ID: 920964413

View in Genome Browser
Species Human (GRCh38)
Location 1:210690283-210690305
Sequence TGCTGAGTGCTCTCAGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920964413_920964417 18 Left 920964413 1:210690283-210690305 CCACTGTCTGAGAGCACTCAGCA 0: 1
1: 0
2: 2
3: 24
4: 192
Right 920964417 1:210690324-210690346 GCTCCTTGCTAGTAGGAGCCAGG 0: 1
1: 0
2: 2
3: 6
4: 134
920964413_920964416 11 Left 920964413 1:210690283-210690305 CCACTGTCTGAGAGCACTCAGCA 0: 1
1: 0
2: 2
3: 24
4: 192
Right 920964416 1:210690317-210690339 CTGTATAGCTCCTTGCTAGTAGG 0: 1
1: 0
2: 0
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920964413 Original CRISPR TGCTGAGTGCTCTCAGACAG TGG (reversed) Intronic
900350920 1:2234156-2234178 TGCTGAGTCTTCTCAAGCAGGGG + Intronic
900486382 1:2924691-2924713 TGCAAAGGCCTCTCAGACAGGGG - Intergenic
901061142 1:6472463-6472485 AGCTGAGGGCTGTCAGAAAGAGG + Intronic
902862241 1:19254688-19254710 AGCTGAGTGCTCTCTGCCAAAGG + Intronic
903193132 1:21667927-21667949 TGCTGGGGGCTCTCAGAGTGAGG + Intronic
903770013 1:25757861-25757883 TACTGTGTGATCTCAGGCAGGGG + Intronic
905000769 1:34666964-34666986 TGCTGAGTGGTGTGAGACAATGG - Intergenic
907315941 1:53572676-53572698 TGCTGAGAGCTCTCAGAGAATGG + Intronic
910744579 1:90559400-90559422 AGCTGAGTGCTCTCAGATGTGGG - Intergenic
913221348 1:116663306-116663328 TGCAGGCTGCTCCCAGACAGAGG + Intronic
915247934 1:154569259-154569281 TGGTCAGTGGTCTCAGAGAGGGG + Intronic
915349325 1:155214653-155214675 TCCTGAGGGCTCCCAGAGAGTGG - Intergenic
915352511 1:155235280-155235302 TCCTGAGGGCTCCCAGAGAGTGG - Exonic
915872533 1:159576321-159576343 TGTAGAGTTCTCTCAGAAAGAGG + Intergenic
918070391 1:181129899-181129921 TGCTGAGTTCTTCCAGGCAGTGG + Intergenic
920126839 1:203700258-203700280 TGATGAGAGCTCTCTGACAGGGG + Exonic
920268436 1:204744429-204744451 TGCTGATTGGTCTCAGTGAGGGG - Intergenic
920964413 1:210690283-210690305 TGCTGAGTGCTCTCAGACAGTGG - Intronic
921539728 1:216398976-216398998 GGCTGACTCCTTTCAGACAGGGG - Intronic
924016531 1:239731291-239731313 GACTGAGAGCACTCAGACAGTGG + Intronic
924833582 1:247625746-247625768 TGGAGAATGCTCTCAGACATTGG - Intergenic
1062932045 10:1360007-1360029 TGCTCAGTGCTCTCCGCCAAAGG - Intronic
1062992874 10:1836606-1836628 TGCTGAGTCCTCCCAGACTGAGG - Intergenic
1063184639 10:3639610-3639632 TGCTGTGTGATCTGGGACAGTGG - Intergenic
1063574441 10:7249077-7249099 AGCTGTGTGCTCTTAGACACGGG - Intronic
1063883328 10:10552952-10552974 TGCTGTGTCCTCTCAGCAAGGGG + Intergenic
1064595921 10:16945146-16945168 TGTTGACTGCTCTCATTCAGTGG - Intronic
1067231965 10:44418315-44418337 AGCTGAGTGCTCAGAGCCAGTGG - Intergenic
