ID: 920976092

View in Genome Browser
Species Human (GRCh38)
Location 1:210786711-210786733
Sequence CAGTTCCATTTTTAGATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920976092_920976094 -9 Left 920976092 1:210786711-210786733 CCACAGATCTAAAAATGGAACTG 0: 1
1: 0
2: 1
3: 16
4: 306
Right 920976094 1:210786725-210786747 ATGGAACTGGTCCTCCTTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 120
920976092_920976095 -8 Left 920976092 1:210786711-210786733 CCACAGATCTAAAAATGGAACTG 0: 1
1: 0
2: 1
3: 16
4: 306
Right 920976095 1:210786726-210786748 TGGAACTGGTCCTCCTTCCTGGG 0: 1
1: 0
2: 1
3: 24
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920976092 Original CRISPR CAGTTCCATTTTTAGATCTG TGG (reversed) Intronic
901207128 1:7503713-7503735 CAGCTCGATTCTTAGATGTGTGG + Intronic
901344813 1:8530644-8530666 CAGTTCCATGTCTAGATATGCGG - Intronic
905781252 1:40711971-40711993 AGGTTCCATTTTTACATGTGAGG - Intronic
906446177 1:45900245-45900267 TAGTTCTATTTTTAGTTCTGTGG + Intronic
907676381 1:56521404-56521426 CAGCTCTATTTTTAGCTCTAAGG - Intronic
908604612 1:65782385-65782407 CAGTTTCATTTTTCTATATGTGG - Intergenic
911962280 1:104320708-104320730 CAGTTTCATTTTTTTATATGTGG + Intergenic
912103631 1:106242976-106242998 TTGTTCCATTTTTAAATCTAGGG + Intergenic
912663480 1:111557077-111557099 CATTTCTCTTTGTAGATCTGTGG - Intronic
914694609 1:150065692-150065714 CAGTTCTATTTTTAGAGGTATGG + Intergenic
914722844 1:150303614-150303636 TAGTTCCATTTTGTGATCTTGGG + Intronic
915589072 1:156860561-156860583 CAGCTGCATTTTTACATTTGGGG - Intronic
917919521 1:179739393-179739415 CTGGTCCTTTTTCAGATCTGTGG - Intergenic
918067892 1:181113691-181113713 CAGTTGCATTTAGAGACCTGAGG + Intergenic
918752979 1:188296254-188296276 CAGTTTCACTTTGAGATATGAGG - Intergenic
920221970 1:204410932-204410954 AAGCTCCAATTTTAGGTCTGGGG + Exonic
920976092 1:210786711-210786733 CAGTTCCATTTTTAGATCTGTGG - Intronic
921668213 1:217898022-217898044 CAGGTTCATTATTAGACCTGGGG + Intergenic
921853254 1:219953238-219953260 GAGTTCCCTTTCTAGATCGGAGG - Intronic
922437114 1:225617145-225617167 CATTTGCATTTGTTGATCTGAGG - Intronic
922718709 1:227889568-227889590 GAGTGGCATTTCTAGATCTGAGG - Intergenic
923779734 1:237011580-237011602 CAGTTCTATATTTAGCTCTTTGG + Intergenic
924274933 1:242376205-242376227 CAGTTCCATTTTGAGGAATGGGG - Intronic
1065182090 10:23136402-23136424 CAGTTCTTTTCTTAGCTCTGTGG - Intergenic
1065762768 10:28998092-28998114 CAGTTCCATTTTGAGGAATGGGG + Intergenic
1066320002 10:34293040-34293062 TTGTTTGATTTTTAGATCTGTGG - Intronic
1066708471 10:38206062-38206084 TAGTTCTATTTTTAGTTTTGAGG - Intergenic
1067459432 10:46446562-46446584 TAGTTCCGTTTTTAGGTCTTTGG - Intergenic
1067627762 10:47938068-47938090 TAGTTCCGTTTTTAGGTCTTTGG + Intergenic
1070249797 10:74764020-74764042 CAGCTGCAATTTTAAATCTGGGG + Intergenic
