ID: 920969594

View in Genome Browser
Species Human (GRCh38)
Location 1:210731847-210731869
Sequence CACCCTGCCAAGCTGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 371}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920969594_920969597 0 Left 920969594 1:210731847-210731869 CCTTCTCCCAGCTTGGCAGGGTG 0: 1
1: 0
2: 3
3: 29
4: 371
Right 920969597 1:210731870-210731892 CTCTACCACCCACACTGAGAAGG 0: 1
1: 0
2: 2
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920969594 Original CRISPR CACCCTGCCAAGCTGGGAGA AGG (reversed) Intronic
900711676 1:4118647-4118669 CACCCTGACAGGTTGGGAGGAGG + Intergenic
900923650 1:5689662-5689684 CATCCTTCCAAGATTGGAGAGGG - Intergenic
901022684 1:6263014-6263036 CACCCTTCCCAGCTAGCAGAAGG - Intergenic
902224383 1:14987576-14987598 GAACCTGCCAGGCAGGGAGAAGG + Intronic
902289952 1:15429159-15429181 CCCCTTCCCAGGCTGGGAGACGG + Exonic
902580747 1:17405998-17406020 CAAGCTGCCAAGGGGGGAGATGG + Intergenic
903057623 1:20647443-20647465 CACCACGCCCAGCTGGGAGTTGG + Intronic
903419214 1:23206476-23206498 CAGCCAGCTATGCTGGGAGATGG - Intergenic
903542773 1:24106202-24106224 CACCCTGCTCAGCTAGGGGAGGG - Intronic
904038625 1:27571730-27571752 CACCATGCCAGCCTGGGAGGGGG - Intronic
904433195 1:30478428-30478450 CTCCCTGCCCAGGTTGGAGAAGG + Intergenic
905016808 1:34783440-34783462 CACCCTGCCACCCTGGAATAAGG - Intronic
906051922 1:42881209-42881231 CACCCTGCCAACTTGGAAAAAGG + Intergenic
906147510 1:43568806-43568828 ACCCCTAGCAAGCTGGGAGAAGG + Intronic
907404354 1:54244751-54244773 GAGCCTGCCAAGCAGGGAGCAGG - Intronic
907656044 1:56342699-56342721 CACCCAGCCAAGGAGGGACAGGG + Intergenic
908675105 1:66594738-66594760 AACCCACCCAAGCTAGGAGAGGG - Intronic
910927368 1:92410868-92410890 CTTCCTGCCAAGGTGGGAGGGGG - Intergenic
911093874 1:94039980-94040002 CACCCAGCAATACTGGGAGATGG + Intronic
911577829 1:99599202-99599224 GACCCTGTCCAGCTGGCAGAGGG + Intergenic
912428597 1:109616044-109616066 CTCACTGCTAAGCTGAGAGAGGG + Exonic
913712800 1:121502945-121502967 CCCTCTGCCATGCTGGGATAGGG - Intergenic
915598782 1:156909740-156909762 CACGCTGCCAACCTGGAGGAGGG - Exonic
915724297 1:158006934-158006956 CACCCTGGCAAGGCGGGACAAGG - Intronic
916959950 1:169879231-169879253 CACCATGCATAGCTGTGAGAAGG - Intronic
917969815 1:180199269-180199291 CAGTCTGCCAGGCTGGGAGCTGG + Exonic
918091084 1:181295745-181295767 CACCCTGCCAAGCGAGGTGGAGG + Intergenic
918426669 1:184417765-184417787 CACCATTCCAAGATGGGAGGTGG - Intronic
919984215 1:202661571-202661593 CCCCCTGCCAGGCTGTGTGAAGG - Intronic
920262642 1:204699876-204699898 CACCATGCCCAGCCAGGAGAGGG - Intergenic
920843830 1:209576983-209577005 CTCCCTGCCCCGCTGGGACACGG - Intergenic
920969594 1:210731847-210731869 CACCCTGCCAAGCTGGGAGAAGG - Intronic
921027594 1:211301362-211301384 AATCCTGGAAAGCTGGGAGAGGG - Intronic
921033443 1:211353964-211353986 TACCCTGCCAAGCTTTGAAAGGG + Intronic
921690130 1:218139288-218139310 CAACCTCCCAAACTGGGAAACGG + Intergenic
922831700 1:228557598-228557620 CACCCTTCCAAACCGGGTGAAGG - Intergenic
922832178 1:228609580-228609602 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922832738 1:228611821-228611843 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922833299 1:228614062-228614084 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922833859 1:228616303-228616325 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922834416 1:228618544-228618566 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922834976 1:228620776-228620798 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922835527 1:228622979-228623001 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922836085 