ID: 920964226

View in Genome Browser
Species Human (GRCh38)
Location 1:210688963-210688985
Sequence AAATATATGCCCCTGTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920964226 Original CRISPR AAATATATGCCCCTGTGGGC TGG (reversed) Intronic
904911564 1:33938087-33938109 AAATATAAGCCTCTGAGGGCTGG - Intronic
907518918 1:55010602-55010624 AAGGAGATGCCCCTGTGTGCTGG + Exonic
912035087 1:105302060-105302082 AATTAAATGCCTCTGTGGGTGGG + Intergenic
914851979 1:151321575-151321597 GAAAATATGCCTTTGTGGGCAGG + Intronic
918508235 1:185281259-185281281 CAATATATGCTTCTGTGGGCAGG - Intronic
918807181 1:189063628-189063650 TAATATATGCCTCTGTGTCCTGG + Intergenic
919929122 1:202209567-202209589 AGAAATATGCCACTGTGGCCTGG - Intronic
920964226 1:210688963-210688985 AAATATATGCCCCTGTGGGCTGG - Intronic
922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG + Intergenic
924568404 1:245217037-245217059 AAATATCCTTCCCTGTGGGCGGG - Intronic
1069932745 10:71893682-71893704 ACATAAAAGCCACTGTGGGCAGG + Intergenic
1070150650 10:73802851-73802873 AGAGACATGTCCCTGTGGGCAGG - Intronic
1072940829 10:99762147-99762169 AAAAAAAAGCCCCTGTAGGCTGG + Intergenic
1073506750 10:104001333-104001355 AAAAATATGAACATGTGGGCAGG - Intronic
1074720501 10:116260348-116260370 AAAAATATGCACATGTGAGCAGG + Intronic
1078394083 11:10963670-10963692 AAATATATGCTCCTATGGGATGG + Intergenic
1078445057 11:11397765-11397787 AAATATAAGCCCTTGTGGGCCGG - Intronic
1078534295 11:12160769-12160791 ATCCATCTGCCCCTGTGGGCGGG + Intronic
1081322727 11:41711469-41711491 AAATATATGCCCGTTTGCTCCGG - Intergenic
1082747758 11:56984734-56984756 AAATAGAGGCCCCTGTCAGCAGG - Intergenic
1082928556 11:58577086-58577108 AAAAAAAAGCCACTGTGGGCTGG - Intronic
1084931191 11:72557393-72557415 AAATATATGCACCAGTGAGCTGG + Intergenic
1085742985 11:79092739-79092761 AAACATCTGCCTCTGTGGCCTGG - Intronic
1086601186 11:88636186-88636208 AAATATTTTTCCCTGTGGTCAGG - Intronic
1087768334 11:102180325-102180347 AAATATATACTCCTGTGTTCAGG + Intronic
1088386156 11:109258703-109258725 AAATATAATCCCCAATGGGCTGG - Intergenic
1091437814 12:486529-486551 AAATAGTTTCCCCTGAGGGCAGG - Intronic
1092895988 12:13010762-13010784 AAAAGCATGCCACTGTGGGCAGG - Intergenic
1096276826 12:50216509-50216531 AAAGAAATGCCACAGTGGGCTGG - Intronic
1097268546 12:57759951-57759973 AAATATTTGGGCCTGTGGGCTGG + Exonic
1101283655 12:103286377-103286399 AAATAGATGCCCATGTAGTCAGG + Intronic
1101607665 12:106259810-106259832 AAATATTTGTCAGTGTGGGCCGG - Intronic
1103672920 12:122632984-122633006 AAAAATATCCCCAGGTGGGCCGG - Intergenic
1105012623 12:132765899-132765921 AAAAATATTTCACTGTGGGCCGG + Intergenic
1106385617 13:29282547-29282569 AAATAGATGCACTTGTGGGAGGG - Intronic
1107453979 13:40537404-40537426 AAATAAATGCCCCTGTAGGATGG + Intergenic
