ID: 920959765

View in Genome Browser
Species Human (GRCh38)
Location 1:210653972-210653994
Sequence TGTGATGGGAATAGTGTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920959765 Original CRISPR TGTGATGGGAATAGTGTGAC GGG Intronic
900741958 1:4335875-4335897 GGTAATGAGAATGGTGTGACAGG - Intergenic
904619967 1:31769417-31769439 TGTGATGGGGACAGTGTGTGGGG + Intergenic
905304033 1:37005338-37005360 TGTGATGGGAAACATGGGACTGG - Intronic
906934509 1:50200662-50200684 TCTGATGGGAATGGCTTGACTGG - Intronic
908360741 1:63366978-63367000 TGAGATGGAAATAGTGGAACTGG + Intergenic
908407457 1:63829381-63829403 GGTGATAGGGATAGTGTGATAGG + Intronic
908949857 1:69547170-69547192 TGTTATGGGATTATTATGACTGG + Intergenic
909478257 1:76106857-76106879 TGTCATGGGAAAAGTGTGCATGG + Intronic
909648459 1:77944204-77944226 TGTGATGGGAACAGTGTCTTAGG - Intronic
909925496 1:81433074-81433096 TGGGATGGGAAAGGAGTGACCGG - Intronic
912145797 1:106792673-106792695 TGTGCTGGGAACAGGGTTACAGG - Intergenic
915253230 1:154605521-154605543 TGTGTTGGGAATATTGAGAGTGG - Intronic
916356986 1:163922738-163922760 GGTGCTGGTAATACTGTGACTGG - Intergenic
917277833 1:173349571-173349593 TGTCATGGGAAAAGTGAAACTGG - Intergenic
918679607 1:187335624-187335646 TGTGATGAGAATAATGGGACTGG + Intergenic
919758681 1:201082846-201082868 TGTGATTGGAATAATCTGCCCGG + Intronic
920959755 1:210653884-210653906 TGACAGTGGAATAGTGTGACGGG + Intronic
920959761 1:210653944-210653966 TGACAGTGGAATAGTGTGACGGG + Intronic
920959763 1:210653958-210653980 TGTGACGGGAATAGTGTGATGGG + Intronic
920959765 1:210653972-210653994 TGTGATGGGAATAGTGTGACGGG + Intronic
920959767 1:210653986-210654008 TGTGACGGGAATAGTGTGATGGG + Intronic
920959775 1:210654073-210654095 TGTGACGGGAGTAGTGTGACAGG + Intronic
922857361 1:228786380-228786402 TGTGATGGGGAGAGTGAGATAGG - Intergenic
924335917 1:242986885-242986907 TGTGCTTGGAAAAGTCTGACTGG + Intergenic
1066128874 10:32370735-32370757 TGAAATGTGGATAGTGTGACTGG + Intronic
1067215187 10:44295397-44295419 TGTGATGTGTGTAGTGTGTCTGG - Intergenic
1068636652 10:59355610-59355632 TGTGATGAGAATATTGAGATAGG + Intronic
1068834529 10:61539340-61539362 AGTGATGGAAATAGTGAGGCAGG + Intergenic
1070362555 10:75705041-75705063 TGGGATGGGGAAAGTGTGATTGG + Intronic
1072680712 10:97504242-97504264 TGGGATGGAAATAGTCTGTCGGG - Intronic
1073594059 10:104783181-104783203 TGTGATGTGAATATTAAGACAGG + Intronic
1075383375 10:122037139-122037161 TGGTATAGGAATAGTGTAACAGG + Intronic
1075462436 10:122626085-122626107 GGTGAAGGGTATAGTGGGACAGG - Intronic
1076692558 10:132231135-132231157 GGTGATGGGATGCGTGTGACGGG - Intronic
1078151178 11:8760789-8760811 TGTAATGGGGATAGTGAGCCTGG + Intronic
1083945865 11:65922210-65922232 TGTGAAGGGATAAGTGGGACAGG + Intergenic