1:228625221-228625243 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922836643 1:228627460-228627482 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922837202 1:228629702-228629724 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922837763 1:228631943-228631965 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922838321 1:228634183-228634205 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922838879 1:228636408-228636430 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922839439 1:228638649-228638671 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922840000 1:228640880-228640902 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922840560 1:228643121-228643143 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922841123 1:228645352-228645374 CACCCTTCCAAACCGGGGGAAGG - Intergenic
923273736 1:232379381-232379403 CAGCCTGGGCAGCTGGGAGATGG - Intergenic
1062893734 10:1086977-1086999 CACGCTGCCAGGCTGAGAGGTGG + Intronic
1063045165 10:2384373-2384395 CTCCCAGCCATGCCGGGAGAGGG - Intergenic
1063177855 10:3568387-3568409 CATTCTGCCATGCTGAGAGAAGG - Intergenic
1067175165 10:43940763-43940785 CACTCTGAAAAGCTGGGAGTGGG - Intergenic
1067341083 10:45404381-45404403 CACTCAGCCACGCAGGGAGAAGG + Intronic
1068222855 10:54064911-54064933 CACCCTGCCAACTTGGAAGGGGG + Intronic
1069160416 10:65084929-65084951 CACCCTACCAAGTTGGCAGGGGG - Intergenic
1069280817 10:66651598-66651620 AGCCCTGCCCTGCTGGGAGACGG + Intronic
1070105421 10:73426466-73426488 CACTCTGCCAACCTGTGAGCAGG + Intronic
1070989636 10:80720140-80720162 TACCCTGCCAAGCTGGAAGAGGG + Intergenic
1071936565 10:90538090-90538112 AACACTGCCAAGCTGGCAAATGG + Intergenic
1072860127 10:98994843-98994865 CACTCTGCCAAGGAGGGACAGGG - Intronic
1073067238 10:100769831-100769853 CACCCCTCCAAGCTCTGAGAAGG - Intronic
1073083860 10:100876101-100876123 CACACTGCCAAGAAGGGAGCTGG - Intergenic
1073383504 10:103100896-103100918 CACATTGCCAACCTGAGAGATGG - Intronic
1073691946 10:105819206-105819228 CACCTTGGCTAGTTGGGAGATGG + Intergenic
1073794783 10:106975857-106975879 CACCATGCCCAGCCAGGAGATGG - Intronic
1074579821 10:114708402-114708424 CTCCTTGCCAAGCAGGGAGGAGG - Intergenic
1074746542 10:116539503-116539525 CACACTGCCAAGTTCAGAGAGGG - Intergenic
1075662667 10:124209010-124209032 CACCCTGCTGAGTTGGGATAGGG + Intergenic
1076549752 10:131270878-131270900 CACCCTGCCAGGCTGGGGCCAGG + Intronic
1076638401 10:131898367-131898389 CCCCAGGCCAAGATGGGAGATGG - Intergenic
1076759047 10:132591016-132591038 CCTCCCGCCAAGCTGGGAGTGGG - Intronic
1076826777 10:132973363-132973385 CAGCCTGCCCAGCTGGGTGCAGG - Intergenic
1077037316 11:501689-501711 GTCCCTGCCAAGCTGGGGGCTGG - Intronic
1077465477 11:2731780-2731802 CACCCGGAAGAGCTGGGAGATGG - Intronic
1078094646 11:8289372-8289394 GTCCCTGCAAAGCTGGGAGAAGG - Intergenic
1078521730 11:12069126-12069148 CACTGTGCCCAGCTGGAAGAGGG - Intergenic
1079779818 11:24587392-24587414 CACTCTTCCAAGGTGAGAGATGG + Intronic
1081754222 11:45533066-45533088 CTCCCTGCAAAGCTGGCAAATGG + Intergenic
1081772562 11:45658929-45658951 CTGCCGGCCAGGCTGGGAGAGGG + Intronic
1081909938 11:46694298-46694320 CACCCTGGGGAGCTGGGAGTTGG - Intronic
1083336300 11:61923743-61923765 CACCCTGCACAGCTGGCGGAGGG - Intergenic
1084548488 11:69826338-69826360 CACCCTGCCAGGGGGTGAGAGGG - Intergenic
1085624540 11:78061922-78061944 CACCATGCCGGGCTGGGAGGCGG + Intronic
1086003106 11:82003276-82003298 CAAGCACCCAAGCTGGGAGAGGG + Intergenic
1086398353 11:86440530-86440552 CAGCCTGCCAAGCAGTGAGGAGG - Intergenic
1087292076 11:96330980-96331002 CACCATGCCTGGCTGGTAGATGG - Intronic
