAGACTTGATCAAGG + Intergenic
1118377466 14:65189736-65189758 GAGGTTACATAACTTGCTCAGGG + Intergenic
1118513330 14:66500490-66500512 GAGGTTAAATGACTAGTTCAAGG - Intergenic
1118565986 14:67141600-67141622 GAAGTTAAGCAACTTGTGCATGG + Intronic
1118588340 14:67378464-67378486 GAGATTAAATAATTTGTTCAAGG + Intronic
1119043807 14:71299175-71299197 AAGGTTACATAACTTCCTCAAGG - Intergenic
1119058456 14:71448416-71448438 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1119196511 14:72720756-72720778 GGGGTTAAGCAATTTGTTCAAGG - Intronic
1119277827 14:73375375-73375397 GAGATTAAGTAACTTGTTCAAGG + Intronic
1119362006 14:74058572-74058594 CAGGGTACACAACATTTTCAAGG + Exonic
1119490886 14:75031942-75031964 GAGGTTACAAGACTTGTCTAAGG - Intronic
1119583026 14:75804735-75804757 GAGGTTAAACAACTTGTCCAAGG - Intronic
1119636658 14:76278823-76278845 GAGGTTTCATAACTTGCCCATGG + Intergenic
1119688046 14:76648626-76648648 GAGGTTAAACAACTTGCTGGAGG - Intergenic
1119769458 14:77211320-77211342 GAGGTTAAACAACTGGCTCAAGG - Intronic
1119779241 14:77267097-77267119 GAGGTTACATAACTTACCCAAGG - Intronic
1119903988 14:78285044-78285066 GAGGTTACATGACTTGCCCAAGG - Intronic
1119917885 14:78419153-78419175 AAGGTCACACAGCTAGTTCATGG + Intronic
1119959074 14:78834273-78834295 GAGGTTGAATAATTTGTTCAAGG + Intronic
1119980367 14:79073883-79073905 GAGGTTAAATAACGTGTCCAAGG - Intronic
1120127203 14:80758884-80758906 GAGCTTACATAACTTATCCAAGG + Intronic
1120385286 14:83838190-83838212 GAGGTTGAACACCTTGTTCAAGG - Intergenic
1120510770 14:85411569-85411591 CAGGTTAAGCAACTTGTCCAAGG + Intergenic
1120633971 14:86928377-86928399 GAGGTTATAAAACTTGCCCATGG - Intergenic
1120762339 14:88296294-88296316 GAGGGTAAAAAACTTGTCCAAGG - Intronic
1120945887 14:89996656-89996678 GAGGTTAAGAAACTTGTCCAAGG - Intronic
1121101987 14:91255600-91255622 GAGGTTAAAAGACTTGTCCAGGG - Intergenic
1121228507 14:92339506-92339528 GAGGTTCAATAACTTGCTCAAGG + Intronic
1121458814 14:94057432-94057454 GAGATTACATGACTTGTTCAAGG + Intronic
1121483441 14:94295492-94295514 GAGGTTAGGTAGCTTGTTCAGGG - Intergenic
1121495161 14:94387231-94387253 GAGGTTAAGTAACTTGTCCAAGG - Intronic
1122146301 14:99690944-99690966 GAGGTTACAGCACTGGCTCAGGG - Intronic
1122453663 14:101833156-101833178 GAGAGTAAACAACTTGATCAAGG - Intronic
1122541618 14:102500909-102500931 GAGGTTAGGTAACTTGCTCAAGG + Exonic
1123432799 15:20232723-20232745 AAGGTTACACAGCTTGTGAACGG + Intergenic
1125147925 15:36494213-36494235 TAGGTTAAATAATTTGTTCAAGG + Intergenic
1125697119 15:41648294-41648316 GAGGTTAAGTAATTTGTTCAAGG - Intronic
1126069299 15:44851792-44851814 GAAGTTAAATAACTTGGTCAAGG + Intergenic
1126089512 15:45039004-45039026 GAAGTTAAATAACTTGGTCAAGG - Intronic
1126266489 15:46760360-46760382 GAGTTTCCATAACTTGCTCAAGG - Intergenic
1126459666 15:48901768-48901790 GAGCTTTAAAAACTTGTTCAGGG - Intronic
1126491206 15:49238391-49238413 GAGTTTCCTCAACTTGTTTAGGG + Intronic
1127185285 15:56473025-56473047 GAGGTTAAATGACTTGTTCAAGG - Intergenic
1127327246 15:57907536-57907558 GAGGTTGAAAAACTTGTCCAAGG - Intergenic
1127639964 15:60907196-60907218 GAGGTGAAGCAGCTTGTTCAGGG + Intronic
1127654320 15:61041952-61041974 GAGGTTAAATAACTTGCCCAAGG + Intronic
1127689385 15:61379899-61379921 GAGGTTAAATTACTTGTCCAAGG + Intergenic
1128183698 15:65626239-65626261 GAAGTTAAACCACATGTTCAAGG + Intronic
1128198495 15:65782555-65782577 GATGTTAAACAACTTGTCCGAGG - Intronic
1128327779 15:66736399-66736421 TAGGTTACACATCTTGTAAATGG + Intronic
1128462815 15:67884193-67884215 AAGGTTAAACAACTTGCCCAAGG - Intergenic
1128542066 15:68543227-68543249 GAGGGGACATGACTTGTTCAAGG - Intergenic
1128615771 15:69108207-69108229 CAAGTTAAATAACTTGTTCAAGG + Intergenic
1128711454 15:69875349-69875371 GAGGGGACATAACTTGATCAAGG + Intergenic
1128753808 15:70167352-70167374 GAAGTTAAGCAACTTGTCCAAGG + Intergenic
1129229733 15:74190553-74190575 GAGGTTATATAACTTGCCCAAGG + Intronic
1129257321 15:74341090-74341112 GAGGTTAAATAACTTGGTCGAGG - Intronic
1129674567 15:77625430-77625452 GAGGTTCCATAACTTGCTCGGGG + Intronic
1129734233 15:77950976-77950998 GAGGTTACATGACTTGCCCAGGG + Intergenic
1129841350 15:78745015-78745037 GAGGTTACATGACTTGCCCAGGG - Intergenic
1130172538 15:81530777-81530799 GAGTTTACATAACTTGTTTAAGG + Intergenic
1130821870 15:87504518-87504540 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1131082410 15:89547663-89547685 GAGGTCACATAACTTGTTCAAGG - Intergenic
1131249937 15:90823657-90823679 GAAGTTAAATAACTTGCTCAAGG - Intergenic
1131395563 15:92082883-92082905 AAGGTCACACAGCTTGTACATGG - Intronic
1131961867 15:97797998-97798020 GAGGTTAAGTAATTTGTTCAAGG + Intergenic
1132153574 15:99479203-99479225 GAGGTTACATAACTTGCACCAGG - Intergenic
1132389177 15:101426321-101426343 GAGGTTATGTAAGTTGTTCAAGG + Intronic
1133368506 16:5229882-5229904 GAAGTTCAACAACTTGTCCAAGG - Intergenic
1133440125 16:5814540-5814562 GAGGCCACACAACTTGCCCAAGG + Intergenic
1133703417 16:8330893-8330915 GAGGTTAAATAACTTTCTCAAGG + Intergenic
1133852493 16:9518577-9518599 GAGGTTAAGCAACTTGACCAAGG + Intergenic
1134067214 16:11236542-11236564 GAGGTGAAACAACTTGCTCAAGG - Intergenic
1134071753 16:11264592-11264614 GAGGTGAAACAACTTGGTCAAGG - Intronic
1134199767 16:12188314-12188336 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1134401971 16:13918601-13918623 GAGGTTATATAACTTGGGCAAGG - Intergenic
1134577080 16:15341573-15341595 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1134693712 16:16207691-16207713 GAGGTTAAGCAACGTGTCCAAGG + Intronic
1134725360 16:16414920-16414942 GAGGTTAAATAACTTGCTCAAGG + Intergenic
1134942072 16:18296938-18296960 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1134978131 16:18586952-18586974 GAGGTTAAGCAACGTGTCCAGGG - Intergenic
1135065772 16:19308575-19308597 GAAGTTCAGCAACTTGTTCAAGG + Intronic
1135167397 16:20151647-20151669 GAGGTGAAAGAACTTGCTCAAGG + Intergenic
1135471506 16:22735658-22735680 GAGGTTACATAACTTGCCCAAGG - Intergenic
1135486831 16:22872984-22873006 AAGGTTAAGAAACTTGTTCATGG - Intronic
1135581230 16:23628331-23628353 GAGGTTACACAATTTGTCCAAGG + Intronic
1135620401 16:23950509-23950531 GAGGCCACACAGCTTGTCCACGG - Intronic
1136237362 16:28922965-28922987 GAGGTTAAATAACTTGCCCAAGG - Intronic
1136555927 16:31007913-31007935 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1136717209 16:32290183-32290205 GTGTTTACACAACTGGGTCATGG + Intergenic
1136835583 16:33496437-33496459 GTGTTTACACAACTGGGTCATGG + Intergenic
1137335928 16:47548761-47548783 AAGGTCACATAACTTGTTGAGGG - Intronic
1137506617 16:49059420-49059442 GAAGTTAAGTAACTTGTTCAAGG - Intergenic
1137559968 16:49496203-49496225 GAGGTCACAGAACTTGCCCAAGG - Intronic
1137866563 16:51903163-51903185 GAGGTTACACTGCTGGTACATGG - Intergenic
1138038849 16:53639657-53639679 GAGGTTAAGTAACTTGTTCATGG - Intronic
1138052222 16:53791287-53791309 GAGGTTAAGTAACTTGCTCAAGG + Intronic
1138624076 16:58235373-58235395 GAAGTTAAGCAACTTGTCCAAGG - Intronic
1138835196 16:60426143-60426165 GAGGTTAAGCAACTTGCTCAAGG - Intergenic
1139331438 16:66195279-66195301 CAGGTTAAGTAACTTGTTCAAGG - Intergenic
1139588109 16:67917216-67917238 GAGGTTACATAACTTGGCCATGG + Intronic
1139672169 16:68499343-68499365 GAGGTTAAGCAACTTGCCCAGGG - Intergenic
1139937447 16:70581780-70581802 GAGGTTATAAAACTTGTTAGGGG + Intronic
1140116272 16:72044099-72044121 GAGGATAAGGAACTTGTTCAAGG - Intergenic
1140873490 16:79128491-79128513 GAGGTTAAATAACTTGGCCAAGG + Intronic
1140941372 16:79724212-79724234 GAGGTTAAAAATCTTGTCCAAGG - Intergenic
1141016643 16:80457094-80457116 GAGCTTACACAACGTGCCCAAGG - Intergenic
1141074994 16:80997535-80997557 GAGGTCACACAGCTGGTTAATGG - Intronic
1141283152 16:82647117-82647139 GAGGTTAAGCAACTTGCCCATGG - Intronic
1141340481 16:83199433-83199455 TGGGTTACACAGCTAGTTCAGGG - Intronic
1141343020 16:83221028-83221050 GCTGTTAAACAACTTTTTCAAGG + Intronic
1141474020 16:84259879-84259901 GAGGTCAAGCAACTTGTCCAAGG + Intergenic
1141496995 16:84417092-84417114 GAGGTTAACTAACTTGCTCAAGG - Intronic
1141564962 16:84895195-84895217 GAGGTTAAACGACTTGCCCAAGG + Intronic
1141609998 16:85175873-85175895 GAGGTTAAGCAACTTGTCCAAGG + Intronic
1141757592 16:86002424-86002446 GAGGTTACACATCTAGTGCCAGG - Intergenic
1141825626 16:86477690-86477712 GAGGTTAAGTAACTTGTGCAAGG - Intergenic
1141929834 16:87194990-87195012 GAGGTTAAGGAACTTGTCCACGG + Intronic
1142454870 16:90214289-90214311 GAGGTTAGGTAACTTGTTCGAGG + Intergenic
1203009221 16_KI270728v1_random:227595-227617 GTGTTTACACAACTGGGTCATGG - Intergenic
1203145760 16_KI270728v1_random:1796750-1796772 GTGTTTACACAACTGGGTCATGG + Intergenic
1142491771 17:284296-284318 GAGGTCACACAGCTCGTTCACGG + Intronic
1142702563 17:1672873-1672895 GAGGCTACACAATTTCTACAAGG + Intronic
1142870050 17:2814221-2814243 GAGGTTAAGTAACTTGTCCAAGG - Intronic
1142952342 17:3493733-3493755 GAAGTTAAGCATCTTGTTCAAGG + Intronic
1143281380 17:5757161-5757183 GAGGGTGGACAACTTGTCCAAGG - Intergenic
1143505128 17:7359807-7359829 GAGGTTAAATAACTTGCCCACGG - Intergenic
1143538089 17:7553590-7553612 GAGGTTACACAACTTGTCTGAGG + Intronic
1143589255 17:7871238-7871260 GAGGTTAAATATCTTGCTCAAGG - Intronic
1143659863 17:8318226-8318248 GAGGTAACAGGACTTGCTCAGGG + Intronic
1144105940 17:11985393-11985415 AAGGTTAAATAACTTGCTCAAGG - Intronic