1084505961 11:69568172-69568194 TGTGATGGGCAAAGTCTGCCAGG - Intergenic
1086272213 11:85081233-85081255 AGACATGGGAATAGTGTGTCCGG + Intronic
1088135276 11:106549520-106549542 TTTTATGGGAATAGTTTTACAGG + Intergenic
1090349769 11:126100577-126100599 TGTGATGGCAAGAGTGAGATGGG - Intergenic
1092988650 12:13873558-13873580 GATGATGGTAATAGTGTGAGAGG - Intronic
1093343393 12:18007730-18007752 TGTGATGCCAATAGTGTGGGAGG + Intergenic
1096859572 12:54515321-54515343 TGTGGTGGCAATAGTGATACAGG + Intronic
1098212139 12:68177734-68177756 TTTGATCAAAATAGTGTGACTGG - Intergenic
1098673720 12:73263840-73263862 TAAGATGGGAAAAGAGTGACAGG - Intergenic
1098994032 12:77097555-77097577 TGTGATAAGCATAGTGTGAGTGG - Intergenic
1099885082 12:88519231-88519253 AGAGAAGGGACTAGTGTGACAGG + Intronic
1102969385 12:117154261-117154283 TGTGATGGGGATGGTGTAAGGGG - Intronic
1104897237 12:132170460-132170482 TGTGCTTGGAAAAATGTGACTGG - Intergenic
1105337615 13:19487946-19487968 TGTGATGGCAGTGGGGTGACAGG + Intronic
1106125422 13:26896892-26896914 TGTAATAGGAATAGTGTGTGTGG - Intergenic
1106283809 13:28301759-28301781 CATGATGGGAATAGGGAGACAGG - Exonic
1106863779 13:33940815-33940837 TATGATGGCAATAATGTGAGAGG - Intronic
1107064607 13:36199484-36199506 GGTGTTGGGAATAGTGCAACAGG + Intronic
1107254258 13:38404564-38404586 TCAGATGAGAATATTGTGACTGG - Intergenic
1108439697 13:50438360-50438382 TGGGGTGGGAATAGGGTGAGGGG + Intronic
1114893841 14:26960675-26960697 TGTGGTGGGAACAGTGCTACAGG + Intergenic
1114959509 14:27867467-27867489 TCTGATGGTAATAGTGGGATAGG + Intergenic
1115376782 14:32685312-32685334 TGTTATGGGAATACTGAGAAGGG + Intronic
1115732543 14:36286889-36286911 TGGGGTGGGAAGAGTGTGAGAGG - Intergenic
1118692447 14:68352920-68352942 TTTGATGGGAAAAGTGAGGCTGG + Intronic
1120043107 14:79776014-79776036 AGTGATGGGATGAGTGTGAGTGG + Intronic
1121578397 14:95007417-95007439 TGGGATGGGAATAGGGAGGCAGG + Intergenic
1125903109 15:43367404-43367426 TCTGAAGGGAAGAGTCTGACAGG - Intronic
1127145356 15:56017632-56017654 ATTGATGAGAATATTGTGACCGG - Intergenic
1132129717 15:99264670-99264692 TGGGATGGGCATAGTGGGAGGGG + Intronic
1134092754 16:11400203-11400225 TAAGATGGGAACAGAGTGACTGG - Intronic
1134352956 16:13454970-13454992 TGTGATTGCAATAGTGAGATTGG - Intergenic
1134355946 16:13482423-13482445 TGTTATGAGAAAAGGGTGACAGG - Intergenic
1134395356 16:13857693-13857715 TGTGATGGGAAAAGAGACACGGG + Intergenic
1135544154 16:23354554-23354576 TGTGGTGGGCTCAGTGTGACTGG + Intronic
1136369511 16:29827295-29827317 TGTGATGTGGAAAGTGTGCCAGG + Intronic
1139660325 16:68416390-68416412 TGTGGAGGGAAGAGTGGGACGGG - Intronic
1139949399 16:70661819-70661841 TGTGGTGGGAATAGAGTGAGGGG - Exonic