1109202376 13:59445131-59445153 TAATAATGGCCCCTGTGGGCTGG - Intergenic
1109234376 13:59797265-59797287 GAATATATGCCCATGAGGGCCGG + Intronic
1110056577 13:70981612-70981634 AAATAAATGATACTGTGGGCTGG - Intergenic
1111002141 13:82198289-82198311 AAATATATTCTCCTTTGGCCTGG - Intergenic
1121197641 14:92088364-92088386 AAATACATGCCCCTAACGGCTGG - Intronic
1122624581 14:103077872-103077894 AAATAAATGACCCTGGGGCCGGG - Intergenic
1122649445 14:103217898-103217920 AAACATCTGCTGCTGTGGGCTGG + Intergenic
1126740996 15:51775870-51775892 AAGAATTTGCCACTGTGGGCCGG - Intronic
1129981813 15:79879260-79879282 AAAACTTTGCCTCTGTGGGCAGG - Intronic
1133697132 16:8275457-8275479 TAATATATGCCACTGCCGGCTGG + Intergenic
1141882233 16:86867724-86867746 GAACATAAGCCCCTGAGGGCAGG + Intergenic
1142803587 17:2360044-2360066 AAAGATTTCCCCATGTGGGCCGG + Intronic
1143473585 17:7190944-7190966 AAAGAGGTGCCCCTGTGGGCGGG - Intronic
1144442624 17:15297572-15297594 AAATACCTGCACCTCTGGGCTGG + Intergenic
1147003997 17:37387110-37387132 AAATATATGCTCTTGGGGACGGG - Intronic
1150752288 17:67876011-67876033 AAATATCTGCCACTATGGTCTGG - Intronic
1152401687 17:80070297-80070319 AAAAATGTGCCCCCATGGGCGGG + Intronic
1152724365 17:81937788-81937810 AAATATATCACCATTTGGGCCGG + Intronic
1158938991 18:62389519-62389541 GAATAAATGTCCCAGTGGGCAGG + Exonic
1162615267 19:11795018-11795040 CAATATATTCCCATGTGGGGTGG + Intergenic
1165115439 19:33525400-33525422 AGATAGATGCCCAGGTGGGCTGG - Intergenic
1167416714 19:49377339-49377361 AAATAAAAGCCAATGTGGGCCGG - Intergenic
1168384135 19:55948732-55948754 AAAAATAGGCCCATATGGGCTGG - Intronic
925522399 2:4761720-4761742 CAATGTGTGCTCCTGTGGGCTGG + Intergenic
926020540 2:9491418-9491440 AAATTTATCCCTCTGTGGGCAGG + Intronic
928253980 2:29706185-29706207 GAATAATTGCCCCTTTGGGCAGG + Intronic
929465594 2:42141070-42141092 AAATATATGCCTGTGTGGCTGGG - Intergenic
931989640 2:67777041-67777063 GGAAATATGCCCCTGTGGCCTGG + Intergenic
932692778 2:73927248-73927270 ACAAATATGTTCCTGTGGGCGGG - Intronic
933041284 2:77470107-77470129 AAATATATGCCCCTGCTGGTCGG - Intronic
933307656 2:80621867-80621889 AAATAAATATCCCTGTGGCCTGG + Intronic
937278986 2:120704512-120704534 AACTCTACGCCCCTGAGGGCAGG + Intergenic
938993819 2:136656678-136656700 GATTATATGCCCATGAGGGCAGG + Intergenic
940297356 2:152141238-152141260 AAAAATGTGCGCCTTTGGGCCGG + Intronic
941954926 2:171194519-171194541 AAGTAAAAGCCACTGTGGGCTGG + Intronic
944213123 2:197227024-197227046 AACCATATCACCCTGTGGGCTGG + Intronic
946691758 2:222313449-222313471 AAATATATGTCTCTGGGGGCAGG + Intergenic
948638424 2:239356719-239356741 ACATTTATGCACCTGTTGGCAGG + Intronic
948660565 2:239503868-239503890 AGACATAGGCCCGTGTGGGCAGG - Intergenic
1168986061 20:2050060-2050082 AAAAAAAGGACCCTGTGGGCTGG - Intergenic
