ID: 920964810

View in Genome Browser
Species Human (GRCh38)
Location 1:210692962-210692984
Sequence CTCCGTTAGGGGAGGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 278}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920964810_920964820 10 Left 920964810 1:210692962-210692984 CCTGTCTCCCTCCCCTAACGGAG 0: 1
1: 0
2: 0
3: 14
4: 278
Right 920964820 1:210692995-210693017 CAGCCCTGCCCTTTGCGCTCAGG 0: 1
1: 0
2: 1
3: 25
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920964810 Original CRISPR CTCCGTTAGGGGAGGGAGAC AGG (reversed) Intronic
902029617 1:13412407-13412429 ATCCTTGAGGGGAGGGAGAAAGG - Intronic
903100224 1:21023472-21023494 CGCGGTTAGGGGCTGGAGACTGG - Intronic
903147908 1:21387238-21387260 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
903443486 1:23405727-23405749 ATGCATTAGGGGAGGGAGCCAGG + Intronic
903601546 1:24545591-24545613 CTCCTTTGGGGGAAGGAGCCTGG - Intergenic
904077205 1:27852351-27852373 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
904113277 1:28143463-28143485 CTCTGTAAGGGGAGGGACAGAGG - Intergenic
905028765 1:34867881-34867903 CTCTGATACGGGAGGGAGAAAGG - Intronic
905358962 1:37405039-37405061 CTGCCTTAGGGTAGGGAGAGGGG + Intergenic
905458447 1:38104747-38104769 ATCAGTTAGGAGAGGGAGATGGG + Intergenic
905699196 1:39999257-39999279 CTCGGTTAGGGGCTGGAGACCGG - Intergenic
905860795 1:41349882-41349904 CTCCGTGTGGGGAGGGGGTCAGG - Intergenic
907089769 1:51712194-51712216 CGCGGTTAGGGGCTGGAGACCGG + Intronic
907736966 1:57122950-57122972 CTCCATTATGGGATGGAGAGGGG - Intronic
910343645 1:86215316-86215338 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
911164721 1:94714365-94714387 CTCCCTCAGCAGAGGGAGACTGG - Intergenic
912316849 1:108675284-108675306 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
913306353 1:117430991-117431013 CGCGGTTAGGGGCTGGAGACCGG + Intronic
915364423 1:155306426-155306448 CTCAGTGTGGGGATGGAGACAGG + Intergenic
917082310 1:171268675-171268697 CTCTGACAGGGGAGGGAGAAAGG - Intronic
917376229 1:174350872-174350894 CGCGGTTAGGGGCTGGAGACCGG + Intronic
918228914 1:182510460-182510482 CGCGGTTAGGGGCTGGAGACCGG + Intronic
920858774 1:209687622-209687644 GTCAGTGATGGGAGGGAGACTGG + Intronic
920964810 1:210692962-210692984 CTCCGTTAGGGGAGGGAGACAGG - Intronic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
923649838 1:235864178-235864200 CTGCAGTAGGGGAGGGAGACTGG - Intronic
923710646 1:236386127-236386149 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1064653962 10:17538065-17538087 CTCCATTGGAGGAGGGATACGGG - Intergenic
1064663734 10:17629892-17629914 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1065594541 10:27297275-27297297 CGCGGTTAGGGGCTGGAGACTGG + Intergenic
1067353187 10:45495772-45495794 CTAGGGGAGGGGAGGGAGACAGG + Intronic
1067575119 10:47404042-47404064 CTTCTCTATGGGAGGGAGACAGG + Intergenic
1067582182 10:47452762-47452784 GGCCGGTGGGGGAGGGAGACAGG - Intergenic
1069741588 10:70688649-70688671 CGCGGTTAGGGGCTGGAGACTGG + Intronic
1070531295 10:77339615-77339637 CTCCACTAGGGGAGGGTTACTGG + Intronic
1072740295 10:97905084-97905106 ATGGGTTGGGGGAGGGAGACTGG + Intronic
1072956347 10:99891387-99891409 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1073072189 10:100801690-100801712 CTCCATTTGGGGAGGGTGCCAGG + Intronic
1073385914 10:103128279-103128301 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1074721669 10:116270773-116270795 CTGCCTTCGGGGAGGGACACGGG + Intronic
1075128676 10:119721561-119721583 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1075275544 10:121089564-121089586 CTCCTTCAGGAGAGGAAGACTGG + Intergenic
1075636614 10:124034812-124034834 CCCCGTTAGGGGGCGGAGCCGGG - Intronic
1075636729 10:124035132-124035154 CCCCGTTAGGGGGCGGAGCCGGG - Intronic