1149190769 17:54058596-54058618 TGGGATGGGAATAGACTGAAGGG + Intergenic
1150119359 17:62586995-62587017 TGAGATGGGCAAACTGTGACCGG - Intronic
1151455828 17:74225317-74225339 TGGGATGGGGAAAGTGTCACGGG + Intronic
1151504058 17:74514758-74514780 TGTGATGGTGATCATGTGACAGG + Intergenic
1152706231 17:81845041-81845063 TGTGATGGGAATGGTGCCATTGG - Intronic
1153365269 18:4248703-4248725 TGTGCTGAGAATAGTCTGAGAGG - Intronic
1153471421 18:5450472-5450494 GGTGAGGGGAAGAGTGTGAGGGG + Intronic
1157697587 18:49735383-49735405 TGTTATGGGATTAGTGTTTCAGG + Intergenic
1159984575 18:74826999-74827021 TGTGAAGGGATTACTGGGACAGG - Intronic
1160450489 18:78960806-78960828 TTTGAAGGGAATATTGTGACTGG + Intergenic
1162826385 19:13254928-13254950 AGTGGTGGGAACAGTGTGTCAGG + Intronic
1163359657 19:16837685-16837707 AGTGATGGGGACAGAGTGACTGG + Intronic
925530077 2:4849706-4849728 TGTCAAGGGAATACTGTGCCAGG - Intergenic
926041370 2:9675956-9675978 TGTGATGGGGAGTGTGTGAACGG - Intergenic
926045687 2:9708093-9708115 TATGATGGGAATAGTCTGGAAGG - Intergenic
927432254 2:23036684-23036706 TATGATAGGAACAGTGTGTCTGG - Intergenic
928047699 2:27953879-27953901 TGTGAGGGGAATAAAGAGACAGG + Intronic
931140715 2:59454730-59454752 GGTGATGGGAATAGCTTGAGAGG - Intergenic
934121375 2:88843362-88843384 AGTGATGGGAATAATGAGAAAGG - Intergenic
934919625 2:98332312-98332334 TGTGCTGGGAACAGTGGGAAGGG - Intronic
935460521 2:103327462-103327484 TGAAATGGGAAATGTGTGACTGG + Intergenic
939227300 2:139380057-139380079 TGAGATGGGAAGATTCTGACAGG - Intergenic
939696124 2:145327063-145327085 TGTGATGGGAACCATGTGGCAGG + Intergenic
943153362 2:184142374-184142396 AGTGATGGTAGTAGTATGACAGG + Intergenic
945578702 2:211565323-211565345 GGTGATGGGAATGGAGTGAAAGG + Intronic
945637047 2:212368419-212368441 TTTGAGGGGAAGAGTGAGACAGG + Intronic
946029334 2:216692458-216692480 TGTGATGTGGCTAGTGTGAAGGG - Intronic
946405199 2:219488695-219488717 AGTGATGGGGATGGTGGGACAGG + Intronic
946918518 2:224552116-224552138 TGTGATGGGAAAAGTCTTACAGG + Intronic
947394832 2:229676053-229676075 TGTGCTTGGAACAGTGTAACAGG - Intronic
947884037 2:233549412-233549434 TTTGATTGGTGTAGTGTGACTGG - Intronic
948787610 2:240360620-240360642 TGTGAGGGGAATAGGGTGAGAGG - Intergenic
1169591511 20:7147857-7147879 TATGATGGTGATAGTGGGACAGG + Intergenic
1169906765 20:10612369-10612391 TGTGCTGGGACTCGTGTGCCAGG + Intronic
1170442275 20:16391076-16391098 TGTGATGAGCATAGTGTGGGTGG + Intronic
1171444480 20:25194376-25194398 TGGGTTAGGAATAATGTGACTGG - Intergenic
1173148521 20:40545992-40546014 TGTCATGGGGATAGAGAGACAGG + Intergenic
1174098954 20:48112360-48112382 AGTGATGGGAAAAGTGTCACAGG - Intergenic
1179823258 21:43949520-43949542 TGTGGTGGGATTGGTGTCACAGG - Intronic