1073198328 10:101713741-101713763 TAGTTCCAATTTTAATTCTGAGG + Intergenic
1073369103 10:102970600-102970622 CAGTTCCTTTTTTAGAGATAGGG + Intronic
1073929496 10:108557894-108557916 AATTTCCATTTTTACATCTTTGG - Intergenic
1078364714 11:10697016-10697038 CAGTTCCTTTTTTAGAACTGTGG - Intergenic
1079061887 11:17256128-17256150 CAGCTCCATTTTTAAATCATGGG + Intronic
1079463844 11:20709236-20709258 CAGTTTCATTATTCGACCTGGGG + Intronic
1079962605 11:26942513-26942535 CATTTCCATTTTTACATTTTCGG + Intergenic
1080079312 11:28195899-28195921 CAGTTTCATTTTTCTATATGTGG + Intronic
1080705013 11:34682657-34682679 CTGTTCCACTTTTAGCTGTGTGG - Intergenic
1080734339 11:34997080-34997102 CATTTTAATTTTTATATCTGAGG + Intronic
1080829553 11:35878644-35878666 CACTTCCCTTTTTACAGCTGAGG + Intergenic
1081642941 11:44769970-44769992 CATCTCAATTTTTACATCTGCGG + Intronic
1083495694 11:63050923-63050945 CAGTTCCATTTTGAGGAATGGGG - Intergenic
1086087116 11:82966743-82966765 CATTTCCATTTTTATCTCTCTGG - Intronic
1086497189 11:87416541-87416563 TAGTTCTATTTTTAGTTTTGTGG - Intergenic
1086619977 11:88875896-88875918 CTGTTCCATTTTTAGAGCACAGG + Intronic
1086886149 11:92208187-92208209 CATTTCCATTTTTATAAATGAGG + Intergenic
1087033668 11:93733486-93733508 CAGGACTATTGTTAGATCTGTGG - Intronic
1087601357 11:100320100-100320122 TAGTTCCATTTTTAATTTTGGGG + Intronic
1087904382 11:103678751-103678773 CAGTGTCATTATTTGATCTGTGG - Intergenic
1088772590 11:113050077-113050099 CTATTCCATTTTTTGCTCTGTGG + Intronic
1090585769 11:128210869-128210891 AAGTTTTATTTTTATATCTGTGG - Intergenic
1092177573 12:6421150-6421172 AAGTTCCACTTCTAGATCTCTGG - Intergenic
1092373260 12:7934646-7934668 CAGCTCAATTTTTATACCTGAGG + Intronic
1094211677 12:27899973-27899995 CAGTTCTATTTTTAATTCTTTGG - Intergenic
1094433333 12:30394704-30394726 CAGTGCCTTTTTTAGATCCAGGG - Intergenic
1094522273 12:31204915-31204937 AAGTTCACTTTTGAGATCTGGGG - Intergenic
1095859543 12:46901250-46901272 CAGTTTCATTTTCAGTTCAGTGG - Intergenic
1096285187 12:50293797-50293819 GATTTTGATTTTTAGATCTGGGG - Intergenic
1097465716 12:59922261-59922283 TAGTTCTGTTTTTAGCTCTGAGG - Intergenic
1098443330 12:70540804-70540826 CAGTTGCATTTTTAAAGTTGTGG + Intronic
1098802657 12:74981705-74981727 CTGTTCCCTGCTTAGATCTGAGG - Intergenic
1101299071 12:103459228-103459250 TAATTCACTTTTTAGATCTGTGG - Intronic
1106546571 13:30735896-30735918 CAGTCCCATTTTTAGAGCCAGGG + Intronic
1106893433 13:34271454-34271476 CATTTTTATTTTTAGTTCTGGGG + Intergenic
1108800968 13:54093571-54093593 CAGTTCTATTTTTATTTCTTTGG + Intergenic
1109231591 13:59764342-59764364 CAGTCCCATTTTCAGCTCTATGG + Intronic
1109386840 13:61640856-61640878 TAGTTCTATTTTTAGTTCTTTGG + Intergenic
1110265653 13:73534661-73534683 CATTTTTATTTTTAGTTCTGGGG + Intergenic