1075636741 10:124035157-124035179 CCCCGTTAGGGGGCGGAGCCGGG - Intronic
1075636820 10:124035378-124035400 CTCTGTTAGGGGGCGGAGCCAGG - Intronic
1077397408 11:2331961-2331983 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1081086344 11:38806289-38806311 CTCTGGTAGGGGAGAGAGGCAGG - Intergenic
1081288528 11:41303301-41303323 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1081627191 11:44663145-44663167 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1083028589 11:59571623-59571645 ATCCCTCAGGGGAAGGAGACAGG - Intergenic
1083145223 11:60753062-60753084 CTCGGTGGGGGGAGGGAGAAGGG - Intergenic
1083382153 11:62278134-62278156 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1083646337 11:64173239-64173261 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1083831914 11:65238832-65238854 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1084048784 11:66587200-66587222 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1085513523 11:77099511-77099533 CGCGGTTAGGGGCTGGAGACCGG + Intronic
1086647704 11:89245586-89245608 CTCAGTTGGGGCAGGCAGACAGG + Intronic
1087057508 11:93948028-93948050 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1087198458 11:95321858-95321880 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1089307585 11:117536294-117536316 CGCTGTTTGGGGATGGAGACGGG + Intronic
1089375857 11:117994169-117994191 CTCAGCATGGGGAGGGAGACTGG + Intronic
1089585781 11:119508664-119508686 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1090172044 11:124613647-124613669 CTCTGTTAGGGGAGGGAAAGAGG + Intronic
1090322768 11:125862422-125862444 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1090791303 11:130092503-130092525 CGCGGTTAGGGGCTGGAGACCGG + Intronic
1092590828 12:9952389-9952411 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1093152758 12:15642868-15642890 CTCCATTGGAGGAGGGAGACAGG + Intronic
1094805971 12:34092670-34092692 CTCCTTTAGTGGATGGAGCCAGG + Intergenic
1095068964 12:37815700-37815722 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1095124659 12:38462650-38462672 CTCCTTTAGTGGATGGAGCCAGG + Intergenic
1096421712 12:51464369-51464391 CTCCCTTAGGGTAGGAAGATAGG + Intronic
1097028671 12:56076518-56076540 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1100581879 12:95946829-95946851 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1101092117 12:101297951-101297973 CTCCGTTGGGGGTGGCAGAGGGG - Intronic
1102175139 12:110868513-110868535 CGCGGTTAGGGGCTGGAGACCGG + Intronic
1102294345 12:111724586-111724608 CGCGGTTAGGGGCTGGAGACCGG + Intronic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103300025 12:119919517-119919539 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1103591125 12:121993181-121993203 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1103875630 12:124125035-124125057 GTGCTTTTGGGGAGGGAGACAGG + Intronic
1105257432 13:18753343-18753365 CTCCCTTAGCTGAGGGAGCCAGG + Intergenic
1105367558 13:19778585-19778607 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1105555816 13:21447496-21447518 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1106879281 13:34111932-34111954 CTCCTTTAGGGTAGGCAGAGAGG - Intergenic
1106918440 13:34540047-34540069 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1107692336 13:42965997-42966019 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1107953490 13:45486093-45486115 CGCGGTTAGGGGCTGGAGACCGG + Intronic
1108351183 13:49592355-49592377 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1108736287 13:53286461-53286483 CTCCTTTGAGGGAGGGAGAGAGG + Intergenic
1119924310 14:78477855-78477877 CACCATTAGGGTAGGGAAACAGG + Intronic
1120378561 14:83742781-83742803 GTCCTTTAACGGAGGGAGACAGG + Intergenic