1180214094 21:46313895-46313917 TTTGGTGGGATTCGTGTGACTGG - Intronic
1181923726 22:26341341-26341363 TGAGAAGGGAAGAGTGTGATTGG - Intronic
1182617217 22:31595338-31595360 TGTGTTGGGCATTGTGTGATGGG + Intronic
1183533192 22:38375423-38375445 TGTGATGGCAGTGGGGTGACAGG + Intronic
1183701619 22:39454345-39454367 TGGGAGGGGAAAAGAGTGACAGG + Intergenic
1183750885 22:39719676-39719698 TGTGATGGGGATGGTGTGATGGG + Intergenic
1183885928 22:40882006-40882028 TGTGATGGTAATTGTTTGCCAGG - Exonic
1185347110 22:50315245-50315267 TGGGATGGGCACAGGGTGACGGG - Intronic
950404340 3:12795387-12795409 TGAAATGGAATTAGTGTGACTGG - Intergenic
951667130 3:25139448-25139470 TGTTAAGGGAATGTTGTGACTGG - Intergenic
952688636 3:36177666-36177688 AGAGATGTGAATAGTGTGACAGG - Intergenic
954248028 3:49347011-49347033 TGTGATGGTAATAGAATTACAGG - Intergenic
957382451 3:79449830-79449852 TGTGATGGCCATAGTGTGTCAGG + Intronic
958988381 3:100810847-100810869 TGTGATGGGATAAGTGTTAATGG + Intronic
962372936 3:134835725-134835747 TGTGAAGGGAATAGCCTGAGTGG + Intronic
964680423 3:159331902-159331924 TGAGGTGGGAATAGTGATACGGG - Intronic
965859059 3:173125117-173125139 TGGGATGGGAAGACTGAGACAGG - Intronic
966221164 3:177552672-177552694 TGTGAGGGGATTAGTTTGATTGG + Intergenic
970125910 4:12810893-12810915 TGTGGTGGGATTACTGTGCCTGG - Intergenic
970354753 4:15240592-15240614 GGTGCTGGGAATAGTGAGGCAGG - Intergenic
976591214 4:86851437-86851459 TCTGATGAGAATGGTGTGACGGG + Intergenic
978041699 4:104072176-104072198 TGTGAGGGTGATAGTTTGACAGG - Intergenic
979241213 4:118448399-118448421 TGTGCTTGGAAAAGTCTGACTGG - Intergenic
979861121 4:125695216-125695238 TGTTATGGGAAGAGTGCTACTGG + Intergenic
981942741 4:150302527-150302549 TGTTATGGTAAAAGTGAGACAGG - Intronic
983905903 4:173183251-173183273 TGTGAGAGGAATAGTGGGAGGGG - Intronic
985328405 4:188798295-188798317 TCTTATGGCAATACTGTGACTGG - Intergenic
989461217 5:41700629-41700651 TGTGTAGGGAATAGTGAGAGAGG + Intergenic
992006528 5:72483769-72483791 TGTGATGGGAATGATGGGCCTGG + Intronic
994052050 5:95373532-95373554 TGGGATGGGAATTGTGAGAGAGG - Intergenic
995009926 5:107245759-107245781 TGTGTTGGGAATAGACTGAAGGG + Intergenic
998189836 5:140014168-140014190 TGAGATGGGAAGAGTCTGAGTGG - Intronic
1001344536 5:170880604-170880626 TGAGTTGGGAATATTGTGATGGG + Intronic
1005102683 6:22190337-22190359 TCTGTTGGAAATAGTGGGACTGG + Intergenic
1005108505 6:22251975-22251997 TCTGATGGGAAAACTGAGACAGG + Intergenic
1008173764 6:48241015-48241037 TTTGATAGGAATAGTCTGGCAGG - Intergenic
1008335244 6:50296349-50296371 TGTGATGATAATAGTGAGAGCGG - Intergenic
1008665550 6:53712446-53712468 TATGAAGGGAACAGTGTGCCTGG + Intergenic
1009201437 6:60751437-60751459 TGTGCTAGTAGTAGTGTGACAGG + Intergenic