1089572001 11:119417263-119417285 CAGCCTCCCAACCTGGGACAAGG + Intergenic
1089684178 11:120136558-120136580 CACAGGGCCCAGCTGGGAGAAGG + Intronic
1090328768 11:125912867-125912889 CACCGTGCCCAGCTGAGAAATGG - Intronic
1090387174 11:126364067-126364089 CACCCCGCCATTTTGGGAGATGG - Intronic
1090421237 11:126576606-126576628 CACACTGCCAGCCTGAGAGAGGG - Intronic
1091583478 12:1802555-1802577 CACCCTGACATGCTGGGAAATGG - Intronic
1092565632 12:9662371-9662393 TACCTCGCCAAGCTGGGAGGTGG - Intergenic
1092651288 12:10637839-10637861 CACTCTGTCAAGCTGAGAAAAGG + Intronic
1094697668 12:32836987-32837009 CACCTTTCCAAGGTAGGAGATGG - Intronic
1096121012 12:49089534-49089556 CACCTTGGCAAGCTGGGCAAGGG + Exonic
1097181374 12:57173914-57173936 CCCCCTGACAAGCTGTGTGATGG + Exonic
1100681095 12:96921902-96921924 CACCACACCCAGCTGGGAGAGGG + Intronic
1100856565 12:98762598-98762620 CACCAGGCAAAGGTGGGAGATGG - Intronic
1101064108 12:101001733-101001755 CACCCTGAGCAGCTGGGGGAGGG + Intronic
1101205301 12:102481269-102481291 CACCCCACCACTCTGGGAGAAGG + Intergenic
1101398564 12:104369016-104369038 CACCCTGCCCAGCATGCAGAAGG + Intergenic
1102341086 12:112122129-112122151 AGCCCTGCCAGGCTGGGGGAGGG - Intergenic
1102498168 12:113333667-113333689 CACCCTGCACAGCAGGGAGAGGG + Intronic
1104521399 12:129478749-129478771 CTCCCTTCAAATCTGGGAGAGGG + Intronic
1104716242 12:131018218-131018240 CACCCTGCCTTCCTGGGAGCTGG - Intronic
1105706717 13:22971758-22971780 CACCCAGCCAGGCTGGGACCTGG + Intergenic
1106300514 13:28460105-28460127 AACACTGCCCAGCTGGGTGATGG - Intronic
1107040821 13:35945410-35945432 CAGCCTGGCCAGCAGGGAGAAGG + Intronic
1107264379 13:38535485-38535507 CACCCTGCCAAGTGCGGAGCAGG - Intergenic
1107699938 13:43037027-43037049 TACCCTGCCAAGCTGATAGGTGG + Intronic
1108498166 13:51045070-51045092 GTCTCTGCCAAGCTGGGAGGGGG - Intergenic
1112006616 13:95259096-95259118 CACCATGCCCAGCCGGGGGAAGG - Intronic
1112703542 13:102039498-102039520 CAGCCTCTGAAGCTGGGAGAGGG - Intronic
1113465272 13:110508169-110508191 CACACTGCCCAGCTGGGTGGCGG + Exonic
1113594214 13:111519970-111519992 CACCCTGCCCAGCTCAGAGCTGG + Intergenic
1114410448 14:22495843-22495865 GTCCCTGCCATGCTGGGAGGTGG + Intergenic
1114755037 14:25249582-25249604 CATCATGGGAAGCTGGGAGAAGG + Intergenic
1115675110 14:35664267-35664289 CACACTGAGAAACTGGGAGAAGG + Intronic
1119441455 14:74631358-74631380 CACCCTGCCAACCCTGGGGAGGG + Intergenic
1119654044 14:76404005-76404027 CACCATGCCCGGCTGGGAGCAGG + Intronic
1119925142 14:78486561-78486583 CACCATCCCAGGGTGGGAGAGGG - Intronic
1120151413 14:81039166-81039188 CACCATGACCAACTGGGAGATGG + Intronic
1121995018 14:98594862-98594884 CACCATGCCCAGCCAGGAGATGG + Intergenic
1123933710 15:25184056-25184078 CACCCTTCCATGCTGGCAGAAGG - Intergenic
1123996260 15:25719790-25719812 CATCTTGCCAAGCTGTCAGAGGG + Intronic
1124365549 15:29068699-29068721 CACCCAGGCAAAGTGGGAGATGG - Intronic
1124368689 15:29091160-29091182 AGCCCTGCCCAGCTGGGAGAAGG + Intronic
1124916062 15:33975641-33975663 CACCGTGCCCAGCTGGGACCTGG - Intronic
1125380219 15:39079420-39079442 CTCCCAGTCAAGCTGGGAGAGGG + Intergenic
1125440666 15:39699909-39699931 CACCATGCCAAGCTGAGAATGGG + Intronic
1125883697 15:43213340-43213362 CATCTTGCCATGCTTGGAGATGG - Intronic
1126358109 15:47817523-47817545 CATCCTGTCAACCTGGGAGTTGG + Intergenic
1127142111 15:55988681-55988703 CCCCCTTCCAAGCTAGGAAATGG - Intronic
1127437736 15:58974592-58974614 CACCGTGCCCAGCTGAGAGCTGG + Intronic
1128606251 15:69038670-69038692 CAACCTGCCAATCTGGAAGTGGG - Intronic
1128691815 15:69730342-69730364 AGCCCTGCCACGCTGGGAGATGG + Intergenic