1170069648 20:12351659-12351681 AAATATATGCCTGTGTGTGTTGG + Intergenic
1173122610 20:40307484-40307506 AAATCTATGTCCCTGTGGGTGGG - Intergenic
1177191641 21:17858255-17858277 GAAAATATGCCCCTGTTAGCTGG + Intergenic
1181527755 22:23499913-23499935 AAACATATGCTTCTGTGAGCTGG + Intergenic
950721904 3:14889184-14889206 AAACATACGCCCCTGGGGGAGGG - Intronic
950976940 3:17256708-17256730 AAATCTAAGCCCCTGAGGGCAGG - Intronic
951141837 3:19171094-19171116 AAATATATGCCCCAAGGGGCCGG - Intronic
951193672 3:19800663-19800685 AAATATAAGCCCCAGTGTGATGG + Intergenic
951228870 3:20153306-20153328 AAGTTTATGCCTTTGTGGGCAGG - Exonic
952516529 3:34109973-34109995 AAACATAGGCCCCTGAGAGCTGG - Intergenic
954982089 3:54755288-54755310 AAATAAATGCTTCTGTGGGGGGG + Intronic
955915408 3:63903096-63903118 AAAAATAGGCACATGTGGGCCGG + Intronic
956551768 3:70468924-70468946 AAATACAGGTCCCTGTGGGTGGG - Intergenic
957787656 3:84903013-84903035 AAATAGATGCCCATGAGGACAGG - Intergenic
961538386 3:127583963-127583985 AAATAAAAGCACGTGTGGGCTGG - Intronic
963573825 3:147033527-147033549 AAATACATTCTCCTGAGGGCAGG - Intergenic
964298841 3:155264739-155264761 AAATATATACCACTGTGAGATGG + Intergenic
966039842 3:175469375-175469397 AAATATATTCCCCTGTGAAGGGG + Intronic
966917415 3:184592780-184592802 AAAGAGAGGCCCCTGTGGGCTGG - Intronic
967340115 3:188387859-188387881 AAAAATATTCACCTCTGGGCCGG - Intronic
968112418 3:196059769-196059791 AAATATTTGCCTATGTGGGGTGG - Intronic
972949807 4:44304824-44304846 AAATATATGCATTTGTTGGCAGG + Intronic
974108265 4:57495892-57495914 TAACATATGCCTCTGAGGGCAGG - Intergenic
981746149 4:148054360-148054382 TAACATCTGCCCCTCTGGGCCGG + Intronic
984160631 4:176248416-176248438 TAATATTTGCCAATGTGGGCTGG - Intronic
985027947 4:185758006-185758028 AAATATATGCACCTGTAATCTGG - Intronic
985043841 4:185919849-185919871 AAATATATGCCACTTCAGGCTGG - Intronic
985431103 4:189881281-189881303 TAATATCTGCCCCTGTGACCAGG + Intergenic
987827795 5:23055935-23055957 AAATATAGGACCATGTGGACCGG + Intergenic
988656086 5:33213410-33213432 GAGTATATACCACTGTGGGCTGG + Intergenic
991208442 5:64076846-64076868 TAAAATATGCCCCGGTTGGCTGG - Intergenic
991542518 5:67745635-67745657 AAATAGCTTCCCCTGAGGGCAGG - Intergenic
992669257 5:79042486-79042508 AAAGATTTGCCCTTGTGGTCAGG + Intronic
993144440 5:84075769-84075791 AGTAATAAGCCCCTGTGGGCCGG - Intronic
993606947 5:90002854-90002876 AATTTTATTCCACTGTGGGCTGG - Intergenic
995051939 5:107716908-107716930 AAATACTTTCCCCTGAGGGCAGG - Intergenic
995268371 5:110191814-110191836 AAAAATATGCCCCTGAGGCTGGG - Intergenic
995533027 5:113109790-113109812 AAAAATTTTCCCCTGTGGGTTGG + Intronic
996292479 5:121868236-121868258 GTATATATGCCCCTATGGACTGG + Intergenic
996809615 5:127501369-127501391 AAATATATGGCCCAGTGCGGTGG - Intergenic