1009338575 6:62525473-62525495 TTAGATGGGAGAAGTGTGACAGG - Intergenic
1011638048 6:89393004-89393026 TGTAATGGCAGTACTGTGACTGG - Intronic
1012449983 6:99344749-99344771 TGTGATGGGAATTATTTGACTGG - Intronic
1012656332 6:101826431-101826453 TGTGATGGGGATGGTGGGAAAGG + Intronic
1015255800 6:131178428-131178450 TGTGATGGCAGTAGTGGGAATGG - Intronic
1018404031 6:163457945-163457967 TATGATGGGAATGGAGAGACAGG + Intronic
1019651094 7:2159031-2159053 TCTGCTGGGAAGAGTGTGAGTGG - Intronic
1020918224 7:14225640-14225662 AGTGATCGGAATATTGTGATGGG + Intronic
1021672880 7:23049909-23049931 TGTGATGGTAATTGTGTACCTGG - Intergenic
1021843876 7:24745393-24745415 TGGGAAGGGAATAATTTGACTGG - Intronic
1023797340 7:43804680-43804702 TGTTTTGGGAACAGTGTGACAGG - Intronic
1028492222 7:91425154-91425176 TGTGATGGGGTGAGTGTGAGGGG - Intergenic
1030266982 7:107630965-107630987 TGTGATAGGAATAATCTGAATGG + Intergenic
1030366632 7:108654231-108654253 TGTGGTGGGAATAGAATGAGGGG + Intergenic
1031514705 7:122687670-122687692 TGTGATAGGAATAGAGGGAGGGG - Intronic
1033004737 7:137549128-137549150 TGTGAAGGGAATAGGCTCACTGG + Intronic
1037361352 8:18077892-18077914 TGAGTTGGGAATACTGTGATGGG + Intronic
1039326775 8:36493868-36493890 TGTGATGTGCTTAGTGTAACTGG - Intergenic
1039839760 8:41285326-41285348 TGTGAAGGGAATAGTGCGTGGGG - Intronic
1040572640 8:48624219-48624241 TGGGGAGGGAATAGTGTGACTGG + Intergenic
1046356671 8:113095166-113095188 TGTGATTGGAATAGTTTTAAGGG - Intronic
1049301653 8:141873856-141873878 GGTGATGGGAATTGTGTGTAGGG + Intergenic
1052153323 9:25148305-25148327 TGTGATGGGATATTTGTGACTGG - Intergenic
1053173553 9:35907223-35907245 TCTGATGGGAAGCGTGTGGCTGG + Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1058846744 9:108968004-108968026 TGGGGTGGGCATAGTGTCACAGG + Intronic
1061096394 9:128459367-128459389 TGGGATGGAAATAGGGTGACAGG - Intronic
1062304941 9:135900360-135900382 AGTGATGGGACGAGAGTGACTGG + Intronic
1186703420 X:12116196-12116218 AGAGCTGGGAATAGTGAGACTGG - Intergenic
1190117315 X:47634774-47634796 TGTGACTGGGAGAGTGTGACAGG - Intergenic
1194456695 X:94113463-94113485 TGTGTTGGGCATAGTGTGTTGGG - Intergenic
1195292388 X:103441753-103441775 TGTGATGGGAAGGGTGGCACTGG - Intergenic
1196083882 X:111662864-111662886 TGTGATGTGAATATTCTGAGAGG + Intergenic
1197441504 X:126496075-126496097 TGTGATGGGAACAGTGTCTTAGG + Intergenic
1198812647 X:140551198-140551220 TGTGATGGGAATGATGGGAATGG + Intergenic
1200056374 X:153463545-153463567 TGTGCTGGGAACAGGGTGCCCGG - Intronic
1200829441 Y:7676924-7676946 TCTGGTGGGAGCAGTGTGACAGG - Intergenic
1202388928 Y:24350224-24350246 TGTGCTTGGAAAAGTCTGACTGG - Intergenic
1202481859 Y:25319900-25319922 TGTGCTTGGAAAAGTCTGACTGG + Intergenic