1144175685 17:12704700-12704722 GAGGTTAAGCAACTTGCTTAGGG + Intronic
1144192187 17:12856688-12856710 AAGCTTACAAAACTTGTCCAAGG - Intronic
1144458541 17:15438642-15438664 AAGGTTAAGAAACTTGTTCAAGG - Intronic
1144711154 17:17402396-17402418 GAGGCTGCAGAACTTGTCCAGGG - Intergenic
1144711570 17:17404758-17404780 GAGGCTGCAGAACTTGTCCAGGG + Intergenic
1144998149 17:19285266-19285288 AAAGTTCCACAAATTGTTCATGG - Intronic
1145840861 17:27993244-27993266 GAACTTAAACAACTTGTTCAAGG + Intergenic
1145900528 17:28488021-28488043 GAGGGTAAACAGCTTGCTCAGGG - Intronic
1145981302 17:29013369-29013391 GAGGTTCCAAAACTTGCCCAAGG - Intronic
1146011255 17:29196664-29196686 GAGGTTACACCACTGGTAAATGG + Intergenic
1146342569 17:32033519-32033541 GAGGTTACATAACTTGTCCTAGG - Intronic
1146465710 17:33084542-33084564 GTGGTTGAATAACTTGTTCAAGG - Intronic
1146496373 17:33326047-33326069 GAGGTTAAGAAACTTGGTCAAGG + Intronic
1146602118 17:34226757-34226779 GAGATTAAATAACTTGCTCAAGG - Intergenic
1146650772 17:34604918-34604940 AAGGTTAAACAACTTTCTCAAGG + Intronic
1146667703 17:34715908-34715930 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1146794060 17:35769156-35769178 GAGGTTAGGTAACTTGCTCAGGG - Intronic
1146807825 17:35879254-35879276 GAGGTTAAGTAACTTGTCCATGG - Intronic
1146846750 17:36186673-36186695 GAGTTAAAACAACTTGTCCATGG - Intronic
1146912244 17:36656369-36656391 GAGGTCATGCAACTTGTTCAAGG + Intergenic
1147008661 17:37425483-37425505 GAGGTTAAGTAACTTGTTCAGGG + Intronic
1147215123 17:38894450-38894472 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1147267820 17:39245394-39245416 GAGGTTAAATAACTTGCCCAAGG + Intergenic
1147568938 17:41555314-41555336 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1147657089 17:42097211-42097233 GAGGTTAAGAAACTTGTTCAAGG + Intergenic
1147774006 17:42887682-42887704 GAAGTTAAATAACTTGTTCAAGG - Intergenic
1147794875 17:43035093-43035115 GAGGTTAAGTAACTTGTGCAAGG - Intergenic
1148062240 17:44844854-44844876 GAGGATACACAGCTAGTACATGG - Intergenic
1148171594 17:45525599-45525621 GAGGTTATATAACTTGTCCTAGG + Intergenic
1148277777 17:46320807-46320829 GAGGTTAGATAACTTGTCCTAGG - Intronic
1148299984 17:46538662-46538684 GAGGTTAGATAACTTGTCCTAGG - Intronic
1148364427 17:47042950-47042972 GAGGTTATATAACTTGTCCTGGG - Intronic
1148759479 17:49992089-49992111 GAGGTTAAACAACTTGCCCAAGG - Intronic
1149364439 17:55928073-55928095 GAGGCTACAGAACTAGTTCCTGG - Intergenic
1149411259 17:56409862-56409884 GGGGTTAAGTAACTTGTTCAAGG - Intronic
1149456639 17:56793634-56793656 GAGGTTAGGCAACTTGCCCAAGG + Intronic
1149778897 17:59380654-59380676 GAGGTTAATGAGCTTGTTCAAGG + Intronic
1149831723 17:59878453-59878475 GAGATTAAAAAACTTGTCCAAGG - Intronic
1149984107 17:61334287-61334309 GAAGTTACATAACTTGCCCAAGG - Intronic
1150227728 17:63533009-63533031 GAGGTTACAAAACTTGCCCAAGG + Intronic
1150298048 17:64025161-64025183 GAGGTTACACAACTTGCTCAAGG - Intergenic
1150402520 17:64870635-64870657 GAGGTTATATAACTTGTCCTAGG + Intronic
1150624425 17:66832655-66832677 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1150706767 17:67494141-67494163 GAGGTTACACATATTGTTAGTGG - Intronic
1150783434 17:68142695-68142717 GAGGTAACATAACTTGTCCTAGG + Intergenic
1150845478 17:68653384-68653406 GAGGTTAAATAACTTGTTCAAGG - Intergenic
1151323775 17:73366671-73366693 GAAGTTATACTACTTGTCCAGGG - Intronic
1151400211 17:73850962-73850984 GAGGTTAAACAACCTGCTCAAGG - Intergenic
1153057638 18:962925-962947 GAGCGCAAACAACTTGTTCAAGG - Intergenic
1153417318 18:4861441-4861463 GAGTTTAATCAACTTGTACAAGG + Intergenic
1154024771 18:10696874-10696896 GAGGTTACATAGCATGCTCATGG - Intronic
1154299866 18:13183697-13183719 GAGCCTACAGAACCTGTTCAGGG + Intergenic
1155079189 18:22390702-22390724 GAGGTAAAGCGACTTGTTCAAGG + Intergenic
1155082308 18:22422939-22422961 GAGGTGAAGCAACTTGCTCAAGG + Intergenic
1155208150 18:23578280-23578302 GAGGCTAAACAACTTGTCCAAGG + Intronic
1155256304 18:24000925-24000947 GATGTTAAGCAACTTGATCAAGG + Intronic
1155456518 18:26021246-26021268 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1155721765 18:29022505-29022527 GAGTTTCCACAAATTGTTAAGGG + Intergenic
1155813111 18:30264037-30264059 GAGGTTAGTTAACTTGCTCAAGG + Intergenic
1155924819 18:31644173-31644195 GCAGCTTCACAACTTGTTCAAGG + Intronic
1156460139 18:37317002-37317024 GAGGCTAGATAACTTGTTCCAGG - Intronic
1156569521 18:38237458-38237480 GAGGTTAGGCAACATGCTCAAGG + Intergenic
1156816962 18:41323028-41323050 ATGGTTAAATAACTTGTTCAAGG + Intergenic
1157215960 18:45783664-45783686 GAGGCTAAATAACTTGTTCTGGG + Intergenic
1157336362 18:46740735-46740757 GAGGTTAAGTAATTTGTTCAAGG - Intronic
1157340403 18:46772822-46772844 GAGGGAAAGCAACTTGTTCATGG - Intergenic
1157389469 18:47289089-47289111 GAGGTGAAGCAACTTGTCCAAGG + Intergenic
1157493652 18:48140421-48140443 GAAGTTTTACAACTTGTTTAAGG + Intronic
1157499710 18:48180972-48180994 GAGGTTAAGTAACTTGTCCAAGG - Intronic
1157508541 18:48250333-48250355 GAGTTTAACTAACTTGTTCAAGG - Intronic
1157564367 18:48670017-48670039 GAGGTTAAACAACTTGTACAGGG + Intronic
1157588680 18:48821396-48821418 GAGGTCAGGCAACTTGCTCAGGG + Intronic
1157676136 18:49569927-49569949 GAGGTGAGACAACTTGCCCAGGG + Intronic
1157798249 18:50596199-50596221 GAGGTTAAATGACTTGTCCAAGG + Intronic
1158110075 18:53931096-53931118 GAGATTCAAAAACTTGTTCAAGG - Intergenic
1158118372 18:54022430-54022452 GAAGTTAAACAACCTGTTCATGG - Intergenic
1158132415 18:54167363-54167385 GAGGTTATAGACCTTGTCCAAGG - Intronic
1158143518 18:54283554-54283576 AAGGTTAAATAACTTGTCCAAGG + Intronic
1158253383 18:55516205-55516227 GAGGTTAAATGACTTGTTCAAGG - Intronic
1158357194 18:56634359-56634381 GAGGTTAAATAATTTGTTTAAGG - Intronic
1158507535 18:58059993-58060015 GAGGTTAAATAACTTGCCCAGGG + Intronic
1158603386 18:58873922-58873944 GAATTTACATAACCTGTTCAAGG - Intronic
1159271701 18:66161493-66161515 GAGGTTAAACAACATGTCTAAGG + Intergenic
1161602854 19:5195423-5195445 GAGGTTAAATAACTTGCCCAAGG - Intronic
1161606714 19:5219159-5219181 GAGGTTAAGCCACTTGATCAAGG - Intronic
1161632318 19:5364318-5364340 GAGGTCACACAGCTTGTTCAAGG - Intergenic
1162146636 19:8616434-8616456 GAGGTTGAGTAACTTGTTCAAGG + Intergenic
1162151121 19:8646393-8646415 GAGGTTAAGCAATTTGTCCAAGG + Intergenic
1162204770 19:9047416-9047438 GAGATTAAGCAACTTGCTCAAGG - Intergenic
1163258016 19:16169488-16169510 GAGGTTAAGACACTTGTTCATGG - Intronic
1163307854 19:16493058-16493080 CAGATCACACAACTTGCTCAAGG - Intronic
1163871303 19:19823498-19823520 CAGCTCACACAACTTGTTCCAGG - Intergenic
1164567374 19:29336963-29336985 GAGGTTAAGAAACTTGTCCAAGG - Intergenic
1164573625 19:29392264-29392286 GAGGTAAAGCAATTTGTTCAAGG - Intergenic
1165029046 19:32984096-32984118 AAGGTTACACAGCTTGTGAACGG + Intronic
1165217154 19:34283601-34283623 GAGGTTAAGGAACTTGCTCAAGG + Intronic
1165438030 19:35807266-35807288 AAGGTTACATAACTTGCCCAAGG - Intronic
1165709506 19:37999966-37999988 GAGGTTACGCAACTTTCTCAAGG - Intronic
1165847858 19:38830365-38830387 GAGGTTAAGCATGTTGTTCATGG + Intronic
1166928868 19:46288963-46288985 GAGGTTAAGTAATTTGTTCAAGG + Intergenic
1167020005 19:46866483-46866505 GAGGTCAAGCAATTTGTTCAAGG - Intergenic
1167487070 19:49768779-49768801 GAGGTTAAACAACTCGTGGAGGG - Intronic
1168147555 19:54428565-54428587 GAGGTTGGACCACTTGCTCAGGG + Intronic
1168413671 19:56155684-56155706 GAGGTGACACAGCTGGTTCAGGG + Intronic
1168709169 19:58488342-58488364 GTGGCCACACACCTTGTTCATGG + Intronic
925309011 2:2868763-2868785 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
925422240 2:3722154-3722176 GAGGTTATACAACTTGATCAAGG + Intronic
925673382 2:6335158-6335180 GAGGTTGAACAAATTGTCCAAGG + Intergenic
925912924 2:8584714-8584736 GAAGTTAGACAACTTTCTCAGGG - Intergenic
926048564 2:9728264-9728286 GAGGTTAGGCAACTTGTCCATGG + Intergenic
926400761 2:12493635-12493657 GAGGTCACATAATTTGTGCAAGG + Intergenic
926575737 2:14578789-14578811 GAGGTTCAATAACTTGCTCATGG - Intergenic
926591275 2:14742741-14742763 GAGGCAAAACAACTTGTTCAAGG - Intergenic
926607461 2:14911794-14911816 GAAGTTAAGCAACTTGTTCAGGG - Intergenic
926809007 2:16739971-16739993 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
926881297 2:17547196-17547218 GAGTTTAAACAATTTATTCAAGG - Intronic
927043698 2:19255693-19255715 GAGGTTACACCAGTTGTTCAAGG - Intergenic
927081508 2:19635190-19635212 GAGGCTAGTTAACTTGTTCATGG + Intergenic
927956258 2:27209484-27209506 GAGATTAAATAACTTGCTCAAGG + Intronic
928099812 2:28430233-28430255 GAGGTTAAGTAACGTGTTCAAGG - Intergenic
928214600 2:29350798-29350820 GAGGTTAAGCAACTTGTCCAAGG + Intronic
928317267 2:30255905-30255927 AAGGTCACACAGCTTGTTCATGG - Intronic
929634674 2:43505876-43505898 GAGGTTAAACCACTTGCCCACGG - Intronic
929835716 2:45396149-45396171 GAGTTTAAATAACTTGTCCAAGG + Intronic
930339291 2:50092084-50092106 GAAGGTACAAGACTTGTTCAAGG + Intronic
930406082 2:50957271-50957293 GAGATTAAATAACTTGCTCAAGG - Intronic
930779778 2:55212927-55212949 GAGGCTAGATAACTTTTTCAGGG - Intronic
930997536 2:57738758-57738780 GAGGTTACATGACTTGCCCAAGG - Intergenic
931171808 2:59811388-59811410 GAGGTTATATGACTTGATCAAGG - Intergenic
931180610 2:59896629-59896651 GAGGTTAGATGACTTGATCAAGG + Intergenic
931265887 2:60660240-60660262 GAGGTTACACTACTTGCTCAAGG + Intergenic