1121124439 14:91397110-91397132 CACCAATAGGGGAGGGAGAGGGG + Intronic
1121306934 14:92912474-92912496 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1124245677 15:28069616-28069638 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1125868357 15:43076194-43076216 CGCGGTTAGGGGCTGGAGACTGG - Intronic
1127072765 15:55302287-55302309 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1128785809 15:70396052-70396074 CTCTATTAGCAGAGGGAGACGGG + Intergenic
1130407462 15:83614522-83614544 CTTCCTTAGGGGAAGGAGAGGGG + Intronic
1131001552 15:88942492-88942514 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1131071682 15:89470141-89470163 CTCTGCTGGGGGAGGGAGGCTGG + Intergenic
1131094648 15:89647710-89647732 CTCCTATAGGGCAGGGAGAGGGG + Exonic
1131127034 15:89867226-89867248 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1131938035 15:97528813-97528835 CTCCTTTAGGGGAAGATGACGGG - Intergenic
1132343510 15:101092753-101092775 CTCAGTGAGAGGAGGGAGACAGG + Intergenic
1132992385 16:2802663-2802685 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1133769027 16:8857021-8857043 CTCCTTTGGGGGAGGTGGACTGG - Intronic
1133858102 16:9568375-9568397 CTCCTTTAGGGGAGGAACATGGG + Intergenic
1134490736 16:14693871-14693893 GCCGGTTAGGGGAGGGAGCCAGG + Intronic
1134496117 16:14732989-14733011 GCCGGTTAGGGGAGGGAGCCAGG + Intronic
1136154689 16:28374841-28374863 GCCGGTTAGGGGAGGGAGCCAGG - Intergenic
1136160419 16:28416060-28416082 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1136202676 16:28699254-28699276 CGCGGTTAGGGGCTGGAGACCGG + Intronic
1136208403 16:28740417-28740439 GCCGGTTAGGGGAGGGAGCCAGG + Intergenic
1136264492 16:29107093-29107115 GCCGGTTAGGGGAGGGAGCCAGG + Intergenic
1137932770 16:52604340-52604362 CTCCATTTGGGGAGGGGAACAGG - Intergenic
1138400706 16:56740807-56740829 CGCGGTTAGGGGCTGGAGACCGG + Intronic
1139885308 16:70204076-70204098 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1140051398 16:71484483-71484505 CTGCCTCAGTGGAGGGAGACAGG - Intronic
1140710328 16:77671633-77671655 CTCCCTTAGGGAAGGAAGAGGGG + Intergenic
1141635987 16:85314154-85314176 CTGCCTCAGGGGAGGGAGGCTGG - Intergenic
1142024704 16:87806248-87806270 CTCCGTGTGGGGAGGGAGTGGGG - Intergenic
1145047424 17:19628675-19628697 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1145862682 17:28223280-28223302 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1146688899 17:34859637-34859659 CTCAGTTGTGGGAGGGGGACAGG - Intergenic
1147360547 17:39927248-39927270 CTCGGCTAGGGGTGGGAGGCGGG - Intronic
1147784931 17:42972536-42972558 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1152030256 17:77837929-77837951 CTCTGTTAGGGGAGGTACAAAGG + Intergenic
1154405245 18:14084628-14084650 CTCGGAAATGGGAGGGAGACTGG - Intronic
1154433621 18:14327384-14327406 CTCCCTTAGCTGAGGGAGCCAGG - Intergenic
1157677578 18:49578804-49578826 CGCGGTTAGGGGCTGGAGACCGG + Intronic
1158148419 18:54342675-54342697 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1161322145 19:3646234-3646256 CTCCCTCTGGGGAGGGAGACTGG + Intronic
1161458173 19:4380382-4380404 CTCCTTGCGGGGAGGGAGCCAGG + Intronic
1163912991 19:20214111-20214133 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1164081959 19:21866649-21866671 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1164106242 19:22108502-22108524 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1165149130 19:33750749-33750771 CTCCGTTGGGGGTGGGCGGCTGG - Intronic
1165193221 19:34080374-34080396 CGCGGTTAGGGGCTGGAGACTGG + Intergenic
1166028769 19:40109498-40109520 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1167315483 19:48760627-48760649 TTGCGTGAGGGGAGCGAGACCGG - Intergenic