1110272840 13:73610254-73610276 TATCTCCATTTTTAGATGTGAGG + Intergenic
1110397441 13:75048061-75048083 CAGTTTTATTTTTAGTTCTTTGG - Intergenic
1110718638 13:78736804-78736826 AAGTTCAATTTTAAGATTTGGGG - Intergenic
1111193039 13:84834107-84834129 CAGTTTCATTCTTCGATATGCGG + Intergenic
1111717479 13:91897107-91897129 CAGTTCCATTTTATGGTCTGTGG - Intronic
1111718733 13:91914473-91914495 AAATTTCATTTTTAGATGTGAGG + Intronic
1111764097 13:92505217-92505239 CAGCTCCCTTTTCAGATATGTGG - Intronic
1112176177 13:97027404-97027426 CATCTCCATTTTTGGTTCTGTGG - Intergenic
1112400222 13:99070820-99070842 CATTTCTATGTTTAGAACTGAGG + Intronic
1113175939 13:107564198-107564220 CAGTTGCATATTTAAATTTGAGG - Intronic
1114669199 14:24399765-24399787 CAGTCCCACTTTTCCATCTGGGG + Intronic
1114918397 14:27295881-27295903 CAGATATATTTTTAAATCTGTGG + Intergenic
1116229811 14:42202053-42202075 CAGTTTCATTTTTTGACTTGGGG - Intergenic
1116671850 14:47852108-47852130 CATTTTTATTTTTAGTTCTGGGG - Intergenic
1117102080 14:52360072-52360094 CAGTTGCCTTTTTACAACTGTGG - Intergenic
1118213759 14:63788808-63788830 TAGTTCTATTTTTAGTTCTGGGG - Intergenic
1119560181 14:75583641-75583663 CAGTTCCCTTATTAGGTCCGAGG - Intronic
1120984792 14:90325145-90325167 TAGTGCCATTTTTTGATTTGTGG + Intronic
1121967312 14:98322466-98322488 AAGTCTCATTCTTAGATCTGAGG - Intergenic
1123770543 15:23524157-23524179 AATTTACATTTTTATATCTGTGG + Intergenic
1124012761 15:25851889-25851911 CAGTTTTATTTTTAGAGATGAGG - Intronic
1126214179 15:46135407-46135429 CATTTCCATTTTTAAATGCGGGG + Intergenic
1126324957 15:47466705-47466727 CAGTTCTGTTTTTAGGTGTGTGG + Intronic
1126995656 15:54440700-54440722 TAGTTCTATTTTTAGATTTTGGG + Intronic
1127080327 15:55371687-55371709 CAGTGCCATTATTAAATGTGTGG - Intronic
1128005543 15:64236737-64236759 TAGTTCTATTTTTAGTTCTTTGG - Intronic
1129802457 15:78425747-78425769 TAGTTCTATTTTTAGTTTTGAGG + Intergenic
1131414338 15:92240035-92240057 CAGTTCCATTCTTCTACCTGTGG - Intergenic
1131426133 15:92346826-92346848 CACGTCCATTTGTAGGTCTGAGG + Intergenic
1133140824 16:3742818-3742840 ATGTTCCATTTCTAGATCTTGGG + Intronic
1133551936 16:6864835-6864857 CATTTCCCTTTTTTTATCTGAGG + Intronic
1134378880 16:13705608-13705630 CAGTTTCATTATTACATTTGCGG - Intergenic
1138975072 16:62196179-62196201 CATTTTCTTTTTTAGATTTGGGG + Intergenic
1139162097 16:64522543-64522565 CATTTCTGTTTTTAGATCTTTGG - Intergenic
1139379402 16:66521132-66521154 CAGTTCCATGATCATATCTGTGG - Intronic
1141036109 16:80627608-80627630 CAGTTACATTATTAAATTTGGGG - Intronic
1141500694 16:84442420-84442442 CTGTCCCATTTTTACAGCTGGGG - Intronic
1141965817 16:87442242-87442264 CAGCTCCATTTTCCGAGCTGTGG - Intronic
1143148788 17:4794205-4794227 CTCTTACATTTTTAGGTCTGTGG - Intergenic
1144474043 17:15569181-15569203 TAGTTCTATTTTTAGTTCTTTGG + Intronic