931380604 2:61749540-61749562 GAGGTTAACCAAATTGTTCTAGG - Intergenic
931585236 2:63819197-63819219 CAGGTTAAATAACTTGTTCAAGG - Intronic
931593830 2:63917847-63917869 GAGGTTAAGCAACTTGTCTAAGG - Intronic
931665289 2:64606185-64606207 GAGGTTGAACAACTTGCCCAAGG + Intergenic
931874609 2:66498352-66498374 GAGGTTAAATAACTTGCCCAGGG + Intronic
931938154 2:67221081-67221103 GAAGTTACATAACTTGCTTAAGG - Intergenic
932117858 2:69069323-69069345 GAGGTTACAGAACTTACCCAAGG - Intronic
932721330 2:74140862-74140884 GAGGTTGAAAAACTTGCTCAAGG + Intronic
933392086 2:81683668-81683690 GAGGTTACACCACTGGTATATGG - Intergenic
933573160 2:84036928-84036950 GGGATTAAACAACTTGTCCATGG + Intergenic
933802614 2:85975158-85975180 GAGATTAAATAACTTGTCCAAGG - Intergenic
933884544 2:86705859-86705881 GAGGTTAAATAACTTGCTCATGG + Intronic
933998114 2:87684869-87684891 GAGGTTAAACAACTTTCCCACGG + Intergenic
934048291 2:88189979-88190001 GAGGTTAGGTAACTTGTCCAAGG + Intergenic
934556951 2:95292481-95292503 GAAGTTACATAGCTGGTTCAGGG + Intergenic
934792200 2:97070781-97070803 GAGGTTAAACAACTTTCCCACGG - Intergenic
934814417 2:97312928-97312950 GAGGTTAAACAACTTTCCCACGG + Intergenic
934823276 2:97395555-97395577 GAGGTTAAACAACTTTCCCACGG - Intergenic
934956165 2:98621886-98621908 GAAGATACACACTTTGTTCAAGG + Exonic
935514826 2:104022858-104022880 GAGGTTTGGCAACTTGTGCACGG + Intergenic
935665020 2:105503705-105503727 GAAGTTAGGCAACTTGTACAAGG + Intergenic
935682524 2:105650349-105650371 GAGGTTTAGAAACTTGTTCAAGG + Intergenic
935985384 2:108667357-108667379 GAGGTTAAGCAACTTGCCCAAGG + Intronic
936066132 2:109333757-109333779 GAGGTTAATTAACATGTTCAAGG - Intronic
936295738 2:111266004-111266026 GAGGTTAAACAACTTTCCCACGG - Intergenic
936952092 2:117987965-117987987 GAGGTTAAAAAACTTGCTGATGG + Intronic
937103714 2:119291308-119291330 ATGGATACACAGCTTGTTCAAGG - Intergenic
937492731 2:122386834-122386856 GAGGTTAAATAACTTGTCCAAGG + Intergenic
937684899 2:124684856-124684878 GAGGTCACACAAGTTGTCCAAGG + Intronic
937859559 2:126697139-126697161 GGGGTCAAACAAGTTGTTCAAGG - Intergenic
937968037 2:127529030-127529052 GAGGTTCAGCAACTTGCTCAAGG - Intergenic
938590831 2:132734732-132734754 GAGGTTAAGCAACTTGTCCAAGG + Intronic
938664327 2:133518687-133518709 GAGGTTAAATGACTTGTCCAAGG - Intronic
938685014 2:133729678-133729700 AAAGTTATGCAACTTGTTCAAGG - Intergenic
938752335 2:134344619-134344641 GAGGTTAGGTAACTTGTTTAAGG + Intronic
938802280 2:134774296-134774318 GAAGTTAAAGAACTTGCTCAAGG - Intergenic
938927155 2:136054651-136054673 GAGGTTATGCAGCTTGCTCAAGG + Intergenic
939297906 2:140293866-140293888 GAGGTTAAATAACTTGCTCAAGG - Intronic
939965412 2:148605800-148605822 GAGGTTACACAAGTTGCCCAAGG + Intergenic
940392529 2:153149260-153149282 GACGTTACACAACTTTTCCAAGG + Intergenic
940527331 2:154833291-154833313 GAGGTTACATAACTTGCTTAAGG - Intronic
940534000 2:154915116-154915138 GAGGTTACAGAGCTTGCCCAAGG - Intergenic
940823692 2:158386242-158386264 GAGGTTAAACAACTTGTTCAAGG + Intronic
940932625 2:159452464-159452486 GAGGTCAGATAATTTGTTCAAGG + Intronic
941030629 2:160507740-160507762 GAGGTTAGGTAACTTGTCCAGGG - Intergenic
941149656 2:161898121-161898143 GAGGTTAAAACATTTGTTCAAGG - Intronic
941209783 2:162623650-162623672 AAGGTTACGTAACTTGTACAAGG - Intronic
941284518 2:163592917-163592939 AAGGTCACACAGCTTGTCCATGG + Intergenic
941728053 2:168885804-168885826 GAGGTTAAGCAACTTTCTCAAGG - Intronic
942120934 2:172776225-172776247 GAGGTTAAGCAACTTGTTCAGGG + Intronic
942324111 2:174761002-174761024 GAGGTTGGACCACTTGTCCAAGG + Intronic
942338728 2:174920394-174920416 GAGATTACGTAACTTATTCAAGG + Intronic
942505863 2:176640932-176640954 GAGGTTATATAACTTGTCCAGGG - Intergenic
942547893 2:177083723-177083745 GAGGTTAAATAACTTGTTCAGGG + Intergenic
942848270 2:180452739-180452761 GAGGTTACATAACATGCTCAAGG - Intergenic
942853086 2:180513612-180513634 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
942877629 2:180820593-180820615 GAGGTTAAATAAATTGTTCAAGG - Intergenic
943750508 2:191504900-191504922 GAGGTTAAGCAACTTGTTTAAGG + Intergenic
944045694 2:195409003-195409025 GAGATTACACAACTTGTTCAAGG + Intergenic
944855513 2:203763379-203763401 GAGGTTAAGTAACTTGTTTAAGG + Intergenic
944994375 2:205277297-205277319 GAGGTTAAATATCTTGTTCAAGG - Intronic
944996446 2:205300353-205300375 GAAGTCAAACCACTTGTTCAAGG + Intronic
945415137 2:209561478-209561500 GAGGTTAAATAACTTCTCCAAGG - Intronic
945498624 2:210540683-210540705 GAGTTAAAGCAACTTGTTCAAGG + Intronic
945584402 2:211640545-211640567 TAGGTTATACAACTTGTCCAAGG + Intronic
945613931 2:212043769-212043791 AAGATTAAATAACTTGTTCAAGG - Intronic
946049562 2:216850610-216850632 GAAGCTAGACAACTTGTTCAAGG + Intergenic
946059316 2:216928027-216928049 GAACTTACAGAACTTGCTCAAGG + Intergenic
946070176 2:217028099-217028121 GAGGTTAAAGAACTTGCTCAAGG + Intergenic
946102378 2:217337107-217337129 GAGGTTAAGCAACTTCCTCAAGG + Intronic
946387915 2:219396852-219396874 GAGGTTGCAGAAATTGTACATGG - Intronic
946403005 2:219478427-219478449 GAGGTTAAATAACTTGCCCAAGG + Intronic
946601494 2:221364809-221364831 GAGATTACATAACTTGTTCAAGG - Intergenic
946828539 2:223704314-223704336 GAGTTTAAGCAACTTGATCAAGG + Intergenic
947082437 2:226413482-226413504 GAGGTTAAACAACTTGCCCAAGG + Intergenic
947181172 2:227412646-227412668 GAGGTGACATAACTTCCTCAAGG + Intergenic
947330355 2:229022844-229022866 GAGGTTACATCACTTGGCCATGG - Intronic
948295029 2:236854250-236854272 GAGGTTAAGCAACTTGTCCAAGG + Intergenic
949086336 2:242158956-242158978 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1168793819 20:597871-597893 GAGGTTAAAGAACTTGGCCAAGG - Intergenic
1168798873 20:631140-631162 GTGGTTAAACAACTTGCTCAAGG - Intergenic
1168834361 20:868102-868124 GAGGTTGTGCAACTTGTTTAAGG + Intergenic
1168840600 20:907663-907685 GAGGTTAAACAACTTGTCCAAGG + Intronic
1168913084 20:1465851-1465873 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1168970357 20:1926712-1926734 AAAGTTATAAAACTTGTTCAGGG + Intronic
1169418021 20:5433951-5433973 GAGGTGGCACACCTTGTTGAAGG + Intergenic
1169719122 20:8653864-8653886 GAGGTTACAAAACTTGTCTAAGG - Intronic
1169833938 20:9856520-9856542 AAGGTTAAAAAACTTGTTTAAGG + Intergenic
1169853978 20:10083415-10083437 GAGATTAAACAACTTTTTCAAGG - Intergenic
1170073739 20:12396843-12396865 GACGTTAAGCAATTTGTTCAAGG + Intergenic
1170085995 20:12532298-12532320 AAGGTTAAATAACTTGTCCAAGG - Intergenic
1170160230 20:13303111-13303133 AAGGTTAGCTAACTTGTTCAAGG + Intergenic
1170414734 20:16127591-16127613 GATGTTAAACAACTCCTTCAAGG - Intergenic
1170441636 20:16385498-16385520 AAGGTTAAATAACTTGTTCATGG - Intronic
1170963209 20:21043832-21043854 GAGGTTAAGGAACTTGCTCAGGG + Intergenic
1171161586 20:22929848-22929870 AAGATTTCACAACTTCTTCAGGG - Intergenic
1171985085 20:31654613-31654635 GAGGTTACGTCACTTGTCCAAGG + Intergenic
1172067461 20:32231633-32231655 GAGGTCAAATAACTTTTTCAAGG - Intronic
1172082707 20:32355094-32355116 GAGGTTTCATAACTTGCCCAAGG + Intergenic
1172429948 20:34881736-34881758 GAGGTTAAATAACTTGTCTAAGG - Intronic
1172439946 20:34958260-34958282 GAAGTTACGTGACTTGTTCAAGG + Intergenic
1172749763 20:37242594-37242616 GAGGTTAAACTACTTGCCCAAGG - Intergenic
1172811408 20:37650714-37650736 GAGGTTAGTTAACTTGTTCCAGG - Intergenic
1172980314 20:38936705-38936727 GAGGTTAGGTAGCTTGTTCAAGG - Intronic
1172999568 20:39095896-39095918 GAGGTCAGGCAACTTGCTCAGGG + Intergenic
1173027220 20:39319577-39319599 GAGGTTAAGCAACTTGCCCAGGG + Intergenic
1173036322 20:39414498-39414520 AAGGTTTCATAACTTGTTCAAGG + Intergenic
1173087318 20:39936218-39936240 GAGGCCAAATAACTTGTTCATGG - Intergenic
1173294053 20:41739964-41739986 GAGGTTAAGTGACTTGTTCAAGG - Intergenic
1173343918 20:42180932-42180954 GAGATTAAATAACTTGCTCAAGG - Intronic
1173841022 20:46157395-46157417 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1173900529 20:46584253-46584275 GAGCAGAAACAACTTGTTCAAGG + Intronic
1173957307 20:47043611-47043633 GAGGTTAAGAAACTTGTCCAAGG - Intronic
1173969469 20:47140667-47140689 AAGGTTAGGCAACTTGTTCAAGG - Intronic
1174146117 20:48453799-48453821 CAGGTTAAAAAACTTGCTCAAGG - Intergenic
1174344014 20:49916127-49916149 GAGGTTAGGTAACTTGTCCAAGG - Intergenic
1174345259 20:49924366-49924388 GAGGTTAGATAGCTTGTCCAAGG - Intergenic
1174356056 20:49998645-49998667 GAGGTTGAACAACTTGCTCTAGG - Intergenic
1174395880 20:50246667-50246689 AAGGTGAAACGACTTGTTCAAGG + Intergenic
1174546446 20:51328873-51328895 GAGGTTAAGCAACTTGTCCTAGG - Intergenic
1174595628 20:51681122-51681144 CAGGTTAAGCAACTTGTTCAAGG - Intronic
1174857133 20:54056964-54056986 GAGGTTATGTAACTTGCTCAAGG + Intronic
1174904121 20:54532245-54532267 GAGGTTAAACAACCTGCCCAAGG + Intronic
1174952208 20:55054500-55054522 GAGGTAACACAACTAGTAAATGG + Intergenic
1175119279 20:56705876-56705898 AAGATCACACAACTTGATCATGG - Intergenic
1175409210 20:58754910-58754932 GAGGTCACACAACTTGCTCAAGG - Intergenic
1176916421 21:14631372-14631394 GAGTTTAAAGAACTTGTCCAAGG + Intronic
1177452222 21:21285054-21285076 GAGGTTACATGATTTGCTCAAGG - Intronic
1177919458 21:27132740-27132762 AAGGTTAAATAACTTGTCCAAGG - Intergenic
1178105802 21:29317896-29317918 GAGGTTAAGCAACTTGGCCAAGG + Intronic
1178462074 21:32811470-32811492 GAGGTTAAATAACTTGTCCAAGG + Intronic
1178709815 21:34906551-34906573 GAAGTTAGACAACTTGCCCAAGG + Intronic