926777357 2:16435704-16435726 CAGAGTTAGGGGAGGGAGAATGG - Intergenic
926798073 2:16635219-16635241 CTCTGTTAAGGGAGGAAGAGGGG - Intronic
927978595 2:27358969-27358991 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
928212609 2:29334712-29334734 CTCCATTCGGGGAAGGAGACTGG - Intronic
929415859 2:41746292-41746314 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
929516405 2:42606861-42606883 CGCGGTTAGGGGCTGGAGACCGG + Intronic
930834091 2:55774523-55774545 CGCGGTTAGGGGCTGGAGACTGG + Intergenic
931036065 2:58244302-58244324 TTACTTTAGGGGAGGGAGATGGG + Intergenic
931656446 2:64513001-64513023 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
934601801 2:95663632-95663654 CTCCTTCAGGGGAGGGGGACGGG + Intergenic
935889499 2:107660786-107660808 CTCCCTTAGGGGAGGTAGGAAGG + Intergenic
936078756 2:109418236-109418258 CTCCCTTCAAGGAGGGAGACAGG - Intronic
936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG + Intronic
936535153 2:113305787-113305809 CTCCTTCAGGGGAGGGGGACGGG + Intergenic
937168891 2:119845034-119845056 CGCGGTTAGGGGCTGGAGACCGG + Intronic
937437466 2:121892279-121892301 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
938006309 2:127789483-127789505 CGCGGTTAGGGGCTGGAGACCGG + Intronic
938569888 2:132553263-132553285 ATCCGTGAGGGGAGGGGGATTGG - Intronic
941814947 2:169787153-169787175 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
942629997 2:177945034-177945056 CGCGGTTAGGGGCTGGAGACCGG - Intronic
943297321 2:186154792-186154814 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
944060569 2:195567397-195567419 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
944283693 2:197923939-197923961 CGCGGTTAGGGGCTGGAGACCGG + Intronic
944733197 2:202535866-202535888 CGCGGTTAGGGGCTGGAGACCGG + Intronic
945338466 2:208620262-208620284 CCCCATTAGGGGAGGGATAAAGG + Intronic
946304056 2:218846114-218846136 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
946742449 2:222815771-222815793 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
947901528 2:233724980-233725002 CGCGGTTAGGGGCTGGAGACCGG + Intronic
1168891710 20:1299321-1299343 CTCCTTGAGGGGAGAGTGACTGG - Intronic
1169370696 20:5027099-5027121 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1172058918 20:32175546-32175568 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1172141040 20:32723348-32723370 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1172348415 20:34222842-34222864 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1172465413 20:35153077-35153099 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1173006343 20:39142496-39142518 CTCCAGTAGGGGTGGGAGAAAGG - Intergenic
1173766240 20:45612274-45612296 CTCTGTGTGTGGAGGGAGACAGG + Intronic
1174945424 20:54980117-54980139 CTCCACTAGGAGAAGGAGACAGG - Intergenic
1176843415 21:13858360-13858382 CTCCCTTAGCTGAGGGAGCCAGG + Intergenic
1177134327 21:17292875-17292897 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1180039358 21:45268197-45268219 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1180726357 22:17949498-17949520 CACCGTTTGGGGAGGGGCACAGG - Intronic
1181079111 22:20401959-20401981 CTCCGTAAGGGAAAGGGGACTGG + Intronic
1181591711 22:23889459-23889481 CTCAGTTAGGGAGAGGAGACAGG + Intronic
1182616976 22:31593777-31593799 CGCGGTTAGGGGCTGGAGACCGG + Intronic
1183595082 22:38806509-38806531 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1185213912 22:49587616-49587638 CTCAGTCAGGGGTGGGAGCCAGG - Intronic
949608674 3:5681428-5681450 TTATTTTAGGGGAGGGAGACGGG + Intergenic
950424916 3:12919914-12919936 CTCCCTGAGGGCAGGGAGCCGGG + Intronic
950636031 3:14315523-14315545 CTCCGCCAGGGGAGGGAAAGGGG - Intergenic
953425868 3:42797162-42797184 CGCGGTTAGGGGCTGGAGACCGG - Intronic