1069759867 10:70801409-70801431 TGCTCAGTCCTCTCTGGCAGAGG - Intergenic
1069954674 10:72042711-72042733 TGCTGAGGACCCTCAGAGAGGGG - Intergenic
1070325712 10:75387703-75387725 TGCTGGGTGCTCCCAGAAGGTGG + Intergenic
1074904898 10:117852958-117852980 TGGTTAGTTCTTTCAGACAGGGG + Intergenic
1075217218 10:120546353-120546375 TGTTCAGTTCTCTCACACAGTGG + Intronic
1075586282 10:123660652-123660674 TTCTGAGTCCCTTCAGACAGTGG + Intergenic
1078483539 11:11701316-11701338 TCCACAGTGCCCTCAGACAGTGG + Intergenic
1078537613 11:12187541-12187563 TACTGAGTGGTCCCAGGCAGCGG + Intronic
1083260644 11:61521011-61521033 TGGTGAGTTCTCTCAGCCAGCGG + Intronic
1083661586 11:64254008-64254030 TGCTGAGAGCTCTGTGACAGTGG - Intronic
1085045800 11:73352741-73352763 TTCTGTGTGCACTCACACAGGGG + Intronic
1086030328 11:82346993-82347015 TGCTGAGAGGTCTAAGAAAGAGG + Intergenic
1088745167 11:112798875-112798897 TGGTGAGTGCTCCCAGAAAGGGG - Intergenic
1089579499 11:119472657-119472679 TGCTGAGGCCTCCCAGTCAGTGG + Intergenic
1089627785 11:119762520-119762542 TTCTGAGTGGTCTCAAGCAGGGG - Intergenic
1089751898 11:120657657-120657679 TGCTGATGGCTCACAGAGAGAGG + Intronic
1092095214 12:5836655-5836677 TGCTGACTGCACCCAGACACTGG + Intronic
1095813626 12:46397803-46397825 TGCCGAGTGCTTTAAGAAAGAGG + Intergenic
1096859389 12:54513066-54513088 TATTGAGTGATTTCAGACAGGGG + Intronic
1102930514 12:116858459-116858481 TGCTGCTTGCTCTCAGAGAGTGG - Exonic
1103184312 12:118943200-118943222 TGCTGTGTGCTCTCACACACAGG + Intergenic
1103737379 12:123069313-123069335 TTCTGAGGCCTCTCACACAGAGG - Intronic
1104838855 12:131810760-131810782 TGCTGGCTGCTTTCAGCCAGGGG - Intergenic
1104848195 12:131857720-131857742 TGCTGGGTGCTCTGGGGCAGTGG + Intergenic
1106399903 13:29419503-29419525 TGCTGAGTGTTCTCTGCCAGTGG - Intronic
1109877555 13:68426303-68426325 TGCCTAGTGGTCTCAGAGAGTGG + Intergenic
1111045740 13:82811478-82811500 TGCTCTGTGTTCTCAGAAAGAGG + Intergenic
1117027921 14:51640500-51640522 AGCTGATTGCTTTTAGACAGTGG - Intronic
1117809243 14:59529234-59529256 TGCTGAATGCTGCCAGCCAGTGG - Intronic
1119876450 14:78063747-78063769 TGCTTAAAGCTCTAAGACAGGGG + Intergenic
1121289814 14:92764838-92764860 GCCTGAGTGCTCTGAAACAGAGG - Intergenic
1121291383 14:92778660-92778682 GCCTGAGTGCTCTGAAACAGAGG + Intergenic
1124336516 15:28861349-28861371 GGCTGAGTGGTCTCAGGCAGCGG - Intergenic
1129333916 15:74841333-74841355 TGCTGAGTGAGCCCAGGCAGAGG + Intronic
1129604842 15:77019841-77019863 TGCCCAGAGCTCTCAGCCAGGGG + Intronic
1131636061 15:94234433-94234455 TGCTGAGTGTTCTCAGGGAGAGG - Intronic
1132720086 16:1311457-1311479 TGCTGAGTGCTTTGGGGCAGGGG + Intronic
1134694300 16:16211858-16211880 TGCTTAGTGCTTGCACACAGCGG - Intronic