1178884133 21:36472130-36472152 AAGGTTACATAACTTGTCCAAGG + Intronic
1179162335 21:38908877-38908899 GAGGTTAGGAAACTTGTCCAAGG + Intergenic
1179594740 21:42435102-42435124 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1180632268 22:17237772-17237794 GTGGGTACACAACTTGTCCATGG - Intergenic
1180743802 22:18072955-18072977 GAGGTTAAATAACTTGTCCAAGG - Intergenic
1181457024 22:23065605-23065627 GAGGTTAAGTAACTTGTCCAAGG - Intronic
1181791204 22:25268091-25268113 GAGGTCAAGCAACTTGCTCAAGG - Intergenic
1181792538 22:25278824-25278846 GAGATTAGACAACTTGTCTAAGG + Intergenic
1181813077 22:25416449-25416471 GAGATTAGACAACTTGTCTAAGG + Intergenic
1181831056 22:25560641-25560663 GAGATTAGACAACTTGTCTAAGG + Intergenic
1181882975 22:25996144-25996166 GAGGTTGAATAACTTGTCCAAGG - Intronic
1181983197 22:26781246-26781268 GAGGTTAAGCAACTTGCCCATGG + Intergenic
1182013154 22:27017273-27017295 GAGGTTAGCTAACTTGTCCAGGG - Intergenic
1182041375 22:27241349-27241371 GAGGTTAAGTAACTTGCTCAAGG - Intergenic
1182081756 22:27534195-27534217 GAGGTTAAGTAACTTGCTCAAGG - Intergenic
1182227793 22:28813089-28813111 GAGGTTAAGCAACTTGTCCAAGG - Intergenic
1182473262 22:30561489-30561511 GAGGTGACATAACTTGTCCAGGG + Intronic
1182769939 22:32787460-32787482 GAGGTTAAATCACTTGCTCAAGG - Intronic
1182770474 22:32792197-32792219 GAGGTTAAGGAACTTGTTCAAGG + Intronic
1183016178 22:34989503-34989525 GAGGTTAAGTAACTTGCTCAAGG - Intergenic
1183105206 22:35610515-35610537 GAGGTTAAGCAGCTTGTCCACGG - Intronic
1183305262 22:37079646-37079668 AAGGTCACACAGCTTGTTCCTGG - Intronic
1183383390 22:37501688-37501710 GAGGTTAAGCAACTTGCCCAGGG - Intronic
1183489709 22:38109828-38109850 GAGGTTAAACAGCTCATTCAAGG - Intronic
1183945207 22:41321738-41321760 GAGGTTAAGCAACTTGTTTAAGG + Intronic
1184001382 22:41676421-41676443 GAAGTTAAACACCTTGCTCAAGG - Intronic
1184043219 22:41956749-41956771 GAGGTTAGGCAACTTGCCCAAGG + Intergenic
1184103974 22:42356843-42356865 GAGGTGAAGGAACTTGTTCAGGG + Intergenic
1184445421 22:44544310-44544332 GAGGTTAAGTAACTTGTCCAGGG + Intergenic
1184446274 22:44548907-44548929 GAGGTTAATGAACTTGGTCAAGG + Intergenic
949197235 3:1326386-1326408 GAGGTTAGGCTACTTGTTTAAGG + Intronic
949417066 3:3826380-3826402 AAAGTTACATGACTTGTTCAAGG + Intronic
949420357 3:3858663-3858685 AAGGTTAAGCAATTTGTTCAAGG + Intronic
949473031 3:4416616-4416638 GAGGTTAACTAACTTGCTCAAGG - Intronic
949644952 3:6082702-6082724 GAAGTTAAATAACTTGTTCAGGG + Intergenic
949801849 3:7912804-7912826 CAGGTTAAAAAACTTGTTCAAGG - Intergenic
949857778 3:8477746-8477768 GAGGTTAAGGAACTTGGTCAAGG + Intergenic
950048230 3:9964414-9964436 GAGGTCAAATAATTTGTTCAAGG + Intronic
950108908 3:10405944-10405966 TAGGTCACACAGCATGTTCATGG - Intronic
950143452 3:10631429-10631451 GAGGTGACATGACTTGCTCAAGG + Intronic
950148476 3:10668277-10668299 GAGGTTAAGCGACTTGGTCATGG + Intronic
950165526 3:10794499-10794521 GAGGTTAAGAAACTTGTCCAGGG - Intergenic
950180788 3:10911775-10911797 GAGGTTAAGTAACTTGTCCAGGG + Intronic
950327611 3:12126673-12126695 GAGATTAAGTAACTTGTTCAAGG - Intronic
950673844 3:14542844-14542866 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
951064633 3:18249574-18249596 GAAGCTAAACAACTTGCTCAAGG + Intronic
951067520 3:18284344-18284366 GAAGTTACATGACTAGTTCAAGG + Intronic
951106329 3:18747568-18747590 GAGGTTAGGCAACTTGCCCAAGG + Intergenic
951127310 3:18998720-18998742 GAGGTTGAGCAACTTGTTCAAGG - Intergenic
951484681 3:23198897-23198919 GAAGTTAAACCACTTGCTCATGG + Intergenic
951696395 3:25449660-25449682 GTGGTTAGGTAACTTGTTCAAGG - Intronic
951808223 3:26670699-26670721 GAGGTTAAGGAACTTGTTCAAGG - Intronic
952190497 3:31018070-31018092 AATGTTACATAACTTGTCCAAGG + Intergenic
952362697 3:32646795-32646817 AAGGTCACACCACTTGTTCCTGG + Intergenic
952541868 3:34375320-34375342 GAGTTTAAGCAACTTGTCCAGGG + Intergenic
952617477 3:35292231-35292253 GAGGTTACATATTTTATTCATGG + Intergenic
952842954 3:37663801-37663823 GATGTTAAGCAACTTGCTCAAGG - Intronic
952934241 3:38383226-38383248 GTGGTTAAATAACTTGGTCAGGG + Intronic
952979810 3:38725537-38725559 GAGGTTAAACAACTTGCCTAAGG - Intronic
953113038 3:39962122-39962144 GAAGTTAAGCCACTTGTTCAAGG - Intronic
953203406 3:40798386-40798408 GAGATGACATAACTTGTCCAAGG - Intergenic
953258476 3:41313217-41313239 GAGGTTAAATAACTTGCTCATGG - Intronic
953414301 3:42706883-42706905 GAGGTTAAATAACTTGCCCAAGG + Intronic
953428520 3:42817033-42817055 GAGGCTAAATAACGTGTTCAAGG - Intronic
953440837 3:42915667-42915689 GAGGTTATAAAACTCATTCAGGG + Exonic
953475215 3:43200222-43200244 GAGGTTAAACAACTTGCTCCAGG - Intergenic
954173029 3:48820620-48820642 GAGGTTAAGTAACTTATTCAAGG - Intronic
954245518 3:49328411-49328433 TAGTTTACACACCTTTTTCAGGG + Intronic
954459671 3:50619205-50619227 GAGGTTACAGGACTTATTTAAGG + Intronic
954766471 3:52922073-52922095 GAGGTTATACAGCTTGAGCAAGG - Intronic
954851330 3:53603367-53603389 GAGGTTACAAAACTTGCCCAAGG - Intronic
954915750 3:54147588-54147610 AAGGTTACATAACTTGCCCAAGG - Intronic
955071096 3:55572991-55573013 GAAGTTAAGCAACTTGTTCAAGG - Intronic
955340383 3:58120860-58120882 GAGGTTAAGTAACTTGTCCAGGG - Intronic
955391090 3:58522809-58522831 GAGGTTAACCAATTTGTCCAGGG + Intronic
955408552 3:58641347-58641369 GAGGTTAAGCAACTTGCCCAAGG - Intronic
955440210 3:58946989-58947011 GACATTAAGCAACTTGTTCAAGG + Intronic
955515175 3:59719305-59719327 GATGTTAAATAACTTGTTCAAGG - Intergenic
955643753 3:61114458-61114480 GAGGTTACATAACTTGGTGGAGG - Intronic
955676819 3:61457496-61457518 GATGTTAAGTAACTTGTTCATGG + Intergenic
955865984 3:63384832-63384854 GATGTTACATAACTTGTCCAAGG + Intronic
955866918 3:63394218-63394240 GAGGTTAAGAGACTTGTTCAAGG - Intronic
956240372 3:67123379-67123401 GAGGTTAAATAACTTACTCAAGG - Intergenic
956433570 3:69211282-69211304 GAGATTAAACAACATGCTCAAGG + Intronic
956567419 3:70654650-70654672 GAGGTTAGATAACTTGCCCAAGG + Intergenic
956789045 3:72666583-72666605 GAGGTTAAATGACTTGTCCAAGG - Intergenic
956856497 3:73280298-73280320 AAGGTTGCACAGCTTGTTAATGG - Intergenic
956892105 3:73623494-73623516 GAGGTTAAGCAGCTTGCTCAAGG + Intronic
957871913 3:86099896-86099918 GAGGATAAACAACTAGTCCAAGG - Intergenic
957924014 3:86785318-86785340 GAAGTTAAACAACTTGTACAAGG + Intergenic
958061192 3:88483784-88483806 GAGATTACATAACTTGCCCAAGG + Intergenic
958735498 3:98004380-98004402 GAGATTAAGCAACTTGTCCAAGG + Intronic
958792890 3:98672032-98672054 GAGAGTAAACAACTTGTCCAAGG - Intergenic
958797966 3:98726651-98726673 GAAGTTTCATAATTTGTTCAAGG - Intergenic
958818382 3:98943945-98943967 GAGGTTAGATGACTTGCTCAAGG + Intergenic
959086332 3:101854234-101854256 GAGGTTAAATAACTTGCCCAAGG - Intronic
959559203 3:107760097-107760119 GAAGTTATATAACTTGTTTAAGG + Intronic
960151243 3:114251054-114251076 AAGGTTAGACAACTTGCTCTAGG - Intergenic
960193991 3:114742609-114742631 GAGATTAAATAACTTGTCCAAGG + Intronic
960610531 3:119551225-119551247 GAGGTTACCCAGCTTGCTCAAGG - Intronic
960675134 3:120186245-120186267 GAGGTTACATAACTTTCCCAAGG + Intronic
960719764 3:120614424-120614446 GAGGTTAAGTAACTGGTTCAGGG + Intergenic
960818492 3:121700373-121700395 AAGGTTACGCAGCTAGTTCAGGG + Intronic
961054229 3:123774293-123774315 GAGGTTACAATACTTTTGCAGGG + Intronic
961222022 3:125208607-125208629 GAGGTTACGAAACTTGTTCAAGG + Intronic
961326857 3:126113963-126113985 GAGGTTAGGTAACTTGCTCAAGG + Intronic
961905173 3:130255663-130255685 GAAGTTAAATAACTTGCTCAAGG + Intergenic
961945267 3:130680310-130680332 GAAGTTAAGTAACTTGTTCAAGG - Intronic
962145748 3:132837809-132837831 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
962459797 3:135599787-135599809 GAGGTTAATGAACTTGCTCAAGG - Intergenic
962554764 3:136536772-136536794 GAGGTCACACAACTGGTAAATGG - Intronic
962627884 3:137245146-137245168 GAGGTTAAGCATCCTGTTCAAGG - Intergenic
962869346 3:139474697-139474719 AAGGTTAAAAAACTGGTTCACGG + Intronic
963038737 3:141053074-141053096 GAGGTTAGAGAACTTGCCCAAGG - Intronic
963262603 3:143207827-143207849 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
963452469 3:145501168-145501190 CAGGTAACACAACCTGTTCCTGG - Intergenic
963712246 3:148759749-148759771 GAGGCTAATCAACTTTTTCATGG - Intergenic
963930100 3:150995105-150995127 GAAGTTAAGCAACTTGTTCAAGG - Intergenic
964046478 3:152333925-152333947 TAGGTTACATAACTTCTTCAAGG - Intronic
964121844 3:153193467-153193489 GAGGTTAAATAACTTGCCCAAGG + Intergenic
964760363 3:160129925-160129947 GAGGTTAAATGACTTGCTCAAGG - Intergenic
964841568 3:160999235-160999257 GAGGTTAAGTAACTTGCTCAAGG + Intronic
964980949 3:162678118-162678140 GAGGCTAAACAACTTGCTAAAGG + Intergenic
965629138 3:170712771-170712793 GGGGTTACATAACTTGTTCAAGG + Intronic
965638491 3:170808697-170808719 GAGGTTAAATAACTTGCCCAAGG - Intronic
966042679 3:175510669-175510691 GAAGTTAAAGAACTTATTCAAGG + Intronic
966413350 3:179665475-179665497 GAGGTTAGGTAATTTGTTCAAGG + Intronic
966966227 3:184997308-184997330 GAGGTTAAATAACTTGTCCAAGG - Intronic
966984723 3:185168720-185168742 GAGGTTAAGGAACTTGTCCAAGG + Intergenic
967173268 3:186840663-186840685 GAGGGTAAATAATTTGTTCAAGG - Intergenic
967292944 3:187939201-187939223 AAGGTTAAGCAACTTGTCCACGG + Intergenic
967341212 3:188400342-188400364 GAGGTTGAATAACTTGCTCAAGG - Intronic
967355615 3:188567242-188567264 GAGGTTAAGGAACTTGTTCAAGG - Intronic