1128717604 15:69920063-69920085 GTCCCTGCCAAGCTGGGGCACGG + Intergenic
1128809066 15:70556754-70556776 AGCCCGGCCAAGCTGAGAGAGGG + Intergenic
1129228131 15:74181621-74181643 CAACCCACCATGCTGGGAGATGG + Intronic
1129788420 15:78324138-78324160 CACTCTGCCAAGGGGCGAGAGGG + Intergenic
1130122168 15:81060558-81060580 GACTCAGACAAGCTGGGAGAGGG - Intronic
1131118458 15:89808648-89808670 CTGCCTGCCATGCTTGGAGAAGG - Intronic
1131377723 15:91939473-91939495 AGCCCTGCAAAGCTGGGAGGTGG - Intronic
1132458868 16:39480-39502 CACCCTGCCCAGCTAAGGGAGGG - Intergenic
1132657608 16:1047950-1047972 CACGCTGCCCTGATGGGAGAGGG - Intergenic
1132736084 16:1386914-1386936 CTCCCTGCCCAGGTGCGAGAAGG + Intronic
1133889008 16:9860666-9860688 CAGAGTGACAAGCTGGGAGATGG + Intronic
1134117806 16:11562225-11562247 CACACTGTGAACCTGGGAGATGG + Intronic
1136392567 16:29974569-29974591 GGCTCTGCCAAGCAGGGAGAGGG - Exonic
1137588510 16:49679313-49679335 CACCCTGCCAACTTGGAAGGGGG - Intronic
1138502938 16:57459706-57459728 CACACTGCCAAGCAGGTAGGTGG + Exonic
1140831158 16:78752880-78752902 CACCCAGCCAAGATGGGACCAGG - Intronic
1141110927 16:81270103-81270125 CACAGTGCCAGGCTGAGAGAGGG + Intronic
1142206212 16:88784448-88784470 CTTCCTGACAATCTGGGAGAAGG - Intronic
1142230213 16:88896631-88896653 CACCCAGCCAGGCCAGGAGATGG + Intronic
1142741851 17:1936222-1936244 CACTCTGGCAAGGTGGGAAAAGG - Exonic
1143950807 17:10630911-10630933 CACTCTGCCACCCTGGAAGAGGG + Intronic
1144846312 17:18221465-18221487 GACCCTCCCAGCCTGGGAGATGG + Intergenic
1145774724 17:27519877-27519899 CATCCAGCCCAGCTGGGAGTGGG + Intronic
1145999485 17:29122715-29122737 TCCTTTGCCAAGCTGGGAGAGGG + Intronic
1147409522 17:40239454-40239476 CACCCTGGCAGGCTGGTAAAAGG + Intronic
1147588306 17:41665657-41665679 CACATTGCCAAGCTGCGAGCGGG + Intergenic
1148346797 17:46908659-46908681 AAGCCTGCCATGCTGGGAGCAGG + Intergenic
1148609049 17:48951798-48951820 TACCTTGCCAGGTTGGGAGAGGG + Intergenic
1149116204 17:53098829-53098851 CACCTAGGCAAGGTGGGAGAGGG + Intergenic
1149214262 17:54335710-54335732 CATGCTGTCAGGCTGGGAGATGG + Intergenic
1150291729 17:63986199-63986221 CACCATGTCCAGCTGGGTGAGGG - Intergenic
1151514187 17:74581527-74581549 CACCCTCCCAAGCTGGCAGAGGG - Intronic
1151553604 17:74835702-74835724 CCCCCTGCTCAGCAGGGAGAGGG + Intronic
1151702285 17:75749921-75749943 CATCCTGCCAAGCTTGGCGGAGG - Intronic
1152233552 17:79126618-79126640 CTCCCTGCCATGCAGAGAGATGG - Intronic
1152997834 18:424897-424919 CACCCTGCTCAGCTGTGACATGG - Intronic
1153603345 18:6805120-6805142 CACCATGCCCAGCTGAAAGAGGG + Intronic
1153940027 18:9969357-9969379 GACCCTTCCACGCTGGGAGGAGG + Intergenic
1154300033 18:13184690-13184712 CACACTGCCAAGATGACAGATGG + Intergenic
1154340000 18:13494984-13495006 CTAACTGCCAAGCTGGGAGGCGG - Intronic
1154406470 18:14096223-14096245 CACTGTGGAAAGCTGGGAGATGG + Intronic
1159292330 18:66439472-66439494 CACCCTTCCAACTTGGAAGAGGG - Intergenic
1159356179 18:67339056-67339078 GAGTCTCCCAAGCTGGGAGAAGG - Intergenic
1159806301 18:72962107-72962129 GGCACTGCCAAGCTGGGAGCAGG + Intergenic
1159917314 18:74198759-74198781 GATCCTGCCAAGATGGGACAGGG + Intergenic
1160113369 18:76054743-76054765 CCCCCTGTCAAGGTGGGACAGGG + Intergenic
1160845065 19:1162630-1162652 CACCTCACAAAGCTGGGAGAAGG - Intronic
1160967209 19:1752028-1752050 CAGCCTGCCCAGCTGGGAGCCGG - Intergenic
1161719783 19:5896404-5896426 CATTCTGCCAGGCTGGGAGGAGG + Intronic
1161903258 19:7135680-7135702 CACCGTGCCCAGCTGGTGGAAGG - Intronic
1162346230 19:10119566-10119588 CACGGTGCCAGACTGGGAGATGG + Intronic
1162738966 19:12763138-12763160 CTCCCCACCAATCTGGGAGAGGG + Exonic