1134977534 16:18582772-18582794 TGCTTAGTGCTTGCACACAGCGG + Intergenic
1138158991 16:54735730-54735752 TGCTGATGGCTATCAGAGAGGGG - Intergenic
1142196045 16:88739769-88739791 TGCTGTGTGGTCTCTGAGAGGGG - Intronic
1142557801 17:791373-791395 TGCTGGATGCTGTCAGAGAGAGG + Intronic
1143337858 17:6186954-6186976 TGCTGTGTCCTCTCATAGAGGGG - Intergenic
1145772752 17:27505235-27505257 TTCTGGGTGCTCCCAGACCGAGG + Intronic
1150493177 17:65588301-65588323 TGCTGAGTAATGTCAGACAAGGG + Intronic
1150505506 17:65694118-65694140 TGGGGCATGCTCTCAGACAGAGG + Intronic
1151338119 17:73452283-73452305 TGATGAGTGCTATCTGCCAGAGG - Intronic
1152274433 17:79347969-79347991 GCCTGAGTGATCTCAGAGAGCGG + Intronic
1152618439 17:81348610-81348632 TGCTGAGTGTACTCAGCCAAGGG - Intergenic
1155411930 18:25555970-25555992 TGCTTAGTGCTCTGGGACATAGG - Intergenic
1155633301 18:27921511-27921533 TTCTGAGTCCTCTCAGCCACAGG + Intergenic
1156478277 18:37420177-37420199 TGCTGCCTGCTATCAGACACTGG - Intronic
1157337903 18:46755026-46755048 TCCTGAGTGCTGTCTGACACTGG - Intronic
1157493199 18:48138031-48138053 TGCTGACTGTTCTCAGAAATGGG + Intronic
1158318764 18:56240687-56240709 TGCTGAGTGTTCCTAGATAGGGG + Intergenic
1158797410 18:60863734-60863756 TGCTGAGGCCTCTCAGATGGAGG - Intergenic
1159943611 18:74427116-74427138 TGGCGAGTGCTCACAGACAAAGG + Intergenic
1162790984 19:13062835-13062857 TACTGAGTGCTCTCTCACAGGGG + Intronic
1162790987 19:13062858-13062880 TATTGAGTGCTCTCTCACAGGGG + Intronic
1163237830 19:16039614-16039636 TGCTGGGTGACCTCAGGCAGGGG - Intergenic
1164196687 19:22972663-22972685 TATTGTGTGCTCTCAGGCAGAGG + Intergenic
1166045111 19:40225393-40225415 TTCTGGGTGCTCTGAGGCAGAGG - Intronic
1168522247 19:57061611-57061633 TGCAGAGAGCTCTCTGGCAGAGG + Intergenic
930294877 2:49542792-49542814 TGCTTAGTGCCCTCAAACATCGG - Intergenic
931246098 2:60493951-60493973 AGCTGAGTGGCCTCAGGCAGTGG + Intronic
932289866 2:70567721-70567743 TGCAGACTCCACTCAGACAGTGG + Intergenic
933532560 2:83529031-83529053 TTCTGTGTAGTCTCAGACAGAGG - Intergenic
936636212 2:114261559-114261581 TGCTCTGTGCTCTCAGAGTGAGG + Intergenic
938139894 2:128786920-128786942 TTCTCAGGGCTGTCAGACAGGGG + Intergenic
938763900 2:134447816-134447838 AGCTGAGTGGTCTCAGGCGGTGG - Intronic
939745506 2:145961317-145961339 TGGTGAGAGGTCTCAAACAGTGG + Intergenic
940114393 2:150192364-150192386 AGCTGAGTGCTCTTGCACAGCGG + Intergenic
941952084 2:171165951-171165973 TTCTGAGTACTCCCATACAGTGG + Intronic
943351769 2:186805361-186805383 TTCTCAGTGCTCTGAGACTGTGG + Intergenic
948194946 2:236088186-236088208 GTCTGAGTGTCCTCAGACAGTGG + Intronic
948459588 2:238122705-238122727 GGCTGAGGGCTCCCAGGCAGGGG + Intronic