1144891858 17:18498956-18498978 GTGTTCCATTTTTCCATCTGTGG - Intergenic
1144943198 17:18955525-18955547 CAGTTGCCTTCTTATATCTGGGG - Intronic
1145140364 17:20445361-20445383 GTGTTCCATTTTTCCATCTGTGG + Intergenic
1145870518 17:28269686-28269708 CAGTTCAACCTTTGGATCTGGGG - Intergenic
1146812230 17:35913233-35913255 CAGTTCAACCTTTGGATCTGGGG - Intergenic
1147232874 17:39031813-39031835 CAGTTCAACCTTTGGATCTGGGG + Intergenic
1148174007 17:45548686-45548708 CAGTTCAACCTTTGGATCTGGGG - Intergenic
1148275260 17:46296761-46296783 CAGTTCAACCTTTGGATCTGGGG + Exonic
1148297366 17:46514340-46514362 CAGTTCAACCTTTGGATCTGGGG + Exonic
1148361920 17:47018820-47018842 CAGTTCAACCTTTGGATCTGGGG + Intronic
1150405221 17:64895608-64895630 CAGTTCAACCTTTGGATCTGGGG - Exonic
1150900322 17:69268068-69268090 CAGTTCCATTTGTTACTCTGTGG - Intronic
1151043214 17:70888321-70888343 CAGATACACTTTGAGATCTGGGG - Intergenic
1151081112 17:71329909-71329931 CAGAACCATTTTTAGACATGAGG + Intergenic
1153088979 18:1322053-1322075 TAGGCCCTTTTTTAGATCTGGGG + Intergenic
1156192509 18:34735685-34735707 TATTTTCATTTTTAGTTCTGGGG + Intronic
1157021906 18:43793144-43793166 TTGTACCATATTTAGATCTGGGG - Intergenic
1157023374 18:43813927-43813949 CTTTTCCATTTTTTCATCTGAGG - Intergenic
1158345756 18:56515321-56515343 CAGTTCTGTTTCTAGATCAGGGG + Intergenic
1158359968 18:56660954-56660976 CATTTCCATTTTAAACTCTGAGG - Intronic
1158615762 18:58985156-58985178 CAGTTCCATTTTGAGGAATGGGG + Exonic
1160487210 18:79304517-79304539 CATTTCCAATTTTAGATTTTTGG + Intronic
1161674730 19:5639058-5639080 TTGTTCCAGTTTTAGATATGTGG - Intronic
1162929135 19:13947700-13947722 TAGTGCCATTTTTTGATATGAGG - Intronic
1165861864 19:38913366-38913388 CAGGTCCTCTTTTAGACCTGAGG + Intergenic
1165882022 19:39051046-39051068 CAATTTTATTTTTAGAGCTGAGG + Intergenic
1167069245 19:47210248-47210270 CAGTTGCCTTTTCAGACCTGAGG + Intronic
925695582 2:6574562-6574584 CACTTCCATTCACAGATCTGAGG - Intergenic
926952870 2:18262445-18262467 CAGTTCCATTTTGAGGAATGGGG + Intronic
927391537 2:22601079-22601101 CAGCTACATTTTTAGACCTCAGG - Intergenic
927614914 2:24583492-24583514 CAGTTATATTTTTAGTTTTGAGG - Intronic
928868261 2:35944727-35944749 CAGTTCTGTTTATAGTTCTGAGG - Intergenic
930886289 2:56330821-56330843 TAGTTCTATTTTTAGTTCTCTGG - Intronic
931120342 2:59210732-59210754 CAGTTCCATTCTGAGATCCTGGG + Intergenic
933367491 2:81372192-81372214 CAGTACTATTTTTAACTCTGTGG + Intergenic
933786866 2:85850171-85850193 CAGTTCCTTTTTCAGAAATGGGG - Intronic
935151426 2:100440094-100440116 CAGGTACATGTTTAGCTCTGTGG - Intergenic
935726331 2:106027181-106027203 TAGTTCTATTTTTAGTTCTTTGG - Intergenic
935826251 2:106953338-106953360 GAGTTGCATTTTGGGATCTGGGG - Intergenic
937700099 2:124854402-124854424 AAATTCCATTTTTTAATCTGAGG + Intronic
937760645 2:125598512-125598534 TAGTTCTATTTTTAGCTCTTTGG + Intergenic