1162802429 19:13118684-13118706 CCCCCTCCCTCGCTGGGAGACGG - Intronic
1163056145 19:14719895-14719917 CACCGTGCCCAGCCGGGAGATGG - Exonic
1163276585 19:16288299-16288321 CACCGTGCCCCGCTGGGACAGGG - Intergenic
1163353566 19:16795118-16795140 CTCTTTGCCAAGCTGGGAGCAGG + Intronic
1163500734 19:17674667-17674689 CAGCCAGCCCAGCTGGGAGCAGG - Exonic
1163610610 19:18299495-18299517 CTCCCTCCCAGGGTGGGAGAGGG - Intergenic
1163649710 19:18510077-18510099 CATCGTGCCCAGCTGGGACATGG - Intronic
1163819374 19:19487394-19487416 CACCCTGCAAGGCAGGGGGAGGG + Intronic
1163845385 19:19635557-19635579 CTCCCTGCAGACCTGGGAGACGG - Exonic
1164160215 19:22621272-22621294 CAAGCTGCCTAGTTGGGAGAGGG + Intergenic
1164753008 19:30670037-30670059 CATCCTGCCCAGGTGGGAGAGGG + Intronic
1165887423 19:39088309-39088331 CACCATGCCCAGCAGAGAGAGGG + Intronic
1166620735 19:44297749-44297771 CACCGCGCCCAGCTGGAAGATGG + Intronic
925187470 2:1859020-1859042 CACCCTGACAGCCTGGGGGAGGG + Intronic
928412694 2:31066895-31066917 GACCCAGCCAAGCTGGGAAAGGG + Intronic
928443457 2:31312573-31312595 CACCATGCCCAGCCGAGAGAAGG + Intergenic
929489638 2:42384865-42384887 CACCTTGCAGAGCTGGGGGAAGG - Intronic
929999742 2:46853087-46853109 CACCAACCCAAGCTGGGAGGAGG - Intronic
930156113 2:48109299-48109321 CAGCCAGCCAAGGTGGGAGAGGG - Intergenic
930667243 2:54111403-54111425 CTCAGTACCAAGCTGGGAGAGGG + Intronic
931716811 2:65035623-65035645 CACCCTGTTAGGCTGTGAGAGGG + Intergenic
932088277 2:68781850-68781872 CTACCTGCCAAGCTGCCAGAGGG - Intronic
932611516 2:73203262-73203284 CACGCTGCTGAGGTGGGAGAGGG + Intronic
933639183 2:84741175-84741197 CACCCAGCCAAGCAGGGAAAGGG - Intronic
933764536 2:85697764-85697786 CACTTTCCCAAGCTGGGAGATGG - Intronic
935202611 2:100871009-100871031 CACCCAGGCTAGCTGGCAGAAGG - Intronic
936548977 2:113418405-113418427 GCCTCTGCCAGGCTGGGAGAGGG - Intergenic
937854997 2:126665945-126665967 CAGCCTGCCCTGCTGGGAGGGGG + Intronic
938324675 2:130390689-130390711 CTCCCTGCCAAGCAGGAAGAAGG + Intergenic
941121252 2:161532948-161532970 CACTCTGCCAACTTGGGAGAGGG - Intronic
941858553 2:170254637-170254659 CACCCTGGGAAGTTGGGACAAGG - Intronic
942088470 2:172464636-172464658 GAGCCTGTCAAGCTGTGAGATGG + Intronic
945202454 2:207296403-207296425 CACCTTCCTGAGCTGGGAGAGGG - Intergenic
945382789 2:209161298-209161320 CACCATGCTAATCTGGGGGATGG + Intergenic
946415662 2:219538544-219538566 CCCCCTGCCAAGAGGGGAGCTGG - Exonic
946672577 2:222121814-222121836 CATGCTGCCAAACGGGGAGAGGG + Intergenic
946884585 2:224210433-224210455 CACCCTGCCTGCCTGGAAGAAGG - Intergenic
947997597 2:234541948-234541970 CACCATGCCCAGCTGAGACAGGG + Intergenic
948311509 2:236990373-236990395 TCCCCTGACATGCTGGGAGAGGG + Intergenic
948659795 2:239499877-239499899 CACCCACCCAAGCTGGGAAGAGG - Intergenic
948739082 2:240031080-240031102 CACCCTCCCCAGCTGTGAGCTGG - Intergenic
1169179192 20:3547763-3547785 CAGAGAGCCAAGCTGGGAGATGG + Intronic
1170696309 20:18662407-18662429 CACCATGCCCAGCTGGGGGTGGG + Intronic
1170951800 20:20943303-20943325 CACTCTCCCAGGCTGGGAAAGGG + Intergenic
1172434688 20:34920723-34920745 CACCTGGCCTAGCTGGGGGATGG + Intronic
1172533125 20:35647764-35647786 CACCGTGCCCAGCTGGTAAATGG - Intronic
1172664562 20:36590243-36590265 CACCGTGCCCAGCCGGGGGAGGG + Intronic
1173981464 20:47227270-47227292 CAGCCTGCGAATCTGGAAGAGGG + Exonic
1175388358 20:58611457-58611479 CACCCTGCCTGGCTGGGACGTGG + Intergenic
1175522341 20:59609964-59609986 CACCATGCCCAGCTAGGAAAAGG - Intronic
1175765492 20:61589977-61589999 AGCCGTGCCCAGCTGGGAGAGGG + Intronic
1176053677 20:63133899-63133921 CACCCTGCCAACCTCTGAGCAGG - Intergenic
1176515352 21:7779668-7779690 GGCCCTGCCTGGCTGGGAGAGGG + Intergenic