1168853442 20:992453-992475 TGCTGAGCACTTTCAAACAGAGG + Intronic
1169491236 20:6072979-6073001 TATTGAGTGCTATCAGAAAGAGG - Intergenic
1170004840 20:11655463-11655485 TACTGAGTGTTCAGAGACAGAGG + Intergenic
1170893129 20:20392539-20392561 TTCTGAGTGTTCTAAGATAGGGG + Intronic
1171151176 20:22827629-22827651 GGCTGGGTGCTCTCTGCCAGTGG - Intergenic
1172213282 20:33215946-33215968 TGCTGTGAGCTCTGAGACAAAGG - Intergenic
1174076675 20:47942296-47942318 TGCTGAGGGTTCCCAGACACTGG + Intergenic
1175327515 20:58140120-58140142 GCCTGAGTGCTCGCAGCCAGGGG + Intergenic
1176066970 20:63202975-63202997 TGCTGAGGGCTCTGATACTGCGG + Exonic
1177853161 21:26372825-26372847 TCCTCAGTTCTCTCAGACAGTGG + Intergenic
1178899480 21:36587808-36587830 AGCTGATTTCTCCCAGACAGGGG - Intergenic
1179023859 21:37663403-37663425 AGCTGAGTGCTCTAAGACAGTGG - Intronic
1179993950 21:44965315-44965337 TGCTGAGTGTTCCCAGGCCGTGG + Intronic
1181330114 22:22084237-22084259 TGCTGGGTGCTTTTTGACAGTGG - Intergenic
1182933557 22:34197696-34197718 TAGTGAGTGCTCTCAGACAGTGG + Intergenic
1183688432 22:39375104-39375126 TGGTGGATGCTCTCAGTCAGGGG + Intronic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
1185286593 22:50002998-50003020 TGGGGAGTGTTCTCAGGCAGTGG + Intronic
949838722 3:8297371-8297393 GGCTGAGTTCTCTCTAACAGAGG - Intergenic
950440934 3:13009924-13009946 TGCTGATTGCTGTAAGGCAGTGG + Intronic
950764909 3:15266446-15266468 TGCTGAAAGAGCTCAGACAGAGG - Intronic
951116496 3:18869336-18869358 GGCAGACTGCTCTCAGACAAGGG + Intergenic
952964923 3:38615178-38615200 GTCTGAGTGATGTCAGACAGAGG + Intronic
953387840 3:42516674-42516696 TGCCCAGTGCTGTCAGAGAGGGG + Intronic
953786389 3:45914842-45914864 TGTTGGGTGGTCTCAGAAAGAGG - Intronic
954083317 3:48225000-48225022 AGCTGAGTACTCTTAGACAGTGG - Intronic
955214095 3:56970774-56970796 TCCTGAGTGCTGCCATACAGGGG + Intronic
956466486 3:69525262-69525284 TCCTGTGTGCTCTGAGAAAGGGG - Intronic
960273602 3:115701298-115701320 TGGTGAGTGATCTCACAGAGGGG - Intronic
963114026 3:141710538-141710560 TGCTAAATTCTCCCAGACAGAGG + Intergenic
964425602 3:156550507-156550529 TTCTGAGAGCTCTAAGACAGAGG - Intronic
964708821 3:159649201-159649223 TGCTGAGTGAACGCACACAGGGG - Intronic
966368471 3:179218285-179218307 TGCTCAGTGATTTCAGAGAGAGG - Exonic
966830868 3:184007392-184007414 TTCTTAGTGCTCTCAGGCAAAGG - Intronic
969415186 4:7053310-7053332 TGATGAATGCTTTCAGCCAGTGG + Intronic
972374647 4:38459130-38459152 TGCTAAGTGCTGTGATACAGTGG - Intergenic
972393553 4:38635821-38635843 TGCTGGGAGCTGTCAGACACTGG - Intergenic
973652862 4:53014164-53014186 TGCAGAGTGCTATGAGACAGAGG + Intronic
974852975 4:67426125-67426147 AGTTGAGTGCTCTTAGACAACGG - Intergenic