1000063882 5:157678836-157678858 AAATATTTGGGCATGTGGGCCGG + Intronic
1004669171 6:17779566-17779588 AAATATATGCTACTTTAGGCCGG - Intronic
1006660735 6:35641706-35641728 AAAAATAAACCCCTTTGGGCCGG + Intronic
1006690877 6:35884027-35884049 AAAAATATAACCTTGTGGGCCGG - Intronic
1007007140 6:38375320-38375342 AAATATTTGACGCTGGGGGCAGG - Intronic
1013269720 6:108534573-108534595 GAATTTATGCCCCAGGGGGCAGG + Intergenic
1013872595 6:114784408-114784430 AAATCTAAGCCCCTGAGAGCAGG - Intergenic
1014656691 6:124114379-124114401 AAATATATGCAGGTGGGGGCAGG + Intronic
1015933818 6:138388475-138388497 AAATAAATTCTCCTGAGGGCAGG - Intergenic
1018319085 6:162587430-162587452 TAATAAATGCTACTGTGGGCTGG - Intronic
1021380599 7:19961352-19961374 AAATATATTCCCTTGAAGGCAGG - Intergenic
1021769309 7:23983011-23983033 AAAAATCTTCCCCTGTGGCCTGG - Intergenic
1025844943 7:65187626-65187648 AAAAATAAGCACTTGTGGGCCGG - Intergenic
1029666868 7:102001072-102001094 AAATATCTTCCCCTATGGCCAGG - Intronic
1032174935 7:129614970-129614992 AAATTTAAGCTCCTGTGGTCTGG + Intronic
1032918630 7:136520641-136520663 AAATATATACTACTGTTGGCCGG + Intergenic
1033517426 7:142121471-142121493 AAATATATGCATATATGGGCCGG - Intronic
1035353851 7:158265496-158265518 GGATATATGCACCTGTGGGTGGG - Intronic
1035653740 8:1289596-1289618 GAATATCTGTCCCTGGGGGCTGG + Intergenic
1039047772 8:33465769-33465791 AAAAATATGATCCTGTGGCCGGG - Intronic
1045836355 8:106526016-106526038 GAATATAAGCACCTGAGGGCTGG - Intronic
1048364452 8:133726627-133726649 AAAAATATGGCCATGTCGGCCGG + Intergenic
1051981386 9:23023728-23023750 AAATAGTTTCCCTTGTGGGCAGG + Intergenic
1052265322 9:26565320-26565342 AAACATCTGGCACTGTGGGCAGG - Intergenic
1053505455 9:38639225-38639247 AAATATATGGCACTGTGGACAGG - Intergenic
1059151070 9:111950199-111950221 AAAATTATGCCCCTCTAGGCCGG + Intergenic
1060329964 9:122659112-122659134 AAATATATGTCCCTAGTGGCTGG + Intergenic
1062012136 9:134272976-134272998 AACTATGGGCCCCTGTGTGCAGG + Intergenic
1186097211 X:6115448-6115470 AAAAATATGCCCCTGTTCTCAGG + Intronic
1189755967 X:44271636-44271658 AGATAGATGGCCCTGGGGGCAGG - Intronic
1190439216 X:50460523-50460545 AAATATTGGCCCCTGAGGACAGG - Intronic
1191583589 X:62793926-62793948 TAATATAGGCCTCTGGGGGCTGG + Intergenic
1193240156 X:79158736-79158758 AGAAATATGCCACTGTCGGCTGG - Intergenic
1194211832 X:91079946-91079968 AAGTATGTGCCCCTGTGGGATGG + Intergenic
1194820615 X:98502326-98502348 AAACATAGGCCACTGTTGGCCGG + Intergenic
1195300445 X:103524775-103524797 TAATAGAGACCCCTGTGGGCTGG - Intergenic
1196833530 X:119794582-119794604 ATACATATGCCCCTTGGGGCAGG - Intergenic
1197059486 X:122160332-122160354 AAAGATATTCCCCTATGGGTGGG - Intergenic
1197075572 X:122349379-122349401 AAATAGATGTCCTTGTGGGGTGG - Intergenic
1198662791 X:138989048-138989070 AAATATATGCCACAGTGAGTTGG + Intronic