1178514079 21:33230813-33230835 CACCCTCCCAGGGTCGGAGAGGG + Intronic
1178649380 21:34409680-34409702 GGCCCTGCCTGGCTGGGAGAGGG + Intergenic
1178885257 21:36479875-36479897 AACCCTGCCAGGCTGGGAAGGGG - Exonic
1178918894 21:36725507-36725529 CTCACTGCCAAGCTGTGAGTAGG - Intronic
1179023183 21:37657548-37657570 ACCCCTGTCAAGCTGGGAGCAGG - Intronic
1179623123 21:42631941-42631963 CACCATGCCAGGCTGGGCGTTGG - Intergenic
1180230187 21:46422334-46422356 CTCCCTGCCCAGATGGGAGGCGG - Intronic
1181086589 22:20442372-20442394 CACCGTGCCCAGCAGGGAGTGGG + Exonic
1182291882 22:29286398-29286420 CACGGTGCCCAGCTGGGAGGGGG - Intronic
1182722495 22:32414785-32414807 CACCATGCCCAGCTGAGAGATGG + Intronic
1182723189 22:32421093-32421115 AGCCTTACCAAGCTGGGAGAGGG - Intronic
1183530135 22:38348864-38348886 CAGCCTGCCAGGCTGGGGAAGGG + Intronic
1183578155 22:38705674-38705696 CCCCCTCCCAAGCTGGGAGCAGG + Intergenic
1183773046 22:39943530-39943552 CACCCCGCCAACCTGATAGATGG - Intronic
1183953732 22:41367290-41367312 CGCCCTGCCAAGCAGCGGGAAGG + Intergenic
1184195169 22:42922745-42922767 CACTCTTCTAAGCTGGGGGAGGG + Intronic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1185101903 22:48845071-48845093 CACTCTGCCAAGCTGCTAAATGG + Intronic
950641517 3:14351505-14351527 CACCCGGCCCAGGTGGGAGCTGG + Intergenic
950725999 3:14917416-14917438 CACCCAGACCAGCTGGAAGAGGG + Intronic
952750049 3:36817612-36817634 CACCCTGCCACCCTGGGATTTGG - Intergenic
953171795 3:40513892-40513914 CACTCTGTCAAGCCGGGACAGGG + Intronic
954665353 3:52248523-52248545 CACCCTGCCAAGGTGGAGGGGGG - Intronic
957290223 3:78269307-78269329 CCCCAGGCCAAGGTGGGAGAGGG - Intergenic
957939957 3:86991383-86991405 CACCATCCCATGCTGGGAGGCGG - Intergenic
957973052 3:87407392-87407414 CACCCTCCCAAGATTGAAGAAGG + Intergenic
958663587 3:97104855-97104877 CACCCTGCCAAGATTGAAGCAGG - Intronic
962371399 3:134823589-134823611 TACCCTGCCAAGCTGGGCCTTGG - Intronic
962953506 3:140243150-140243172 CACTCTGCCATGACGGGAGAGGG - Intronic
963746538 3:149129893-149129915 CACCCGGCCCAGCGTGGAGAAGG - Exonic
964406075 3:156350901-156350923 CTCCCTGCACAGCTGGGTGAGGG - Intronic
966499857 3:180626834-180626856 CACCTGTCCAAGGTGGGAGAGGG - Intronic
968515611 4:1014530-1014552 CACCCTGCCCACCTGGGTCAGGG - Intronic
969115540 4:4868585-4868607 CCCTCTGCCTAGATGGGAGAAGG - Intergenic
969166865 4:5323448-5323470 CACCCTGCAAGGGAGGGAGACGG + Intronic
969306502 4:6328941-6328963 GCCCCCGACAAGCTGGGAGAGGG + Intronic
969486150 4:7473534-7473556 CCACCTGCCAAGCTGCTAGAAGG - Intronic
972279310 4:37587081-37587103 CAGCCCCCCAAGCTGGAAGAGGG - Intronic
973815419 4:54614735-54614757 CACGCTGCCATTCTGGGACAGGG - Intergenic
979950388 4:126885688-126885710 CACACTCCCATGCTGAGAGAGGG + Intergenic
980322879 4:131302461-131302483 CACCCGGCCAAGGAGGGAGAAGG + Intergenic
981666954 4:147239431-147239453 CACCTTGTCAAGCTGAGTGAAGG + Intergenic
982902069 4:161019171-161019193 CACCCTGAAAAGCTGGGACTTGG - Intergenic
983766662 4:171492318-171492340 CACTGTGCCACACTGGGAGAGGG + Intergenic
985576982 5:678101-678123 CACCCGGCTCAGCTGGGACATGG - Intronic
985591902 5:770154-770176 CACCCGGCTCAGCTGGGACATGG - Intergenic
986232338 5:5877777-5877799 CACTCTGCAAAGCTGAGAGATGG - Intergenic
986343943 5:6817129-6817151 CACGGGGCCAAGCTGAGAGAGGG + Intergenic
987644184 5:20648083-20648105 GACTCTCCCAAGCTTGGAGATGG - Intergenic
988796417 5:34656721-34656743 GACCCGGCCAAGTTAGGAGAAGG + Intronic
991983593 5:72259179-72259201 CACCATGCCTAGCTGGGAATCGG - Intronic
994903031 5:105801270-105801292 CTCCCTGCCAAGCTCTGGGAGGG + Intergenic
997498017 5:134346782-134346804 CACCGTGCCCAGCCGGGAAAAGG + Intronic
999231474 5:150064708-150064730 CCCCCTGCCCAGCTGGGGGCAGG - Intronic
1002416209 5:179122128-179122150 CACCCTCCCCAGCTGGGGGCAGG + Intronic
1003115503 6:3281182-3281204 GCCCATGTCAAGCTGGGAGATGG + Intronic
1003181428 6:3795186-3795208 CACCATGCCCAGCTGGGATCTGG + Intergenic
1003310480 6:4965694-4965716 GGCCCTGCAAAGCTTGGAGAGGG - Intergenic
1003568102 6:7237514-7237536 CACTCTGCCCAGCTGGCTGATGG + Intronic
1005723768 6:28628977-28628999 CAACCTGTCAAGCAGAGAGAAGG + Intergenic
1006401042 6:33817560-33817582 CTTCCTTCCAAGCTGGGACACGG + Intergenic
1007397175 6:41584680-41584702 CACTCTGCCACGCTGAGAGTGGG + Intronic
1008087372 6:47259164-47259186 CATCCTGCCAAGCAGAGAGGTGG - Intronic
1008962539 6:57280473-57280495 CATCCTGGGAAGCTGGGGGAAGG - Intergenic
1009762809 6:68029553-68029575 CACCTTGCCTGGCTGGGAGGAGG - Intergenic
1013201800 6:107904967-107904989 CACCATGCCCAGCTGGGAGTTGG - Intronic
1015045679 6:128773711-128773733 CATCTTGCCACGCTGGTAGATGG + Intergenic
1015618160 6:135101076-135101098 CAGCCTGGCAATCTGTGAGATGG - Intronic
1015703333 6:136059918-136059940 AACTCTGCCAAGCTTGGAGAGGG + Intronic
1016990250 6:149923486-149923508 CACTCTGCAACGCAGGGAGAGGG - Intergenic
1017126514 6:151069616-151069638 CACCGAGGCAAGCTGGAAGAAGG - Intronic
1018400550 6:163415385-163415407 CACCATCCCAAGCGGGGAAAGGG - Intronic
1018681788 6:166271006-166271028 CACCCAGCCGAGGTGGGGGATGG + Intergenic
1018835481 6:167480226-167480248 CGCCTTGCCCAGGTGGGAGAAGG - Intergenic
1019649978 7:2151631-2151653 CACCCAGCAAAGCTGGGAGCTGG + Intronic
1019872673 7:3780193-3780215 CACTGTGCCAACTTGGGAGATGG - Intronic
1022286162 7:28957432-28957454 CAGCTTGCCTAGCTGGGCGAAGG + Exonic
1022391773 7:29950046-29950068 CACCCTGCCAACTTGGTAGGGGG - Intronic
1024054261 7:45649590-45649612 CACCCAGCTAGGCTGAGAGATGG + Intronic
1025966160 7:66274078-66274100 CACCGTGCCCAGCTGGAAGGTGG - Intronic
1026805903 7:73429529-73429551 CACCCTGGCAAGATGGGGGCGGG + Intergenic
1026951735 7:74352001-74352023 CAGCCAGCCCAGCTGGGAGTGGG + Intronic
1029670072 7:102024092-102024114 AACCCTGCCAACCTGGCACAGGG - Intronic
1030408510 7:109144705-109144727 GACACTGCCAAGGTGGGGGAGGG + Intergenic
1030701775 7:112648220-112648242 CACTGTGCCAGGCTGTGAGAGGG - Intergenic
1032061982 7:128732470-128732492 TACCCTCCCCAGCTGGGGGATGG - Intergenic
1034017892 7:147607236-147607258 CTCCCTGCCCTTCTGGGAGAAGG + Intronic
1034510909 7:151533867-151533889 CACCGTGCCAGGCTGAGACAGGG + Intergenic
1034876497 7:154729250-154729272 CACCCTGCTAGGCTGGGTCAAGG + Intronic
1035209723 7:157318850-157318872 CACCGTGCCCAGCCGGGACATGG - Intergenic
1035319826 7:158021672-158021694 CAGCCTGCCAACCAAGGAGAGGG + Intronic
1035897949 8:3425299-3425321 CACCTTGCCCAGCTGGGACAGGG - Intronic
1036137392 8:6174739-6174761 CACCATACCCAGCTAGGAGAGGG + Intergenic
1036748810 8:11430137-11430159 CACCAGGCCACGCTGGGAGCGGG - Intronic
1037322438 8:17656715-17656737 CACACTGGCTGGCTGGGAGAGGG - Intronic
1038163939 8:25066898-25066920 CACTCGGCTAAGCTAGGAGAAGG + Intergenic
1038210855 8:25518061-25518083 CACCCTGCTCAGCTGCAAGAAGG - Intergenic
1038252978 8:25923436-25923458 CACCCTGGCAAGCTGAGAGATGG - Intronic
1040386920 8:46920297-46920319 CACCAGGACAAGCTGGGACAGGG + Intergenic
1043702948 8:83313336-83313358 CACCCTGCCAACTTGGAAGGGGG + Intergenic
1045500062 8:102738245-102738267 CACGGTGAGAAGCTGGGAGAAGG + Intergenic
1047757228 8:127927984-127928006 TGCCTTGCCAAGCTGGTAGAGGG + Intergenic
1048689123 8:136939018-136939040 CACCATGCTAAGATGCGAGAAGG - Intergenic
1048985539 8:139732842-139732864 GACCCTGCCAGGCAGGGAGCTGG + Intronic
1049014281 8:139908524-139908546 CACGCTGCCAGGCTGGGGAAAGG - Intronic