977492370 4:97731635-97731657 TGCTGGGTTCCCTCAGGCAGAGG + Intronic
978308797 4:107363230-107363252 TGATGAGTGCTCTCTGACGGGGG + Intergenic
983751171 4:171273176-171273198 TGCAGACTGCTCTGAGACACGGG - Intergenic
984756578 4:183330707-183330729 TGCTGAGAGCTGGCAGAGAGGGG + Intergenic
986976961 5:13405923-13405945 TGCAGACTGCTCTCAAACGGAGG + Intergenic
988990220 5:36663062-36663084 TGCTTAGTCCTATCAGACCGAGG + Intronic
989489431 5:42032948-42032970 TGATGAATGCTCTCAGACCTAGG + Intergenic
994236584 5:97369705-97369727 TGCTGAGGGCTCTGATACTGTGG - Intergenic
994703358 5:103166335-103166357 TGCTTATTCCTCTCAGACAAGGG + Intronic
995562450 5:113397243-113397265 TGGTGAGTGCTTTAAGACAGTGG - Intronic
996483070 5:123997554-123997576 TGCTAAATGCTCTCAGACTCCGG + Intergenic
997669274 5:135657031-135657053 TGCTGGGTGCTCCCAGAGGGTGG - Intergenic
999182082 5:149676801-149676823 TGCTGAAGGCTCTGAGACTGAGG - Intergenic
999562010 5:152813719-152813741 TGCTGAGTGGTCTTATAGAGAGG - Intergenic
1001165522 5:169362116-169362138 TGCTGAATGCTCTAGGTCAGAGG - Intergenic
1001962929 5:175891230-175891252 TGCTGAGTGCACGCATCCAGGGG - Intergenic
1002471632 5:179439147-179439169 TGCTGACTGGTCTCAGGCACTGG + Intergenic
1004256614 6:14070359-14070381 TGCTGAATTCTCTAAGGCAGAGG - Intergenic
1004804733 6:19190525-19190547 TGCAAATTGCTATCAGACAGGGG - Intergenic
1005679058 6:28187469-28187491 TCTTGAAGGCTCTCAGACAGAGG + Intergenic
1006560706 6:34909690-34909712 TGATGAGTGCTATGAAACAGAGG + Intronic
1012648286 6:101717364-101717386 TTCTGATTTCTCTCAGACATCGG + Intronic
1012714321 6:102649221-102649243 TGAGGAGTACTCTCAGACTGTGG - Intergenic
1013842017 6:114407791-114407813 TTCTGAATACTCTCAGAAAGGGG - Intergenic
1014249451 6:119100461-119100483 CCCTGAGAGCTCTCAGGCAGAGG + Intronic
1014461657 6:121703527-121703549 TCCTCAGAGCTGTCAGACAGGGG - Intergenic
1017594402 6:156013448-156013470 TACGAAGTGTTCTCAGACAGAGG + Intergenic
1018651712 6:165997860-165997882 TGGTGAGTGCACTAAGAGAGTGG + Intergenic
1018848267 6:167570251-167570273 AGTTGAGTGCACTGAGACAGAGG - Intergenic
1019183449 6:170207428-170207450 TGCTGAGTGGTCACAGCCTGGGG - Intergenic
1019266150 7:118547-118569 TGGTGGGTGCACTCAGCCAGTGG - Intergenic
1020509370 7:9034094-9034116 TGCAGAGTGTTCTCCCACAGAGG + Intergenic
1021555454 7:21913975-21913997 TGCTGATTGCTCTCTGGCACTGG + Intronic
1022508447 7:30921141-30921163 GGCTAAGTGCACTCACACAGGGG - Intronic
1023939250 7:44759498-44759520 TGCTGAGTGCTGTGGGACAGGGG + Intronic
1024587619 7:50855264-50855286 TTCTGAGTGCTCTGACACATGGG + Intergenic
1029261477 7:99305623-99305645 AGCTCAGTGGCCTCAGACAGGGG - Intergenic
1030768638 7:113443754-113443776 TAGTGAGTGCTCCAAGACAGGGG - Intergenic