938996807 2:136688118-136688140 CAGTTCCATTCTTCTATATGTGG - Intergenic
939219712 2:139286199-139286221 CAGTTCCATTTTTCTACATGTGG - Intergenic
939469756 2:142606233-142606255 CAGTTTAATTTATAGATTTGTGG - Intergenic
940274395 2:151923778-151923800 CAGATCAATTTTTAGAGGTGAGG - Intronic
940344141 2:152612105-152612127 AAGTTCCACTTTTAGTTCTTAGG + Intronic
940683268 2:156813408-156813430 TAGTCCCATTTTTAAAACTGTGG + Intergenic
941244053 2:163074748-163074770 AAGTACCATTTTTATATTTGGGG + Intergenic
941342208 2:164320838-164320860 TAGTTCTATTTTTAGTTCTTTGG + Intergenic
941377119 2:164745425-164745447 AATTTCAATTTTTAAATCTGCGG + Intronic
942427199 2:175872535-175872557 TGGTTCAATTTTTAGATCTTGGG - Intergenic
943152358 2:184130536-184130558 CAGTTACATTATTATATATGAGG - Intergenic
944090949 2:195910991-195911013 CAGTTTCATATTTATCTCTGAGG - Intronic
944132339 2:196360144-196360166 CAGTTCTGTTTTTAGCTCTTTGG - Intronic
945058946 2:205891825-205891847 CAGTTCCCTTTTGTTATCTGGGG - Intergenic
945466687 2:210177688-210177710 CAAGTCCATTGTTAGATATGTGG - Intergenic
945638708 2:212394444-212394466 CAGTTTTATTATTATATCTGAGG - Intronic
946292867 2:218758937-218758959 CTGTTCCTTTTTTATATCTAAGG - Intergenic
947059315 2:226144748-226144770 CAGTTACATTGTGAGATCTTTGG - Intergenic
947931282 2:233967352-233967374 CAGTTCCAGTTGTAGAAATGTGG + Intronic
948386951 2:237586348-237586370 TAGGTCCATTTTTAGGTCTGTGG + Intronic
1169322284 20:4643433-4643455 CTGTTCCATTTTTAGAGCACAGG - Intergenic
1172101723 20:32487715-32487737 GAGTTACGTTTTTAGATCAGGGG + Intronic
1172790702 20:37503448-37503470 CAATGCCATTTTCAGAGCTGGGG - Intronic
1173206645 20:41000293-41000315 TAGTTCCATTTTTAATTTTGGGG - Intergenic
1174333438 20:49839928-49839950 CAATTCCATTTTGACAACTGAGG + Intronic
1174390283 20:50214661-50214683 CAGTGCCATTCTAAGAGCTGAGG - Intergenic
1174409867 20:50328272-50328294 CAGTTCCACTTATAGGTCTGGGG + Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1177916681 21:27097282-27097304 CAGTTTCATTTTTAATTTTGGGG + Intergenic
1177917768 21:27111780-27111802 CAGTTACTGTTTTAGATCAGTGG - Intergenic
1180106706 21:45623410-45623432 CAGTCCCATTCTGAGGTCTGGGG - Intergenic
1181090359 22:20468332-20468354 CAGTCCTATTTTTAGAGCAGTGG + Intronic
1182194282 22:28498644-28498666 CAAAACCATTTTTTGATCTGAGG + Intronic
1185343725 22:50302500-50302522 CAGTTCCACATCTAGACCTGGGG - Intronic
950382147 3:12625592-12625614 TTGTTCCAATTTTAGTTCTGTGG - Intronic
951304998 3:21048762-21048784 CAGTTTCTTTTTTAGAGCAGTGG + Intergenic
953039242 3:39240122-39240144 TATTTCTATTTTTAGCTCTGAGG + Intergenic
953225687 3:41017428-41017450 GAGTGCCCTTTTGAGATCTGAGG + Intergenic
953229681 3:41053535-41053557 CAGTTCCATTGTGAGTGCTGTGG - Intergenic
955786770 3:62549384-62549406 CAGTTTCATTTTTGGGTCTTCGG + Intronic