967775085 3:193377911-193377933 GAGGTTAAATAACTTGCCCAAGG - Intronic
969039471 4:4284113-4284135 GAGATTACATAACTTGCCCAAGG + Intronic
969087677 4:4668558-4668580 GAGGTTAAATAACCTGTCCAAGG - Intergenic
969090003 4:4686568-4686590 GAGGTTAAGCAACTTGTTCAAGG + Intergenic
969194433 4:5549358-5549380 GAGGTTGAAGAACTTGTCCAGGG + Intronic
969201119 4:5606894-5606916 AAGGTTAAATAACTTGCTCAAGG + Intronic
969261082 4:6034288-6034310 GAGGTTAAATAATTTGTCCAAGG + Intronic
969396664 4:6926040-6926062 GAGGTGAAGGAACTTGTTCAAGG - Intronic
969635121 4:8364726-8364748 CAGGTCACAGAAGTTGTTCAAGG - Intergenic
969753521 4:9131692-9131714 GAGGGTAAGTAACTTGTTCAAGG - Intergenic
970065234 4:12086094-12086116 GAGATTATATGACTTGTTCAAGG + Intergenic
970225229 4:13850564-13850586 GAGGTTAGGTAACTGGTTCAAGG + Intergenic
970231708 4:13917497-13917519 GAGATTAAATAACTTGTCCAAGG - Intergenic
970275855 4:14399917-14399939 GAGGTTGCAGAACTTATTCAAGG + Intergenic
970316240 4:14831066-14831088 GAAGTTACAGAACTTGTCTAAGG - Intergenic
970450123 4:16157931-16157953 AAGGTTAAGTAACTTGTTCAGGG - Intergenic
970484583 4:16511728-16511750 GAGGTAAAATAACGTGTTCAAGG - Intronic
970491133 4:16574863-16574885 GAGCTTAGGAAACTTGTTCAAGG + Intronic
970498258 4:16650172-16650194 GAGGTTAGAAAATTTGCTCAAGG - Intronic
970521811 4:16891944-16891966 CAGGTTACATAAATTGTCCAAGG - Intronic
970809625 4:20077268-20077290 AAGGTTAAACAACTTATCCAAGG + Intergenic
971263784 4:25080311-25080333 GAGGTTAAAGAACTTACTCAAGG + Intergenic
971340147 4:25760920-25760942 GTGGTTAAACAACTTGCCCAAGG + Intronic
971358403 4:25914568-25914590 GAGGTTGAGCAACTTGTCCACGG - Intronic
972294899 4:37728285-37728307 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
972366553 4:38380996-38381018 GAGGTTAAGTAACTTGTTCAAGG + Intergenic
972388490 4:38590567-38590589 GAGATTAAATAACTTGCTCATGG - Intergenic
972428522 4:38958251-38958273 GAGGTTAAGAAACTTGTTCAAGG - Intergenic
972440441 4:39084340-39084362 GAGGTTACATGACTTGCTCCAGG - Intronic
972658632 4:41091879-41091901 GTGGTTAGAAAACTTGCTCAAGG - Intronic
972982731 4:44725916-44725938 GAAGTTACACAGCTAGTTAATGG + Intronic
972998249 4:44911038-44911060 GAGGTCACATAACTTGTAAATGG - Intergenic
973197967 4:47467212-47467234 GAGTTTATCCAACTTGTCCAAGG - Intergenic
973264344 4:48196364-48196386 GAGGTTAAGTAACTTGTTCAAGG - Intronic
973604661 4:52574664-52574686 GAAGTTAAATAACTTGTCCAAGG + Intergenic
973832370 4:54774454-54774476 GGAGTTAAACAACTTGCTCAAGG + Intergenic
974047775 4:56911664-56911686 GAGGTTAAACAACTTGTGCAAGG - Intronic
974102332 4:57430780-57430802 AAGGTTACATAACTTTTCCAAGG + Intergenic
974103683 4:57444018-57444040 GAGGTTAAACAATTTGCTCCAGG + Intergenic
974159669 4:58121785-58121807 AAGGTTACATAAGTTGTTCTAGG + Intergenic
974580165 4:63788157-63788179 GAGGTTGAAGAATTTGTTCAGGG - Intergenic
974828278 4:67156792-67156814 GAGGTTAAGCTACTTGTTCAAGG - Intergenic
974929958 4:68350246-68350268 TAGGTTACCCAGGTTGTTCATGG + Intergenic
975110694 4:70619862-70619884 GAAGTTAAATAAGTTGTTCAAGG - Intergenic
975211560 4:71706553-71706575 GAGGTCATATAACTTGTTCAAGG - Intergenic
975278843 4:72536633-72536655 AAGGTTAAATAACTTGCTCAAGG + Intronic
975382795 4:73721746-73721768 GAGGATATGCAGCTTGTTCAAGG - Intergenic
975724519 4:77278971-77278993 GAGGTTACAAAGCATGTTGAGGG + Intronic
975822487 4:78286105-78286127 GAGATTAAACAACTTGCCCATGG - Intronic
975919312 4:79365343-79365365 GAGGTTAAGTAACTTATTCAAGG - Intergenic
975924590 4:79433338-79433360 GAGGTCACATAATTTGTTTAGGG + Intergenic
976150442 4:82086090-82086112 CAGGTTGCATAATTTGTTCAAGG - Intergenic
976383409 4:84426965-84426987 GAGGTTAAGTAACTTGTTGAAGG - Intergenic
976580965 4:86736777-86736799 GAAGTTAAACACATTGTTCAAGG - Intronic
976644776 4:87375956-87375978 GAGGTTAAGTAACTTGGTCAAGG - Intronic
976659943 4:87530192-87530214 GAGGTTATATAACTTGTCCCGGG - Intronic
976804492 4:89031435-89031457 GAGGTTATATGACTTGTGCAAGG - Intronic
976899925 4:90160083-90160105 GAGATTACACAGCTTGTTGGGGG + Intronic
977094626 4:92724666-92724688 GAGGTTAAGTAACTTGTTCAAGG - Intronic
977864626 4:102009643-102009665 GGGGTTAAATAACTTGTCCAAGG - Intronic
977961531 4:103090585-103090607 GAGTTCAGACAACTTGCTCAAGG - Intronic
978179966 4:105782058-105782080 GAGGTTGCAGACCTTGTACAAGG - Intronic
978711840 4:111791724-111791746 GAGGTTAAATAACATGTACAAGG - Intergenic
979238058 4:118423935-118423957 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
979319997 4:119312077-119312099 GAGGTTATATAACTTGCCCAAGG - Intergenic
979341393 4:119528614-119528636 GAGATTGAACATCTTGTTCAGGG - Intronic
979474973 4:121144904-121144926 AAAGTTAAATAACTTGTTCAAGG + Intronic
979579244 4:122336543-122336565 GAGGTTACATAACTTTCCCATGG + Intronic
979785183 4:124708771-124708793 GAGGCTAAATAAATTGTTCAAGG - Intronic
980589939 4:134873249-134873271 GAGGTCACGTCACTTGTTCAAGG + Intergenic
980950443 4:139370703-139370725 GAGGTTAGACAAAGTGTCCAAGG - Intronic
981079976 4:140629997-140630019 GAGGTTAAGTAATTTGTTCAAGG + Intronic
981312562 4:143311509-143311531 GAAGTTAGATAACTTGCTCAGGG + Intergenic
981431517 4:144666825-144666847 GAGGTTAAACAACTTGCCCAAGG - Intronic
981591554 4:146369221-146369243 GAGGTTAGATAACATGTTTAGGG - Intronic
981714921 4:147743430-147743452 GAAGTTAAACAACTTGCCCAAGG - Intronic
981722439 4:147815234-147815256 CAGGTTACCCAACTTGCCCAAGG - Intronic
981887814 4:149698845-149698867 GATGTGATACAACTTGTTGAGGG - Intergenic
982032937 4:151318776-151318798 GAGGTTACGTAACTTGTCCAAGG + Intronic
982057460 4:151566873-151566895 GAGGTTAAATAACTTGCTTAAGG + Intronic
982156148 4:152522832-152522854 GAGGTTAAACAACTTGCCAAAGG + Intronic
982165167 4:152607611-152607633 GAGGTTAAGCAACTTGCTGAGGG - Intergenic
982314494 4:154018404-154018426 GAGGTTACAAAAATGGTACAAGG - Intergenic
982386227 4:154806319-154806341 AAGGTCACACAATTTGTTGATGG - Intronic
982749796 4:159146642-159146664 GAGGTGACCTAACTTGTTCAAGG + Intronic
982798839 4:159676984-159677006 GAGATTAAATAAGTTGTTCAAGG - Intergenic
982803338 4:159731839-159731861 GAGGTTAAATAACTTGTCCAGGG + Intergenic
982956793 4:161779561-161779583 GATGTGAAATAACTTGTTCAAGG + Intronic
983110322 4:163741947-163741969 GAGGTTGCACAACTTTGTGAAGG - Intronic
983549478 4:169001334-169001356 AAGGTTACACAGCTAGTTTATGG - Intronic
983573615 4:169236526-169236548 GAGGTTACATAACTTGTTTAAGG - Intronic
983961910 4:173764169-173764191 GAGGTTAAGTAACTTGTTCCAGG - Intergenic
983992308 4:174135409-174135431 GAGGTAAAATAATTTGTTCAAGG + Intergenic
984539055 4:181014300-181014322 GAGTTTAAACAACTTGTCCAAGG - Intergenic
984908689 4:184652033-184652055 GAGGTGACAGAACTTGATCTGGG + Exonic
985031264 4:185792911-185792933 GAAGTTAAACAACTTGCACAGGG - Intronic
986470670 5:8071225-8071247 GAGGTTAAGCAAGTTGTCCAAGG + Intergenic
986627620 5:9737348-9737370 GAAGTTAAATAACTTGTCCAAGG - Intergenic
986768936 5:10954181-10954203 GAGGTTTCATAACTTGTCTAAGG - Intergenic
987135524 5:14896390-14896412 GAGGTTAGGTAACTTGCTCAAGG - Intergenic
987711731 5:21509470-21509492 AAGATTAAACAACTTGTTGAGGG - Intergenic
988302683 5:29451346-29451368 GAGATTAAACAACTTGTTGAGGG + Intergenic
988437349 5:31192033-31192055 GAAGTTACATAACATGTCCAAGG - Intergenic
988901153 5:35733859-35733881 GAGGTTAAACAGCTTGTACAAGG - Intronic
988964745 5:36404584-36404606 GAAGTTACACAACTTGACCAAGG - Intergenic
989128348 5:38078935-38078957 GAGGTTAAGTAACTTGTTCATGG + Intergenic
989162227 5:38402338-38402360 GAGATTAAATAACTTGCTCAAGG - Intronic
989432363 5:41370834-41370856 GAGGTTTCACAATTCATTCAGGG - Intronic
990020858 5:51125713-51125735 GAGGTTAAATAACTTGTCCAAGG - Intergenic
990481522 5:56215707-56215729 GAGGTTACATAACTTGCCCAAGG - Intronic
991254550 5:64599806-64599828 GAAGTTAAACAACTTGTTCCAGG - Intronic
991412789 5:66361544-66361566 GAGGTTAAACAACTGGCTCTGGG + Intergenic
991497304 5:67239194-67239216 GAAATTAAACAACTTGTGCAAGG + Intergenic
991559603 5:67935616-67935638 CAGGTTATGTAACTTGTTCAAGG + Intergenic
991614117 5:68478333-68478355 GAGGTTAAATAACTTGTTCAGGG + Intergenic
991762097 5:69928596-69928618 AAGATTAAACAACTTGTTGAGGG - Intergenic
991785231 5:70189504-70189526 AAGATTAAACAACTTGTTGAGGG + Intergenic
991841325 5:70803645-70803667 AAGATTAAACAACTTGTTGAGGG - Intergenic
991877677 5:71189907-71189929 AAGATTAAACAACTTGTTGAGGG + Intergenic
992365962 5:76089799-76089821 GAGGTTAAGAAACTTGTTCATGG - Intronic
992548195 5:77836165-77836187 GAGGTGAAGCAACTTGTCCAGGG + Intronic
992661152 5:78962143-78962165 GAAGTTAAGTAACTTGTTCAAGG - Intronic
992668598 5:79036059-79036081 GTGGTTACATAACTTGCCCAAGG - Intronic
992739589 5:79759981-79760003 GAGGTTACATAGTTTGCTCAAGG + Intronic
992887528 5:81173630-81173652 GAGGTTAAGTAACTTGTTTAAGG - Intronic
992922944 5:81546224-81546246 AACTTTACACAACTTGTCCAAGG + Intronic
993110775 5:83654842-83654864 GAGGCTGCACAACTTGCCCAAGG - Intronic
993129667 5:83879621-83879643 GAGGCTACACAGCTTGACCAAGG - Intergenic
993225125 5:85159966-85159988 GAGGTTTAACAACTTGCCCAAGG + Intergenic
993564931 5:89462004-89462026 GAGACTCCACAACTTGATCAGGG + Intergenic
993568005 5:89499196-89499218 AAGGTTACACAACTGGTTTGTGG - Intergenic
993650925 5:90521158-90521180 GAGGTTAAACAACTTGCCCCAGG - Intronic
993661211 5:90637160-90637182 GAGGTTAAGTAACTTGCTCAAGG + Intronic
993992355 5:94674934-94674956 GAGTTTAAATAACTTATTCAAGG + Intronic
994176484 5:96717594-96717616 GAGGTTAAGCAACTTGCTCAAGG + Intronic