1030991728 7:116309220-116309242 TGGTGACTGCTTTCATACAGAGG + Intronic
1031851348 7:126868084-126868106 AGCTGAGTGCTCTCAGGCACAGG + Intronic
1032935123 7:136720349-136720371 TGCTGAATGCACCCAGAGAGTGG - Intergenic
1034479336 7:151307731-151307753 TGCTCAGGGCCCTCAGGCAGGGG - Intergenic
1034808204 7:154106864-154106886 CGCTGAGTGCTTTCAAGCAGGGG + Intronic
1038292151 8:26259576-26259598 TTCTGTGAGCTCTGAGACAGTGG - Intergenic
1038622166 8:29154506-29154528 TGCTGGGTACTGTCAGAAAGTGG + Intronic
1039434040 8:37547410-37547432 TGCTGAAAGCTCTCAGCAAGGGG + Intergenic
1039773007 8:40707231-40707253 TGCTTAGTGCTGTCAGATGGGGG - Intronic
1041634722 8:60130190-60130212 TCTTGAGAGCTGTCAGACAGGGG + Intergenic
1042584321 8:70318459-70318481 TGCTCAGTGCTCTTAAAAAGTGG + Intronic
1043618359 8:82156478-82156500 TGCTGAGTGCTTTCAGCCTGAGG + Intergenic
1044509632 8:93059505-93059527 TGTTCTGGGCTCTCAGACAGAGG + Intergenic
1045015415 8:97997208-97997230 TGATGAGTGCTCTCAAAAATTGG + Intronic
1045895903 8:107216452-107216474 TGCTGAGTGCCCCCAGAAAGTGG + Intergenic
1045999550 8:108402798-108402820 TCCCCAGTGCTCTAAGACAGAGG + Intronic
1046044504 8:108947738-108947760 TCCTGATTGCTCTCAGAATGAGG - Intergenic
1047512539 8:125526692-125526714 TGCAGAATTCTCTCAGACTGAGG + Intergenic
1047956688 8:129981886-129981908 TGAGGAGTGCTCTGAGAGAGGGG - Intronic
1050828086 9:9974864-9974886 TGCTGAGTTCTTTCATTCAGTGG + Intronic
1052363932 9:27589937-27589959 TGCAGGGTGCCCTCAGGCAGAGG - Intergenic
1055432351 9:76257117-76257139 TGCTAAGTGCTGTGACACAGTGG - Intronic
1059061033 9:111036166-111036188 TGCTGAGTGCCCACAGACCTGGG + Intronic
1061074022 9:128329869-128329891 TGCTGAGTACTCAGAGGCAGTGG + Intronic
1061996859 9:134190564-134190586 TGCTGAGGCCTCTCTGAGAGCGG + Intergenic
1062173401 9:135147824-135147846 TGCTGAGTGCTCACTGACTGAGG + Intergenic
1186290185 X:8088956-8088978 TGCTGAGGGCTCTTAAACTGGGG - Intergenic
1188751681 X:33912495-33912517 TGGCAAGTGCTCTCAGACAGGGG - Intergenic
1188941375 X:36241700-36241722 TTCTCAGTGCTCTAAGACTGGGG - Intronic
1192152404 X:68720364-68720386 TGCTGAATGCTCTGTGGCAGTGG - Exonic
1192442261 X:71183265-71183287 TGCAAAGTGCTCTCAGACTCAGG + Intergenic
1193050057 X:77089884-77089906 TCCTCAAAGCTCTCAGACAGGGG - Intergenic
1193086736 X:77453742-77453764 TGCTGCGTGCTCTAAGGAAGAGG + Intronic
1194911890 X:99655808-99655830 TTCTCACTGCTCTCAGAGAGAGG + Intergenic
1195685407 X:107580516-107580538 TGGTGACTCCTCTCAGGCAGAGG - Intronic
1196093934 X:111777987-111778009 TGCTAAGTGCTCTGGTACAGTGG - Intronic
1196108861 X:111924977-111924999 TGCTGATTGCTGTCACATAGAGG + Intronic
1201944783 Y:19500010-19500032 AGCTGAGTGCCCTCAGAGAAGGG + Intergenic