956180404 3:66512687-66512709 TTGTTCCATTTCTAGATCAGAGG + Intergenic
957174149 3:76783751-76783773 CATTTCAATATTTAGATTTGGGG + Intronic
960703601 3:120460664-120460686 TAGTTCCTTTTTTAAATGTGAGG + Intergenic
961232383 3:125327912-125327934 CAGTTACATTTTTTGATAGGAGG - Intronic
961925729 3:130478312-130478334 CAGTGCCAGTTTTAGTTCTGTGG + Intronic
961972415 3:130984085-130984107 CAATTCCATTTTTATAGATGAGG + Intronic
964345503 3:155750818-155750840 CATTTCCATTTGTAGACTTGTGG - Intergenic
966494547 3:180565061-180565083 CAGTTCTATTTTAACTTCTGTGG + Intergenic
970012262 4:11471890-11471912 CATTTTCATTTTGAGATATGAGG - Intergenic
971631725 4:29000906-29000928 CAGATCCATTTTTTGATTTAGGG + Intergenic
972154676 4:36145126-36145148 TAGTTCTATTTTTAGTTCTTTGG - Intronic
974097000 4:57374643-57374665 CAGTTTCAATCTTACATCTGTGG - Intergenic
974830549 4:67183071-67183093 CAGTTCAATTATTATAACTGGGG + Intergenic
975903533 4:79181814-79181836 CACTTCCATCTGTGGATCTGTGG + Intergenic
976717677 4:88140093-88140115 CAAGTCCATTTTTAAATGTGCGG + Intronic
977254026 4:94720287-94720309 TAGTTCCATTTTTAGTTTTTTGG - Intergenic
978312054 4:107395452-107395474 CAGCCCCATTTTTAAATATGAGG - Intergenic
978967835 4:114763702-114763724 CAGTTTCATTCTTAATTCTGTGG + Intergenic
979181154 4:117729131-117729153 CGTTTCCATTTCTAGAACTGTGG + Intergenic
979342616 4:119544504-119544526 CAGTTCCATATTTATATTTTGGG - Intronic
979933718 4:126665580-126665602 CTGTTCCATTTATAGAACAGAGG - Intergenic
980040051 4:127928688-127928710 CAGTTCCATTTTAAGTTTTTAGG - Intronic
980196468 4:129595421-129595443 TAGTTCCATTTTTAATTTTGGGG - Intergenic
981094939 4:140769472-140769494 CAGTTCCTTTCTAAAATCTGTGG + Intergenic
981557913 4:146015512-146015534 CAGTTCCATTTTCAGGAATGTGG + Intergenic
982167220 4:152625171-152625193 CATTTCCATTGCTAGAGCTGCGG + Exonic
982942999 4:161582593-161582615 CAGTACCAATTTTAGGGCTGTGG + Intronic
982988274 4:162238203-162238225 CAGTTCCATTTCTATGTCTTAGG - Intergenic
983400282 4:167254951-167254973 CAGTTTCATTTTTGTATATGTGG + Intergenic
983440280 4:167773794-167773816 TAGTTCCAGTTTTAAATTTGGGG + Intergenic
985281878 4:188295166-188295188 CATTTACATTTAGAGATCTGGGG + Intergenic
986517962 5:8582962-8582984 CAGGTCCCTTTTTGGATATGTGG - Intergenic
986893231 5:12334458-12334480 CAGTTTCATTTTTTTACCTGTGG + Intergenic
987030013 5:13967374-13967396 CAGTTTCATTCTTATATATGTGG + Intergenic
987456988 5:18159378-18159400 CATTTCCGTTTTTTAATCTGAGG + Intergenic
988091621 5:26548391-26548413 GAGTTACATTGTTAGATATGTGG + Intergenic
989355046 5:40534517-40534539 CAGTTTCATTTTTCTATGTGTGG + Intergenic
989461171 5:41700076-41700098 CAGTTCAATTTTTAGATAGGAGG - Intergenic
992047574 5:72909693-72909715 AAGTTCCTTTTTAAGATTTGTGG + Exonic
993912537 5:93702091-93702113 TAATTCCATTTTTACATTTGGGG - Intronic
994647530 5:102489693-102489715 TAGTTCTATTTTTAGTTTTGAGG - