ID: 920970817

View in Genome Browser
Species Human (GRCh38)
Location 1:210742388-210742410
Sequence TACCCCAGCATTGTTCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920970817_920970823 6 Left 920970817 1:210742388-210742410 CCCAGGGGAACAATGCTGGGGTA 0: 1
1: 0
2: 0
3: 13
4: 115
Right 920970823 1:210742417-210742439 CAGATGGGAAATAGAATTCCTGG 0: 1
1: 0
2: 3
3: 33
4: 278
920970817_920970820 -9 Left 920970817 1:210742388-210742410 CCCAGGGGAACAATGCTGGGGTA 0: 1
1: 0
2: 0
3: 13
4: 115
Right 920970820 1:210742402-210742424 GCTGGGGTAACCATCCAGATGGG 0: 1
1: 0
2: 0
3: 8
4: 64
920970817_920970819 -10 Left 920970817 1:210742388-210742410 CCCAGGGGAACAATGCTGGGGTA 0: 1
1: 0
2: 0
3: 13
4: 115
Right 920970819 1:210742401-210742423 TGCTGGGGTAACCATCCAGATGG 0: 1
1: 0
2: 0
3: 13
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920970817 Original CRISPR TACCCCAGCATTGTTCCCCT GGG (reversed) Intronic
907271845 1:53295853-53295875 TGCCCCAGCAGTGTTTTCCTAGG - Intronic
909167272 1:72244638-72244660 TACTACACCATTGTTCCCCGGGG + Intronic
910967228 1:92819632-92819654 CACCGCAGCATTGATCTCCTGGG - Intergenic
911767033 1:101690007-101690029 TACCCCACCATTCTTTCTCTTGG + Intergenic
915196248 1:154192184-154192206 CACCCCATCATTGTTCTCCTGGG + Exonic
917157588 1:172020931-172020953 TGCCCCAGCATTGTTTTCCATGG + Intronic
918805521 1:189036710-189036732 AACCCCAGAATTGCCCCCCTGGG + Intergenic
919905812 1:202077626-202077648 CACCACAGCATTCTTCACCTGGG - Intergenic
920856531 1:209667208-209667230 TTCTCCAGCATTATTTCCCTGGG - Intergenic
920970817 1:210742388-210742410 TACCCCAGCATTGTTCCCCTGGG - Intronic
921673835 1:217955413-217955435 TTCCCCAGCATTGATTCCCTGGG - Intergenic
922021636 1:221710910-221710932 TACCCCAGCATTGTTGCTCATGG - Intronic
1067355599 10:45522467-45522489 CACCCCAGGATTGTTACCCAAGG - Intronic
1071307970 10:84315873-84315895 GACCTCAGCATTCTTCCCCCAGG - Intergenic
1074437585 10:113447107-113447129 TCCCCCACCATTCTTCTCCTTGG + Intergenic
1076208200 10:128620104-128620126 TACACCAGCAAAGTTCCCCCTGG + Intergenic
1076570123 10:131426955-131426977 TCCTCCAGCCATGTTCCCCTGGG + Intergenic
1076661404 10:132058138-132058160 GACCTCAGCCTTGTTCCCATAGG - Intergenic
1080545302 11:33311259-33311281 CACCACAGCATTGACCCCCTGGG + Intronic
1086943331 11:92820527-92820549 TACCACAGCTGTCTTCCCCTGGG - Intronic
1087393267 11:97566719-97566741 TACCCCAGCACTGGTTCCCATGG - Intergenic
1092209583 12:6637716-6637738 TACCCCAGGATTGGTCCCTTTGG + Intergenic
1095646812 12:44557493-44557515 TACCTCTGCATTGATCCTCTTGG - Intronic
1096656734 12:53097046-53097068 TACCCCAGTCTGGTTCCCCTCGG + Intergenic
1097144483 12:56930453-56930475 CACACCAGCATTGTTCACCAGGG + Exonic
1098444893 12:70556312-70556334 TACCCCAACCTTGGTTCCCTGGG - Intronic
1103503393 12:121422971-121422993 TGCCCCAGCTTTGTAGCCCTGGG - Intronic
1104859387 12:131916640-131916662 TTCCCCTGCATTGTTCTGCTGGG + Intronic
1107605725 13:42054120-42054142 TTCCCCAGCATACTTCACCTAGG - Intronic
1111187429 13:84757190-84757212 TACCCCAGCACTGGTTCCCAAGG + Intergenic
1111816770 13:93163603-93163625 TCCCCCAGTACTGTTCTCCTGGG - Intergenic
1115027131 14:28758765-28758787 TGCCCCAGGATTGCTCCCCAGGG - Intergenic
1118910426 14:70057715-70057737 TTCCCCTGTATTGATCCCCTGGG + Intronic
1120909718 14:89655198-89655220 TAACACAGCATTGTTTACCTTGG - Intergenic