994759447 5:103834742-103834764 GAGGTTAAACAACTTGTCCATGG + Intergenic
994792773 5:104252019-104252041 GAAATTAAACAACATGTTCATGG - Intergenic
995007641 5:107219466-107219488 GAGGTTAAATAACTTTTCCAAGG - Intergenic
995132010 5:108640785-108640807 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
995876576 5:116796573-116796595 GAGGTTCCAAAACATGTCCATGG + Intergenic
996045414 5:118867540-118867562 GAGGTTAGGTAACTTGCTCAAGG - Intronic
996090819 5:119350004-119350026 GAGGTTACATGATTTGCTCAAGG - Intronic
996607952 5:125346009-125346031 GAGGTTAGGCAACTTGCCCAGGG + Intergenic
997195115 5:131974021-131974043 GAGGTTACATGACTTGCCCAGGG + Intronic
997404801 5:133636936-133636958 GAGGTTAGGCAACTTATTCATGG + Intergenic
997593982 5:135094199-135094221 GAGGTTAAACAACTTGCTTAAGG - Intronic
997619168 5:135273532-135273554 GAGGTTAAGCAAGTTGCTCAGGG - Intronic
997627391 5:135340199-135340221 GAGGTCACTCAACTTGTACTTGG - Intronic
997790079 5:136751099-136751121 GAGGTTACACAAAATGTGAAAGG + Intergenic
997803525 5:136890499-136890521 GAGGTTAAATAACTTGCCCAAGG - Intergenic
997883214 5:137609121-137609143 GAGGTTAAACAGCTTGCACAGGG - Intergenic
998077080 5:139245695-139245717 GAGGTTAAGTAACTTGTCCAAGG - Intronic
998371717 5:141666222-141666244 GAGGTTAAATAACTTGTCCAGGG + Intronic
998593108 5:143499005-143499027 GAGGTTACTTACTTTGTTCAAGG + Intergenic
998629799 5:143885360-143885382 GAGGTTAAACCATTTGTCCAAGG + Intergenic
998693014 5:144608354-144608376 GAGGTTAAAGGACTTGCTCAAGG - Intergenic
998769661 5:145527720-145527742 GAAGTTAAACAACTTGCTGAAGG - Intronic
998785889 5:145708349-145708371 GAGGTTAAGCAACTTGCTTAAGG - Intronic
998795151 5:145810841-145810863 GAAGTGACACAAATTGTACAAGG + Intronic
998882068 5:146654746-146654768 GAGGTTAAGCACCTTGTCCATGG + Intronic
998901327 5:146858160-146858182 GAGGTTAAATAACTTGCCCAAGG + Intronic
999060941 5:148634427-148634449 GAGGTTGAATAACTTGTTCAAGG - Intronic
999062941 5:148654576-148654598 GAGGCTAACCAACTTGTCCAAGG - Intronic
999197132 5:149790040-149790062 GAGGTTAGGCAACTTGCCCAAGG - Intronic
999272508 5:150304844-150304866 GAGGTGAAATAACTTGTGCAAGG - Intronic
999601771 5:153274226-153274248 GAGGTTACACTACTTGCCTAAGG - Intergenic
999828223 5:155294427-155294449 GAGGTTAAGTAACTTGTTCAAGG + Intergenic
1000039008 5:157471226-157471248 GAGGTTAAGCAACTTGGCCAGGG - Intronic
1000126975 5:158255033-158255055 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
1000298886 5:159937339-159937361 GAGTTTAAACAACTTGCCCAGGG + Intronic
1000322009 5:160141953-160141975 GAGGTTAAATAACTTGCTCAAGG + Intergenic
1000440567 5:161258458-161258480 GAGGTTCAGAAACTTGTTCAAGG - Intergenic
1000462060 5:161535596-161535618 GAGGTTAAATGATTTGTTCAAGG - Intronic
1000897051 5:166867912-166867934 AAGGTCACACAACTTGTAAATGG - Intergenic
1000917398 5:167099153-167099175 GAGGCTACATAACTTGGCCAGGG - Intergenic
1000942053 5:167373765-167373787 GAGGTTAAACACCATGTCCAAGG - Intronic
1001028248 5:168242516-168242538 GTGGTTACAAAACTTGCTCAAGG - Intronic
1001037419 5:168307475-168307497 GAGCTCACTCACCTTGTTCATGG - Intronic
1001044615 5:168362362-168362384 GAGTTTACATATCTTGTCCAAGG + Intronic
1001134873 5:169094258-169094280 GAAGTTAAACGACTTGTCCAAGG + Intronic
1001143698 5:169166040-169166062 GAGGTTAAATAACTTGCCCAAGG + Intronic
1001281564 5:170389800-170389822 GAGGTGCCATAACTTGCTCAGGG - Intronic
1001406606 5:171481475-171481497 GAGGTGACATGACTTGTCCAAGG + Intergenic
1001672307 5:173484094-173484116 GAGGTCACACAGCTTCTACATGG - Intergenic
1001971036 5:175955141-175955163 GAGGTTAGAGAACTTGTCCAGGG - Intronic
1002202775 5:177539836-177539858 GAAGTTAAATAACTTGCTCAAGG - Intronic
1002246406 5:177888636-177888658 GAGGTTAGAGAACTTGTCCAGGG + Intergenic
1002327085 5:178416703-178416725 GAGATTAAATAACTTGTCCAAGG + Intronic
1002738486 5:181415911-181415933 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1003020225 6:2503075-2503097 GAGCTTCAATAACTTGTTCAAGG + Intergenic
1003970857 6:11297812-11297834 GAGGGTTAATAACTTGTTCAAGG + Intronic
1004211127 6:13645615-13645637 AAGGTTAAATAACTTGCTCATGG + Intronic
1004289911 6:14357263-14357285 AGGGTTAAATAACTTGTTCAAGG + Intergenic
1004443802 6:15678971-15678993 GAGGTTAAGTAACTTGTTTAAGG + Intergenic
1004742958 6:18480754-18480776 AAGGTTACATAACTTGTCCAAGG - Intergenic
1004972052 6:20921475-20921497 GAGGTTACATGACTTGCTCCTGG + Intronic
1005604337 6:27460915-27460937 TAGTTTTCAGAACTTGTTCAAGG - Intronic
1006028129 6:31160306-31160328 GAGGTTAAGGAACTTGTCCAGGG + Intronic
1006231535 6:32591620-32591642 GAGTTTAAACAACTTTTGCAAGG + Intergenic
1006440902 6:34053189-34053211 GAAGTTAGATAACTTGTCCAAGG + Intronic
1006510904 6:34520522-34520544 GAAGTTAGATAACTTGTCCAAGG - Intronic
1006643313 6:35499388-35499410 GAGGTTAAGCAACTTGCCCACGG - Intronic
1006743586 6:36325934-36325956 GAGGTAAAACAATGTGTTCAAGG - Intronic
1006743826 6:36327403-36327425 GAGGTTAAGAAACTTATTCAAGG - Intronic
1006864644 6:37199578-37199600 GAGGTTAAGCAACTTATTCAAGG - Intergenic
1006901635 6:37506341-37506363 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1006928850 6:37675249-37675271 GAGGTTAAACAACTTTCCCAAGG - Intronic
1007529369 6:42527397-42527419 GAGGTTAAGTAACTTGTACAAGG + Intergenic
1007569499 6:42879398-42879420 GGGGTTAAATAACGTGTTCAAGG + Intergenic
1007758748 6:44119060-44119082 GAGGTTAAATAACTTGCCCAAGG + Intronic
1007766458 6:44163195-44163217 GAGGTCAAACAACTTGCCCAAGG + Intronic
1008515824 6:52318393-52318415 AAGGTTATACAGCTTCTTCAAGG + Intergenic
1008524337 6:52393143-52393165 GAGATTACATAACTTGTCCAAGG - Intronic
1008713241 6:54255281-54255303 GAGGTAGAATAACTTGTTCAAGG - Intronic
1008724846 6:54404915-54404937 AAGGTTAAATGACTTGTTCAAGG + Intergenic
1008937351 6:57006122-57006144 GTGGTTAAACAACTTGCACAAGG - Intronic
1008967022 6:57323001-57323023 GAAGTTATGTAACTTGTTCAGGG - Intronic
1009005968 6:57787216-57787238 AAGATTAAACAACTTGTTGAGGG + Intergenic
1009035433 6:58112231-58112253 GAAGTTAAATAATTTGTTCAAGG - Intergenic
1010418712 6:75646393-75646415 AAGGTTAATCAACTTGTCCATGG - Intronic
1010480591 6:76348102-76348124 CAGGCAACAAAACTTGTTCAGGG - Intergenic
1011056570 6:83210609-83210631 AAGGTTACACAAATTGTTTTAGG - Exonic
1011563027 6:88642685-88642707 GAGGTTAAATAACTTGCCCATGG - Intronic
1011718416 6:90130543-90130565 GAGGTTAGATAACTTGCTTATGG + Intronic
1011759950 6:90552909-90552931 GAGGTTAAATAACTTGCTTAAGG - Intronic
1011774947 6:90719391-90719413 GAGGTTAAACAACTTGTAAGTGG + Intergenic
1011969952 6:93210727-93210749 GAGATTACACAGATTCTTCAGGG + Intergenic
1012050726 6:94340489-94340511 GAGATTAAACAACTTGATGAAGG + Intergenic
1012177630 6:96108371-96108393 GAGGTTAAGCAATTTGTCCAAGG - Intronic
1012301787 6:97598419-97598441 GAGGTTAAGAAACTTGTCCAAGG - Intergenic
1012303890 6:97626095-97626117 GAAGTTAAATAACTTGCTCAAGG + Intergenic
1012592708 6:101002214-101002236 GAGGTTAATTAACTTGCTCAAGG + Intergenic
1013290610 6:108716052-108716074 GAGGTTACAAAACATGCCCAAGG - Intergenic
1013599127 6:111687855-111687877 CAGGTTAAGCAACTTGTTCAAGG + Intronic
1013864135 6:114674112-114674134 CAGGTTAAATAATTTGTTCAAGG - Intergenic
1013876071 6:114830367-114830389 GAGGTTAAGCAACCTGTCCAAGG + Intergenic
1014789437 6:125655491-125655513 GAGGTAACGTGACTTGTTCAAGG - Intergenic
1015081898 6:129237043-129237065 GTACTTACATAACTTGTTCAAGG - Intronic
1015166259 6:130203331-130203353 AAGGTTATATAACTTGTCCAAGG + Intronic
1015457868 6:133449630-133449652 GAGCTTAAGTAACTTGTTCAAGG - Intronic
1015906367 6:138121464-138121486 GAAGTTAAACAACATGTCCAAGG + Intergenic
1016090378 6:139970620-139970642 GAGGTTGCTTTACTTGTTCAAGG + Intergenic
1016806478 6:148217245-148217267 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1017215625 6:151902629-151902651 GAGGTTACGTATCTTGTTCAAGG - Intronic
1017452975 6:154571655-154571677 GAGGTTAAATGACTTGCTCAAGG - Intergenic
1017663349 6:156695376-156695398 GAGTTTAGGCAACCTGTTCAAGG - Intergenic
1019092687 6:169552559-169552581 GAGGTGAAATCACTTGTTCAAGG + Intronic
1019243589 6:170691463-170691485 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1020437721 7:8183610-8183632 AAGGTTAAATAACTTGCTCAGGG - Intronic
1020701999 7:11496451-11496473 AAGGTTACACAAGTTGATGATGG + Intronic
1020783538 7:12545666-12545688 GAGTTTACATAACTTGCCCAAGG + Intergenic
1021491554 7:21224770-21224792 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1021512086 7:21444480-21444502 GAGGTTAAATAATTTGCTCATGG + Intronic
1021554248 7:21903657-21903679 GAGGTTATACACCTATTTCATGG + Intronic
1021596959 7:22327654-22327676 GAAGTTAAATAACTTGTCCAAGG - Intronic
1021670789 7:23032994-23033016 GAAGTTAACCAACTTGATCAAGG + Intergenic
1022012121 7:26317367-26317389 GAGGTAAAGTAACTTGTTCAAGG - Intronic
1022012277 7:26318930-26318952 GAGGTTAAGTAACTTGTTCAAGG + Intronic
1022056276 7:26738174-26738196 GAGGTTAAGTGACTTGTTCAAGG - Intronic
1022194040 7:28046258-28046280 GAAGTTAAGCAACTTGCTCAAGG + Intronic
1022805402 7:33816130-33816152 GAGGTTACATAACTTGTCTAAGG - Intergenic
1022841386 7:34167303-34167325 AAGATTAAGCAACTTGTTCAAGG - Intergenic
1022884130 7:34624279-34624301 GAGATTAAATAATTTGTTCAAGG - Intergenic
1023006995 7:35881608-35881630 CATGTAACACAATTTGTTCAGGG + Intronic
1023013788 7:35945431-35945453 CATGTAACACAATTTGTTCAGGG + Intergenic
1023186097 7:37534714-37534736 GAGGTTAAATCACTTGTCCAAGG + Intergenic
1023254004 7:38294951-38294973 CAGGTCACACAGCTGGTTCATGG - Intergenic
1023411448 7:39892724-39892746 GAGGTTAAGCAACTAGTCCAAGG + Intergenic
1023454888 7:40327952-40327974 GAGTTTAGATAACTTGTGCAGGG + Intronic
1023901511 7:44484489-44484511 AAGGTTATACTGCTTGTTCAAGG + Intronic
1024067202 7:45749552-45749574 CATGTAACACAATTTGTTCAGGG - Intergenic
1024676138 7:51639339-51639361 GATGTTAAACAACTGGTACAAGG + Intergenic
1025249089 7:57339828-57339850 GAGGTTAAGTAACTTGTGCAAGG - Intergenic
1026198282 7:68191992-68192014 GAGGTTAAACAAATTGATCAAGG - Intergenic
1026374532 7:69737394-69737416 GAGGTTAGATAACTTGCTCAAGG + Intronic
1026418292 7:70206062-70206084 GAGGTTAAATAACTTGTTGTAGG + Intronic
1027251745 7:76403058-76403080 GAGATTAGACAACTTACTCAGGG + Intronic
1027414832 7:77963850-77963872 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1027422123 7:78027026-78027048 GAGGTTAAGGAACTTGTTCAAGG + Intronic
1027508327 7:79046619-79046641 GAGTTTACAAAACTTGTTCAAGG + Intronic
1027759470 7:82259821-82259843 GAGGTTAAGTAACTTGTTCAAGG - Intronic
1027759548 7:82260681-82260703 AAGGTTACATAACTTGCCCAAGG + Intronic
1028516693 7:91685259-91685281 GATGTTAGGCAACTTGTTTAAGG - Intergenic
1028551516 7:92072920-92072942 GAAGTTAAATAACTTGATCATGG + Intronic
1028845143 7:95471907-95471929 GAGGTTAAATAACTTGCCCAAGG + Intergenic
1028995817 7:97098759-97098781 GAGGTTAAACAACTAGCCCAAGG + Intergenic
1029050161 7:97678209-97678231 GAAGTTACTCAAATTGTTAAGGG - Intergenic
1029063118 7:97819280-97819302 GAGGTTAAATAACTTGTTCAAGG - Intergenic
1029199768 7:98831048-98831070 GAGGTTTAGTAACTTGTTCAAGG - Intergenic
1029371976 7:100156086-100156108 GAGGTTAAGTAACTTATTCAAGG + Intronic
1029581790 7:101441179-101441201 GAGGTTAAGCAACTTTGTCAAGG - Intronic
1029600903 7:101562974-101562996 GAGGTTACATAGCTTCCTCAAGG + Intergenic
1029790769 7:102840771-102840793 GAGGTAACATGACTTGTTCCTGG - Intronic
1029896848 7:103991593-103991615 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1029940310 7:104473618-104473640 GTGGTTATGTAACTTGTTCAAGG - Intronic
1030108055 7:106003542-106003564 CAGGTCAAACAATTTGTTCAAGG + Intronic
1030130638 7:106196595-106196617 GAGGTTAAGGAACTTGTCCAGGG + Intergenic
1030665937 7:112278644-112278666 AAGGTTAAATAACTTGGTCAGGG + Intronic
1030916418 7:115319766-115319788 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1031471042 7:122169632-122169654 GTGGTTACAAAATTTGTTCAGGG + Intergenic
1031678599 7:124642395-124642417 AAGGTTACATAACTTTTTGAGGG - Intergenic
1031883585 7:127222772-127222794 GAAGTTAAATAACTTGATCAAGG + Intronic
1032470431 7:132174656-132174678 GAGGGGACACAACTTGCCCAAGG - Intronic
1032536356 7:132667943-132667965 GAAGTAAATCAACTTGTTCAAGG + Intronic
1032642748 7:133787889-133787911 AAGGTTAAATAACTTATTCAAGG + Intronic
1032822492 7:135537023-135537045 GAGGTTAGGCAAGTTGCTCAAGG - Intergenic
1033314001 7:140283034-140283056 GAGGTGAAATTACTTGTTCAAGG + Intergenic
1033356000 7:140600966-140600988 GAGGTTAGATAACTTGTTTAAGG + Intronic
1033383011 7:140842239-140842261 AAGGTTACACAACTTGTAATTGG - Intronic
1033434492 7:141320797-141320819 GAGGTAAGATAACTTGCTCAAGG + Intronic
1033778285 7:144638677-144638699 GAGATTAAATAACTTGTCCAAGG + Intronic
1034029456 7:147743953-147743975 GAGATTACATAACTTGCCCAAGG - Intronic
1034095065 7:148400148-148400170 GAGGTTCAGCAACTTTTTCAAGG + Intronic
1034111921 7:148545373-148545395 GAGGTAAAGCAACTTGATCAAGG - Intergenic
1034213234 7:149383199-149383221 GAGGTTAGATAACTTGTTTAAGG + Intergenic
1034522344 7:151630550-151630572 GAGGTTAAGTAACTTGTCCAAGG + Intronic
1034932605 7:155174312-155174334 GAGGTTAGGTAACTTGCTCAAGG - Intergenic
1035193491 7:157194137-157194159 GGGGTAAAACAACTTTTTCATGG - Intronic
1035504533 8:116697-116719 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
1036166830 8:6443170-6443192 GAGGTCAAACAGCTTGTCCAAGG + Intronic
1037438336 8:18888440-18888462 GAGGTTAAATAACTTGCTCAAGG - Intronic
1037934141 8:22903268-22903290 TAGGTTAAGCAACTTGTCCAAGG - Intronic
1038219158 8:25591407-25591429 GAGGTTAAGTAACTTGTCCAGGG + Intergenic
1038445281 8:27599565-27599587 GAGGTTCCACAGCTTGGCCAAGG - Intronic
1038534676 8:28345318-28345340 GAGGTTCAATAACTTGCTCAAGG - Intergenic
1038619718 8:29129924-29129946 GAGGTTATTGAACTTGCTCAGGG + Intronic
1038672026 8:29590380-29590402 GAGCTTAAATAACTTGCTCATGG + Intergenic
1039340672 8:36646321-36646343 GAGGTTAGAAAACTCGTCCAGGG - Intergenic
1039438012 8:37574040-37574062 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1039561067 8:38513008-38513030 GAGGTTACATAACTTGCTTGGGG + Intronic
1039618458 8:38975253-38975275 GAGGTTGAATAACCTGTTCAAGG + Intronic
1039817446 8:41107021-41107043 GAGGTCAAACACCTTGTTGAAGG + Intergenic
1039904949 8:41779763-41779785 GAGGTTAAAAAACTTGCCCAAGG + Intronic
1040574642 8:48640854-48640876 GAGGTGGCACAATGTGTTCAGGG - Intergenic
1040760423 8:50835107-50835129 GAAATTAAACAACTTGTTCCTGG + Intergenic
1041010323 8:53535922-53535944 GATGTTAGGAAACTTGTTCAAGG - Intergenic
1041076387 8:54174069-54174091 GAGGTTAATAAACTTGCTCAAGG + Intergenic
1041492582 8:58451010-58451032 GGGGTAAAACAACTTTTTCATGG + Exonic
1042075636 8:64991677-64991699 GAGGTTAAATAACATGTCCAGGG - Intergenic
1042228671 8:66535568-66535590 GAGGTTCAATAACTTGCTCAAGG + Intergenic
1042404219 8:68385250-68385272 GAGGTTAAGAAACTTGTCCAAGG + Intronic
1042526192 8:69767448-69767470 GAGCTTAAGCAACTTGCTCAAGG - Intronic
1042834963 8:73071252-73071274 GAGGTGGAACAAGTTGTTCAAGG + Intronic
1043129580 8:76444304-76444326 GAGTTTATATAACCTGTTCAGGG - Intergenic
1043134461 8:76503760-76503782 GTGATTACACAATTTATTCAAGG - Intergenic
1043316521 8:78929024-78929046 GAGGTTAAATGACTTGTTCTGGG - Intergenic
1043337863 8:79199402-79199424 GAAGTTAAACAACTTTCTCAGGG + Intergenic
1043939529 8:86181087-86181109 GAGGTTAAGTAACTTGTTCAAGG - Intergenic
1044193467 8:89346826-89346848 GAGGTTAAACAACTTGTCCAAGG + Intergenic
1044359407 8:91264000-91264022 GAGGTTAAATAACTTGTATAAGG + Intronic
1044452062 8:92348114-92348136 GAGATTATATAACTTGCTCAAGG - Intergenic
1044617459 8:94156917-94156939 GAGGTTACATCATTTGGTCAAGG + Intronic
1044665237 8:94627996-94628018 GAGGTTAAATGACTTGTTCCAGG - Intergenic
1045008302 8:97935448-97935470 GAGGTTAAATAACTTGTCCAAGG + Intronic
1045234535 8:100339086-100339108 GAGGTTATGTGACTTGTTCAGGG + Intronic
1045294616 8:100862434-100862456 GAGGTTTAATAACTAGTTCAAGG + Intergenic
1045421778 8:102023563-102023585 GAGTTTACACAATTTGGTCAAGG - Intronic
1045651233 8:104343228-104343250 GAGGTTAAACAACTTGGTCAAGG - Intronic
1045754510 8:105526939-105526961 GAGATTAAATAACTTGTGCAAGG - Intronic
1046103483 8:109641478-109641500 GAGGTTAAGCAACTTGCTGAAGG + Intronic
1046313566 8:112470728-112470750 GAGATTACGTAACTTGTCCAAGG + Intronic
1046477003 8:114758587-114758609 GAGGTTATACAATGTGTCCAAGG + Intergenic
1046677856 8:117131895-117131917 GTGGTCAGGCAACTTGTTCAAGG + Intronic
1046719645 8:117605022-117605044 AAGGCTCCATAACTTGTTCATGG + Intergenic
1046859422 8:119073149-119073171 GAGGTAAAATAACTTGTTCTAGG + Intronic
1047093488 8:121598625-121598647 GAGCCTACATAACTTGCTCAGGG + Intergenic
1047119364 8:121883549-121883571 GAAGTTAGGCAACTTGTTCGAGG + Intergenic
1047143316 8:122167336-122167358 TAGGTTTCAGAACTTGTTCTGGG - Intergenic
1047224411 8:122944209-122944231 AAGGTCACACAGCTAGTTCATGG - Intronic
1047442824 8:124894008-124894030 AAGGTTACAGAACTAGCTCAAGG - Intergenic
1047502624 8:125453996-125454018 GAGGTTAAATAACTTGCCCACGG + Intergenic
1047515037 8:125546644-125546666 GAGGTTAAGCAACTTGCTCTAGG + Intergenic
1047521677 8:125599823-125599845 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1047526267 8:125637006-125637028 GAGGTTAAGAAACTTGTTCAAGG - Intergenic
1047696467 8:127408452-127408474 GAAGTTACATGACTTGTTCAAGG - Intergenic
1047777182 8:128082254-128082276 GAGGTTAAGTAACTTGTTCGGGG + Intergenic
1047800883 8:128308661-128308683 GTGGTTAATCAACTTGTCCAAGG + Intergenic
1047965269 8:130041791-130041813 GAGGTTACACAAGGTGCTGATGG + Intergenic
1048073869 8:131047606-131047628 ACGGTTACATAACTTGTTCAAGG - Intergenic
1048344351 8:133565789-133565811 GAGGTTAAACAACGTGCCCAAGG + Intronic
1048421030 8:134278536-134278558 GTGGTTAAATAACTTGCTCAAGG - Intergenic
1048432581 8:134384001-134384023 GAGGTTAAATGACTTGTCCAAGG - Intergenic
1048556849 8:135486536-135486558 GAGGTTAAATAACTTGCCCAGGG + Intronic
1048613672 8:136051251-136051273 GAGGTTAAACGACTTGTCTAAGG + Intergenic
1048660219 8:136591219-136591241 GAGGTTAAATAACTTTTTCAAGG - Intergenic
1049934358 9:486520-486542 GAGGTCACATAACTTCTCCAAGG + Intronic
1050110908 9:2214818-2214840 AGGGTTAAACAACTTGTCCAAGG + Intergenic
1050159251 9:2699997-2700019 GAGGTTACGCCACTTGTACTTGG + Intergenic
1050613721 9:7380129-7380151 GAGGGTAAAGAATTTGTTCAGGG + Intergenic
1051140443 9:13973234-13973256 GAATTTACATAACTTGCTCAAGG - Intergenic
1051237010 9:15011952-15011974 GGGGTTAAATAATTTGTTCAAGG - Intergenic
1051287140 9:15509493-15509515 AAGGTAAAACAACTTCTTCAAGG + Intronic
1051347784 9:16168191-16168213 AAGGTGAAACAACTTGCTCAGGG + Intergenic
1051709899 9:19920912-19920934 GAGATTAAATAACTTGCTCAGGG - Intergenic
1051857365 9:21584194-21584216 GAGGTTAAGCAACTTGCTCAAGG - Intergenic
1052180420 9:25519341-25519363 GAGGTTAGAGAATTTGTTCTTGG + Intergenic