954059161 3:48055418-48055440 CGCGGTTAGGGGCTGGAGACCGG - Intronic
955395046 3:58550913-58550935 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
955435066 3:58891206-58891228 CGCGGTTAGGGGCTGGAGACCGG + Intronic
956165785 3:66397256-66397278 CTCAGTTGGGGCAGGGAGGCTGG - Intronic
956724981 3:72149549-72149571 CTGCAATAGGGGAGGGAGATGGG + Intergenic
957316932 3:78584101-78584123 CGCGGTTAGGGGCTGGAGACTGG + Intergenic
958809053 3:98838828-98838850 CGCGGTTAGGGGCTGGAGACCGG + Intronic
959941155 3:112082993-112083015 CTCGGTTAGGGGATGGAGGAGGG + Intergenic
960861875 3:122163906-122163928 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
961120898 3:124368843-124368865 CGCGGTTAGGGGCTGGAGACCGG + Intronic
961558739 3:127714402-127714424 CTCCTTTAGGGGAGCGAGGGTGG - Intronic
961729070 3:128953819-128953841 CGCGGTTAGGGGCTGGAGACCGG - Intronic
962113203 3:132472028-132472050 CGCGGTTAGGGGCTGGAGACCGG + Intronic
964212267 3:154241631-154241653 CTCCAGTAGGGGAGAGAGATTGG + Intronic
966420335 3:179728763-179728785 CGCGGTTAGGGGCTGGAGACCGG + Intronic
966434533 3:179868771-179868793 ATGCGTTATGGGAGGGAGAAAGG - Intronic
968201964 3:196762478-196762500 CGCGGTTAGGGGCTGGAGACCGG + Intronic
968473661 4:792858-792880 CTCCGTGGGGGGAGGGAGAGTGG + Intronic
968545572 4:1196027-1196049 CTCCTTGAGGGGAGGGTGCCAGG - Intronic
971266468 4:25100248-25100270 CCCAGATAGGGGAGGGAGACAGG + Intergenic
973593284 4:52464318-52464340 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
975983514 4:80183977-80183999 CTCCGATTGGGGTGGGAGAGCGG + Intronic
976205446 4:82619478-82619500 CTCCCTGAAGGGAGGGAGTCGGG + Intergenic
981306154 4:143248833-143248855 CTGCCTTAGGGATGGGAGACGGG + Intergenic
981970285 4:150658931-150658953 CGCGGTTAGGGGCTGGAGACCGG - Intronic
982821062 4:159940436-159940458 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
984278053 4:177633987-177634009 ATCCATTCTGGGAGGGAGACGGG - Intergenic
984699091 4:182807148-182807170 CTTGGGTAGAGGAGGGAGACTGG - Intergenic
985746915 5:1652978-1653000 CTCTGTGAGGGGAGGGACCCTGG + Intergenic
986464828 5:8010829-8010851 CTTGCTTAGGTGAGGGAGACTGG - Intergenic
988760812 5:34307491-34307513 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
992977874 5:82139056-82139078 CGCGGTTAGGGGCTGGAGACCGG - Intronic
995193161 5:109340854-109340876 CGCGGTTAGGGGCTGGAGACCGG - Intronic
996305172 5:122038247-122038269 CTCCTATAGGGGTGGGGGACGGG + Intronic
998113802 5:139521527-139521549 CTCAGAGAGGGGAGGGACACAGG + Intergenic
998432335 5:142077124-142077146 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
999089281 5:148921154-148921176 TTTTGTTAAGGGAGGGAGACTGG + Intergenic
1001078042 5:168644214-168644236 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1001482253 5:172096407-172096429 CTCCGTAAGGCCAGGGAGAGTGG - Exonic
1001761577 5:174212199-174212221 CTCCATTAGGGGAGAGGGAGTGG - Intronic
1002013507 5:176304401-176304423 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1002115623 5:176960845-176960867 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1003535194 6:6970203-6970225 CTCCATTGGAGGAGGGAGGCTGG + Intergenic
1003674264 6:8188562-8188584 CTCCGTTAGGAGAGACAGACTGG + Intergenic
1005474728 6:26196673-26196695 TTCCGTGAGGGGAGGGGGAACGG + Intergenic
1005607188 6:27486231-27486253 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1006232563 6:32596579-32596601 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006617430 6:35339949-35339971 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1006787329 6:36677320-36677342 CTGCGTTAGAGGAAGAAGACTGG + Intronic
1007422632 6:41728768-41728790 CACTGTGCGGGGAGGGAGACAGG + Intronic
1007663569 6:43501267-43501289 CTCCGATAGTGAAGGGAGGCTGG + Intronic