1121931926 14:97979978-97980000 TACACCAGGACTGTTCCACTTGG + Intergenic
1131287153 15:91069787-91069809 TGCCCCCGCATTCTTCCCTTGGG + Intergenic
1131892865 15:96992521-96992543 CACCCCAGCACTGATTCCCTTGG + Intergenic
1131950459 15:97675651-97675673 TACCCCAGTACTGTTTCCCAAGG + Intergenic
1136480134 16:30535960-30535982 TACCCCAACCTGCTTCCCCTGGG + Intronic
1137518825 16:49174262-49174284 TACCTCTACATTTTTCCCCTTGG + Intergenic
1141282171 16:82638702-82638724 TCCCCCAAGATTGTTCCCCTCGG + Intronic
1142510022 17:387181-387203 TGCCCCAGCGTTTGTCCCCTTGG + Intergenic
1144643166 17:16950624-16950646 TAGCCCAGCATTGGTGTCCTTGG + Intronic
1146093795 17:29908380-29908402 TACCGCAGCCTTGATCTCCTGGG - Intronic
1148052636 17:44776665-44776687 TACCCCAGCATTCCTCCCTGGGG + Intronic
1150416155 17:64990374-64990396 TACCGCAGCCTCGTTCTCCTGGG - Intergenic
1154490661 18:14919589-14919611 TACCCCAGCCCTGGTCCCATGGG + Intergenic
1155457870 18:26040199-26040221 TACCCCAGTATTGCTCACTTTGG - Intronic
1157423239 18:47563451-47563473 AACCCCAGCAGAGTTCCCCTAGG + Intergenic
1157768501 18:50324114-50324136 CACCACAGCTTTGATCCCCTAGG + Intergenic
1161164440 19:2778557-2778579 TACCCCATCCCTGTTACCCTGGG + Intronic
1162301306 19:9846688-9846710 TCACCCAGCAGTGTTCCCGTGGG + Intronic
1163382355 19:16977456-16977478 ACCCCCAGCATGGTCCCCCTTGG - Exonic
1166742724 19:45124032-45124054 TACCCCAACATTGCTCCACATGG - Intronic
925621684 2:5799806-5799828 TTTCCCAGCATTGTACCTCTTGG + Intergenic
926748750 2:16181585-16181607 GCCCCCAGCATTGTTCCCTTCGG - Intergenic
928657784 2:33471249-33471271 TACTGCAGCTTTGATCCCCTAGG + Intronic
931762563 2:65431141-65431163 GCCCCGAGCATTGTTCCCCTCGG + Intronic
932254492 2:70272571-70272593 TACTACAGCCTTGTGCCCCTGGG + Intronic
932753848 2:74391583-74391605 CAGCCTAGCATTGTTCTCCTGGG - Intronic
935217973 2:100989250-100989272 TTGCTCATCATTGTTCCCCTGGG - Intronic
936163576 2:110102326-110102348 TCCCCCAGCATACCTCCCCTAGG + Intronic
936620712 2:114094246-114094268 TACCCCAGCACTGGTTCCCAAGG + Intergenic
946259671 2:218476497-218476519 CACCACAGCATCGTTCTCCTGGG - Intronic
947996796 2:234534763-234534785 CACCCCTCCATTGTTCCCCTGGG + Intergenic
948595358 2:239076168-239076190 CAACCCAGCTCTGTTCCCCTGGG - Intronic
948940150 2:241191320-241191342 TACCCCAGCCTGCTGCCCCTGGG - Intronic
1169207536 20:3748720-3748742 TACCCCAGCAGTTTCCTCCTGGG - Intronic
1169831180 20:9827264-9827286 TACCACAGCATTGATTGCCTTGG + Intronic
1170251592 20:14289615-14289637 TACTGCAGCCTTGTTCTCCTGGG + Intronic
1170569081 20:17622752-17622774 TACCCCAGCAGCCTTCCCCTCGG - Intronic
1172071630 20:32261626-32261648 TCCCCCAGCAGCCTTCCCCTTGG + Intergenic
1172238920 20:33398848-33398870 TACTGCAGCATTGATCTCCTGGG - Intronic
1172712429 20:36936162-36936184 TACTGCAGCCTTGATCCCCTGGG - Intronic
1175454991 20:59105752-59105774 TTCTCCAGCATTCTTCCCCGGGG + Intergenic
1176074311 20:63241531-63241553 TGCCCCAGCCCTGTTCCCCCAGG - Intronic
1180725009 22:17940327-17940349 CACTGCAGCATTGATCCCCTGGG - Intronic
1180849132 22:19004049-19004071 TACCCCTGCTTTTTTCCCTTAGG + Intergenic
1181664384 22:24382233-24382255 TACCCCTGCTTTTTTCCCTTAGG + Intronic
1182764880 22:32751424-32751446 TGCCCCTCCAATGTTCCCCTGGG + Intronic
1185122246 22:48978598-48978620 TCCCCCAGCAGTGATCCCCATGG - Intergenic
950657345 3:14444891-14444913 TGCCCCCCCATTCTTCCCCTTGG + Intronic
951583623 3:24192584-24192606 CAGCCAAGCATTGTTTCCCTAGG - Intronic
952903722 3:38126341-38126363 TACCCCAACAGTTTGCCCCTAGG - Exonic
953469947 3:43158076-43158098 TACCCCTGCATTGTCATCCTTGG - Intergenic
963411077 3:144928775-144928797 CACCACAGCATTGATCTCCTGGG + Intergenic
963881260 3:150531652-150531674 AACCCAAGAATTGTTCCCCTAGG + Intergenic
967087670 3:186109174-186109196 TAGCCCAGCCTTGTTCCCATTGG + Intronic
967989487 3:195120630-195120652 TATCCCTGCAGTGTTCTCCTCGG + Intronic
974627872 4:64446934-64446956 TTCCCCATGATTCTTCCCCTAGG - Intergenic
975070134 4:70124744-70124766 TACCCCAGCAATATTCCCAGTGG + Intergenic
979499877 4:121427707-121427729 TACCCCAGGTGTGTTTCCCTTGG + Intergenic
983637196 4:169909829-169909851 TAGCCCAGCACTGCTCCCCAGGG - Intergenic
988942407 5:36159603-36159625 TACCCCAGCACTCGTGCCCTTGG + Intronic
988985944 5:36619087-36619109 TGCCCCAGCCTTGTTCCACCAGG - Intronic
990800216 5:59593703-59593725 TACCCCAGCACTGGTTCTCTTGG - Intronic
991150126 5:63358064-63358086 TACCTCAGCACTGTTTCCCATGG + Intergenic
995257422 5:110063143-110063165 TACCCCAGCTTTCTTCACCAAGG + Intergenic
996028836 5:118682771-118682793 TTCCCCTGCAATGTTCCCCATGG - Intergenic
997437797 5:133887557-133887579 GACCTCAGCTTTTTTCCCCTGGG + Intergenic
1001425716 5:171620957-171620979 TACCCCAGCTTCGTTGTCCTTGG - Intergenic
1006459383 6:34149543-34149565 TACCCCAGGATTGTTAACCCGGG - Intronic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1007155028 6:39734333-39734355 CACCTCAGCATTGCTCCCCAAGG + Intergenic
1007513323 6:42391441-42391463 TCTCCCAGAATTGTTCCCCCCGG - Intronic
1008074028 6:47127126-47127148 TACCCCAGCACTGATTCCCACGG + Intergenic
1016464401 6:144311105-144311127 TACGCCAGAATTCTTCCCCCAGG - Intronic
1018306025 6:162456659-162456681 TAACCCTGTATTTTTCCCCTAGG - Intronic
1020582488 7:10021618-10021640 AACCCAAGCACTGTTACCCTTGG + Intergenic
1022706714 7:32808620-32808642 TACCACAGCCTTGATCTCCTGGG - Intergenic
1023090057 7:36609046-36609068 TCCCCCAGCATCCTTCCTCTGGG - Intronic
1024727467 7:52214662-52214684 TGCCCCAGCACTGATCCCCATGG - Intergenic
1025607360 7:63048892-63048914 TACCCCAAACTTGGTCCCCTTGG + Intergenic
1026097689 7:67359371-67359393 TACCCCAGCCTCGGTCTCCTAGG - Intergenic
1036120831 8:6015597-6015619 TAACCCAGCATTCTACTCCTAGG + Intergenic
1038937613 8:32269529-32269551 TGCCCCATCCTTGTTCCCCATGG - Intronic
1039135068 8:34312754-34312776 TACCCCTGCACTGTTCCAATTGG + Intergenic
1041045535 8:53882735-53882757 AACCCCAGCCTTGGTGCCCTCGG + Intronic
1042729255 8:71913193-71913215 TTCACCAGCATTCTTTCCCTGGG - Intronic
1043562095 8:81505235-81505257 TGCAACAGCATTGTTCTCCTAGG + Intergenic
1046446847 8:114332532-114332554 TGCCCAACCATTGTTCCCATTGG - Intergenic
1049942275 9:558370-558392 TAACTCTGTATTGTTCCCCTAGG - Intronic
1051398032 9:16647528-16647550 TACACAATCATTTTTCCCCTAGG + Intronic
1051810845 9:21048000-21048022 TTCCACAGCATTCTTTCCCTGGG - Intergenic
1052999483 9:34569780-34569802 GACCCCAGCCATGTGCCCCTAGG + Intronic
1053344462 9:37368044-37368066 CACCACAGCCTTGTTCTCCTGGG - Intergenic
1057309190 9:93931210-93931232 TAGCCCAGCCTTGTCCCCATAGG + Intergenic
1192380472 X:70611379-70611401 TACTCCAGCATTGGTTCCCATGG - Intronic
1195233901 X:102878128-102878150 TTCCCCAGTATTGTTCCCTAAGG - Intergenic