1052625497 9:30971492-30971514 GAGGCTAAATAACTTGTCCATGG - Intergenic
1052930664 9:34052834-34052856 GAAGTGACACAGCTTGTACAGGG - Intergenic
1053050371 9:34956987-34957009 GAGGTTAAACAACTCGCCCAAGG - Intergenic
1053370713 9:37559434-37559456 GAGGTTAAGTGACTTGTTCAAGG - Intronic
1053380050 9:37641477-37641499 GAGGTTACATTAGTTGTCCAAGG + Intronic
1054704332 9:68447480-68447502 GAGGTTATATGACTTGTCCAAGG - Intronic
1054865332 9:69994485-69994507 GAGGCTAAACAACTTGATCATGG + Intergenic
1054924678 9:70577404-70577426 GAGGTTAAAGAACTTGTTGAAGG - Intronic
1055152136 9:73014256-73014278 GAGGTTACACAGCTTGTAAATGG - Intronic
1055642141 9:78327548-78327570 GAGGTTAAGTAACTTGCTCAGGG + Intronic
1055799766 9:80022260-80022282 GAGTTTACAGAAGTTGTTCAGGG + Intergenic
1055963391 9:81842235-81842257 GAGGTTAAGAAACTTGCTCAAGG + Intergenic
1056054837 9:82810691-82810713 GAGGTTACATAACTTTTTTGAGG + Intergenic
1056066730 9:82943273-82943295 GAGGTTAAGCAATTTGTCCAAGG + Intergenic
1056281398 9:85044529-85044551 GAGGTTAATTAACTTGTCCAGGG - Intergenic
1056408100 9:86296272-86296294 GAGGTCACACAACTAGTAAATGG + Intronic
1056411762 9:86335185-86335207 GAGATTAAATAACTTGCTCAAGG + Intronic
1056419048 9:86405894-86405916 CAGGTTCCAGAACTGGTTCACGG - Intergenic
1056453928 9:86742358-86742380 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1056718225 9:89051516-89051538 GAGTTTACAGAACTTGCTCAGGG + Intronic
1056786828 9:89598535-89598557 GAGGTTGAACAACTTGCTCAAGG - Intergenic
1056836011 9:89955808-89955830 GAGGTTAAGTAACTTGTTCGAGG + Intergenic
1056846574 9:90043090-90043112 TATGTTACACAACTTCTGCACGG - Intergenic
1057805371 9:98216103-98216125 GAGGTTAAGTAACTTGTCCAGGG - Intronic
1057810649 9:98254459-98254481 GAGGTTAAGTAACTTGTCCAGGG + Intronic
1057881004 9:98792554-98792576 GAGGATACACCAGTTCTTCAGGG - Intronic
1057954818 9:99399169-99399191 GAGGTTCAATAACTTGCTCAAGG - Intergenic
1058049836 9:100394389-100394411 GAGATTAAGTAACTTGTTCAAGG + Intergenic
1058067116 9:100561988-100562010 GAGGTTATGTAACTTGTTCAAGG + Intronic
1058430787 9:104917219-104917241 GAAGTTAAATAACTTGTTCATGG - Intronic
1058466030 9:105228829-105228851 GGGTTTACATAACTTGCTCAAGG + Intergenic
1058501311 9:105620592-105620614 GAGGTTAAATAACTTGCTCAAGG - Intronic
1058603403 9:106695724-106695746 AAGTTTAAATAACTTGTTCAAGG - Intergenic
1059143149 9:111873490-111873512 AAGGTGAAACCACTTGTTCAAGG + Intergenic
1059465805 9:114468105-114468127 GAGGTTAAGTAACTTGCTCAAGG - Intronic
1059471545 9:114508484-114508506 GGGGTCACACAACTAGTTAAAGG - Intergenic
1059560089 9:115325858-115325880 GAGGTTAAACAACTTACTCAAGG - Intronic
1059695640 9:116727768-116727790 GAGGTTAAATAACTTGCCCAAGG - Intronic
1059744696 9:117188696-117188718 GAGAATAAACAACTTGTTTAAGG + Intronic
1059813978 9:117891011-117891033 GAGGTGAGATAACTTGCTCAAGG + Intergenic
1060114202 9:120928168-120928190 GAGGCTAAGCGACTTGTTCAAGG + Exonic
1060262096 9:122084773-122084795 GAGGTAAAGCAACTTGTCCAGGG + Intronic
1060279676 9:122207394-122207416 GAGGTGACATGACTTGTCCAGGG - Intronic
1060648346 9:125302029-125302051 GAAGATACACAATTTGTTGATGG + Exonic
1060884014 9:127137860-127137882 GATATCAAACAACTTGTTCAAGG - Intronic
1060973250 9:127750983-127751005 GAGGTGAAGCAACTTGTTCAAGG + Intronic
1061187257 9:129061878-129061900 GAAGTTAAGCGACTTGTTCAGGG - Intronic
1061562014 9:131410599-131410621 AAGGTTAAATAACTAGTTCAAGG - Intronic
1061636475 9:131913343-131913365 AAGGTTCAATAACTTGTTCAAGG - Intronic
1061674104 9:132206009-132206031 CAGGTTAGACAACTTGCCCAGGG - Intronic
1203603778 Un_KI270748v1:40686-40708 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1187089360 X:16078890-16078912 GAGGTTAAGTAACTTGCTCAAGG + Intergenic
1187095089 X:16139775-16139797 GAGGTTAAGTAACTTGTTCACGG - Intronic
1187254372 X:17628755-17628777 GAGGTTAAACAACTTGCCCAAGG - Intronic
1187317021 X:18205992-18206014 GAGGTTAAGTAACTTGCTCAGGG - Intronic
1187378295 X:18777122-18777144 AAGGTTACATAACTTGCCCAAGG + Intronic
1187406057 X:19005047-19005069 GAGGTTAAGTAACTTGCTCAAGG + Intronic
1187410275 X:19045131-19045153 GAGGTTTAGAAACTTGTTCAAGG + Intronic
1187829803 X:23369515-23369537 GAGCTTAAATAACTTGTCCATGG - Intronic
1187963651 X:24589743-24589765 GTGGTTAGATATCTTGTTCAAGG + Intronic
1188058889 X:25576148-25576170 GAGGTAAAATAACTTCTTCAAGG + Intergenic
1188072851 X:25738210-25738232 GGGGTTACATAACTTGGTCAAGG + Intergenic
1188786399 X:34352008-34352030 GAGGTTAAATAACTTGCGCATGG + Intergenic
1189179275 X:38988001-38988023 GAGGTTACTTAACTTGCCCAGGG + Intergenic
1189211678 X:39289180-39289202 GAGGTTACACAATTGTTCCAAGG - Intergenic
1190433174 X:50397455-50397477 GAGGTTAAGTAACTTGTCCAGGG + Intronic
1190928375 X:54928406-54928428 GAGGTTAAGTAACTTGTCCAAGG + Intronic
1191031899 X:55982648-55982670 GAGGTTAGGCAACTTATTCAAGG - Intergenic
1191862188 X:65674903-65674925 GAAGTTAAATAACTTGTCCAAGG - Intronic
1192111212 X:68366916-68366938 GAGGTTAAGTAACTAGTTCAAGG + Intronic
1192149743 X:68704891-68704913 GAGGTTATGCAAGTTGCTCATGG + Intronic
1192185387 X:68943479-68943501 GAGGTTAAATGACTTGTCCAAGG + Intergenic
1192185701 X:68945467-68945489 GAGGTTAAGCAACTTGCCCAGGG + Intergenic
1192190148 X:68986055-68986077 GAGGTTAAATAACTTGCCCACGG - Intergenic
1192219425 X:69187204-69187226 GTGGTTACAGAACTTGCCCAAGG + Intergenic
1192262783 X:69517365-69517387 GAGTTTAAATAACTTGTCCAAGG - Intronic
1192306894 X:69970248-69970270 GAGGTTACATGACTTGGCCAAGG - Intronic
1192537382 X:71939665-71939687 GAGGTTAAGGAACTTGTCCAAGG - Intergenic
1192911549 X:75609801-75609823 GATGTTAAAGAATTTGTTCAAGG - Intergenic
1193085188 X:77442615-77442637 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1193257887 X:79370937-79370959 GAGGTTAGATAACTTGCTTAAGG + Intergenic
1193285166 X:79705143-79705165 GAGTTTACACAACTTTTTCATGG + Intergenic
1193432789 X:81431525-81431547 AAGGTTATACAACCTTTTCAAGG + Intergenic
1193686539 X:84583189-84583211 AAGGTTAACCCACTTGTTCAAGG + Intergenic
1194541891 X:95183407-95183429 TAGGTTAAACAGCTTGTTTAAGG + Intergenic
1194725770 X:97394954-97394976 GAGGTTAGATGAGTTGTTCAAGG - Intronic
1194745127 X:97619999-97620021 GAGGTTAAATAACTTGCTCAAGG - Intergenic
1194754486 X:97721993-97722015 GAGATTAAATAACTTGCTCAAGG + Intergenic
1194914913 X:99694277-99694299 GGGGTTACAAAACTTGCTCAAGG - Intergenic
1194949058 X:100103288-100103310 GAGGTTAAAAAATTTGTTCAAGG - Intergenic
1195080841 X:101368504-101368526 GATGTTATGCAACTTGCTCATGG - Intronic
1195471076 X:105230803-105230825 GAGGTTAAACAATTTGTCCAAGG + Intronic
1195475826 X:105284207-105284229 GAAGTTACACAACTTGCCCAAGG + Intronic
1195623053 X:106977664-106977686 AAGGTTACACAGCTTGTAAATGG + Intronic
1195797883 X:108671955-108671977 GAGGTTAAGAAACTTGCTCAGGG + Intronic
1195918205 X:109956539-109956561 AAGGTTACACAACTTGTATGTGG + Intergenic
1195956869 X:110340579-110340601 GAGGTTATATGATTTGTTCATGG - Intronic
1195958376 X:110359097-110359119 GATGTTAAATAACTTGTTCAAGG + Intronic
1196387318 X:115172317-115172339 GAAGTTAAATGACTTGTTCAAGG - Intronic
1196610563 X:117709792-117709814 AAGGTTAAACAACTTGCCCAAGG + Intergenic
1196677330 X:118433564-118433586 GAGGTTAAATAACTTGCCCAAGG - Intronic
1196813954 X:119650379-119650401 GAGGTTAAGTAACTTGTCCAAGG + Intronic
1196819167 X:119689315-119689337 GAGGTTCCATGACTTGTCCAAGG - Intronic
1196828124 X:119757136-119757158 GAGGTTAGGCTACTTGCTCAAGG - Intergenic
1197018984 X:121663394-121663416 GAGGTTAAATAACTTGTCCATGG + Intergenic
1197280031 X:124524378-124524400 AAGGTTAAATATCTTGTTCAGGG + Intronic
1197576866 X:128224182-128224204 GTGGTTACACATATTGTTTATGG + Intergenic
1197690763 X:129498681-129498703 GAAGTTAAACAACTTACTCAGGG + Intronic
1197742869 X:129909114-129909136 GAGGTCACATTACTTATTCAAGG + Intronic
1197884359 X:131202933-131202955 GAGGTTAAACAACTTACCCAAGG + Intergenic
1197948360 X:131865234-131865256 GAAGTTTCACACCATGTTCAAGG + Intergenic
1198408739 X:136343868-136343890 GAGGTTAAGCAACTAGTCCAAGG + Intronic
1198460882 X:136862072-136862094 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1198541784 X:137647814-137647836 GAGGTTAAATGACTTATTCAAGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1198670424 X:139074451-139074473 GAGGTGAAGCTACTTGTTCAAGG + Intronic
1198683836 X:139207106-139207128 GAGGTCACACAGCTGGTACATGG + Intronic
1198690023 X:139271557-139271579 GAGGTTAAGTAACTTGCTCATGG + Intergenic
1198762429 X:140046735-140046757 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1198912601 X:141631456-141631478 GAGGTTAAGGAACTTGCTCAGGG - Intronic
1198950495 X:142065853-142065875 GAAGTTAAATAACTTGTCCAAGG - Intergenic
1199195781 X:145028238-145028260 GAAATTACATAAGTTGTTCAAGG - Intergenic
1199505591 X:148557921-148557943 GAGGTTAAATAACTTGTCCAAGG + Intronic
1199793102 X:151173338-151173360 GAGGTGAAAGAACTTGTCCAAGG - Intergenic
1199820307 X:151439036-151439058 GGGGTTAAACAGCTTGTCCATGG + Intergenic
1199864166 X:151828033-151828055 GAGGTTAAATAACTTGTCCAAGG - Intergenic
1200305690 X:155024070-155024092 GAGGTTAGGCAACTTCTCCATGG + Intronic
1201428801 Y:13884411-13884433 GTGCTAACACAATTTGTTCAAGG + Intergenic
1201678449 Y:16615328-16615350 GAGTTCACACAACCTGTTCCAGG - Intergenic
1202385837 Y:24325731-24325753 GAGGTTAGTTAACTTATTCAAGG + Intergenic
1202484949 Y:25344397-25344419 GAGGTTAGTTAACTTATTCAAGG - Intergenic