1049238011 8:141522357-141522379 CACCGTGCCAGGCTGGGATCGGG - Intergenic
1049903964 9:198445-198467 GCCTCTGCCAGGCTGGGAGAGGG + Intergenic
1049928538 9:433276-433298 AGCCCTGGCAAGCTGGCAGAGGG + Intronic
1050463372 9:5895785-5895807 CGCCCTGCCAAGCTGGGCAGTGG + Intronic
1052386496 9:27829443-27829465 CACCATTCCAAGCAGTGAGAAGG - Intergenic
1053199440 9:36142667-36142689 CTCCCTGCCTAACTGGGAGATGG + Intronic
1053746975 9:41208746-41208768 GCCTCTGCCAGGCTGGGAGAGGG + Intergenic
1054480311 9:65656613-65656635 GCCTCTGCCAGGCTGGGAGAGGG - Intergenic
1054681371 9:68222535-68222557 GCCTCTGCCAGGCTGGGAGAGGG - Intergenic
1055829484 9:80360828-80360850 CACCCTGCCAGGAAGGGAGGTGG - Intergenic
1056729118 9:89149262-89149284 CATCCTGCAGAGCTGGCAGAGGG - Intronic
1057197838 9:93124883-93124905 CACCCAGGTGAGCTGGGAGATGG - Exonic
1057445660 9:95112686-95112708 CACGCTGCCAACCTGGGAGCTGG - Intronic
1057558485 9:96108374-96108396 CACCGTGCTGAGCTGGGAGTGGG + Exonic
1057584205 9:96314888-96314910 CACCAAGTCGAGCTGGGAGAAGG + Intergenic
1058517391 9:105790588-105790610 CTCTCTTCCAAGCTGTGAGACGG + Intergenic
1059894458 9:118845740-118845762 CAACCTGCCAAGGGTGGAGATGG - Intergenic
1060544314 9:124451357-124451379 CGCCCTGGAGAGCTGGGAGAGGG - Intergenic
1060547747 9:124470830-124470852 CAGCCTTCCCAGCTGGCAGAGGG - Intronic
1060820583 9:126659310-126659332 TTCCCAGCCCAGCTGGGAGAGGG - Intronic
1060875595 9:127081497-127081519 CAACCTTCCAGGCTTGGAGAAGG + Intronic
1061007164 9:127934862-127934884 AACCCGGCCAAGCTGGCACAGGG + Intergenic
1061291287 9:129651555-129651577 CACCCTGGCAGGATGGGAGTAGG - Intergenic
1061342935 9:129997896-129997918 CACCGCGCCCAGCTGGGAGAGGG - Intronic
1061476471 9:130870699-130870721 CACCATGCCAAGCTGTCCGAGGG - Intronic
1061608073 9:131726655-131726677 CATGCTGCCAGGGTGGGAGAAGG + Intronic
1061916933 9:133760195-133760217 CAGCCTGCACATCTGGGAGAAGG + Intergenic
1062000611 9:134214001-134214023 CACTCTCCCAAGTTGGGAGAGGG - Intergenic
1062215804 9:135389227-135389249 CACCCTGCCAATCAGGGACCAGG + Intergenic
1062217805 9:135398758-135398780 CACCCTGCCAGGCAGGAAGGAGG + Intergenic
1202783105 9_KI270718v1_random:19526-19548 GCCTCTGCCAGGCTGGGAGAGGG + Intergenic
1203453730 Un_GL000219v1:145035-145057 CATAATGCCCAGCTGGGAGATGG - Intergenic
1185975745 X:4718408-4718430 CAGCACGCCAAGCTGGTAGACGG + Intergenic
1187423795 X:19159722-19159744 GGCCCTGGCAAGATGGGAGAGGG + Intergenic
1187452783 X:19413515-19413537 CACCCTGCCCAGCGAGGAGGCGG + Intronic
1187713509 X:22077844-22077866 CATTCTGCAAAGCCGGGAGAAGG - Intronic
1190596787 X:52059836-52059858 GAGCAGGCCAAGCTGGGAGAAGG + Intergenic
1190612037 X:52194237-52194259 GAGCAGGCCAAGCTGGGAGAAGG - Intergenic
1190708484 X:53049136-53049158 GCCACTGCCAAGCTGGGAGGGGG - Exonic
1190750444 X:53357430-53357452 CCACCTGCTAAACTGGGAGATGG + Intergenic
1190801646 X:53794885-53794907 CCACCTGCTAAACTGGGAGATGG + Intergenic
1195160029 X:102162099-102162121 CACCCTGCAAAGCCAGGGGAAGG - Intergenic
1196013616 X:110914458-110914480 CACCCAGCCAAGTTGGAACAGGG - Intergenic
1197046887 X:122008356-122008378 CACCATGCCTAGCTAGGACAGGG + Intergenic
1198274470 X:135088081-135088103 TGCTCTGCCAAACTGGGAGAGGG + Intergenic
1199139001 X:144287976-144287998 CAGTCTGCCAACCTGGGAGAGGG - Intergenic
1199478556 X:148273303-148273325 CACTCTGGTAAGGTGGGAGATGG + Intergenic
1200041763 X:153375875-153375897 CTGCCAGGCAAGCTGGGAGAAGG + Intergenic
1200154289 X:153967161-153967183 CACATTGAAAAGCTGGGAGAAGG - Intronic
1200985546 Y:9299923-9299945 CAGGCTGCCAACCTGGGACAAGG + Intergenic
1201559431 Y:15300518-15300540 TACCTTGACATGCTGGGAGAAGG + Intergenic