1008112340 6:47506583-47506605 CGCGGTTAGGGGCTGGAGACCGG + Intronic
1008816877 6:55579075-55579097 GTCGGCGAGGGGAGGGAGACTGG + Exonic
1011587947 6:88946858-88946880 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1013325864 6:109046297-109046319 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1013609084 6:111777568-111777590 CACAGTTAGGGGAGGGAGGAGGG - Intronic
1014557273 6:122850090-122850112 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1014761055 6:125357152-125357174 CTCCCTTGGGGGTGGGTGACAGG + Intergenic
1015870026 6:137766935-137766957 CTCCTTTTGTGGAGGGAGAGAGG + Intergenic
1016747194 6:147593256-147593278 CTCTGTTAGGATAGGGAGACAGG - Intronic
1018295185 6:162338466-162338488 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1019438961 7:1037458-1037480 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1019445609 7:1069563-1069585 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1019668877 7:2267526-2267548 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1020137938 7:5596905-5596927 CTCATTTAGGGGAGGGGGCCTGG - Intronic
1024125907 7:46294691-46294713 CTCTGTTGGGTGAGGGATACAGG - Intergenic
1024989341 7:55220971-55220993 CGCGGTTAGGGGCTGGAGACCGG + Intronic
1025011465 7:55402306-55402328 CCCCGTCCGGGGAGGGAGGCGGG - Intronic
1025808145 7:64855725-64855747 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1026741557 7:72981859-72981881 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1026783583 7:73285106-73285128 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1026801391 7:73402243-73402265 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1027102178 7:75383219-75383241 CTCTGAAAGGGGAGGGAGAAGGG - Intergenic
1027232233 7:76279551-76279573 CTCTGTGTAGGGAGGGAGACAGG + Intronic
1027370933 7:77508626-77508648 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1033374503 7:140744352-140744374 CTCCATTGGGAGAGGGTGACAGG + Intronic
1034322378 7:150198058-150198080 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1035760287 8:2064015-2064037 CTCGGGAAGGGGAGGAAGACGGG + Intronic
1037700209 8:21267070-21267092 CTCTGTCAGGGGAGGATGACAGG - Intergenic
1038506426 8:28088903-28088925 CTCAGAGAGGGGAGGGAGATAGG - Intergenic
1041292362 8:56319778-56319800 CTCCGGGTGGGGAGGGAGGCTGG + Intronic
1041796793 8:61753863-61753885 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1043296385 8:78668164-78668186 ATCTCTTAGGGGAGGGAGAGGGG - Intronic
1043598515 8:81912899-81912921 ATCAGTTATGGGAGGGAGAGGGG - Intergenic
1047444519 8:124907316-124907338 CTCCCTTAGGGGAAGGGGAACGG + Intergenic
1049644942 8:143731969-143731991 CTCGGGTTGGGGAGGGAGGCAGG + Intronic
1050558038 9:6807102-6807124 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1055948136 9:81709754-81709776 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1056670736 9:88625695-88625717 CACGGTTAGGGGCTGGAGACCGG - Intergenic
1058660090 9:107258289-107258311 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1058722379 9:107775570-107775592 CGCGGTTAGGGGCTGGAGACCGG - Intergenic
1059120644 9:111640140-111640162 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1059731944 9:117065539-117065561 TTCTGGTAGGGGAGAGAGACAGG - Intronic
1060686915 9:125623010-125623032 CGCGGTTAGGGGCTGGAGACCGG - Intronic
1061729715 9:132604382-132604404 CTCTGTCAGGGGAGGCAGGCTGG - Intronic
1186796336 X:13050255-13050277 GTCCTTCAGTGGAGGGAGACTGG + Intergenic
1187444219 X:19346198-19346220 CTCCATGAAGGGAGGGAGAAGGG + Intronic
1187462512 X:19500576-19500598 CTTGGTTTGGGGAGGGAGAGTGG - Intronic
1189273042 X:39765120-39765142 CTCTGTGAGGCCAGGGAGACAGG + Intergenic
1189587398 X:42474765-42474787 CGCGGTTAGGGGCTGGAGACCGG + Intergenic
1191857044 X:65635495-65635517 TTCAGTCAGGGGACGGAGACTGG + Intronic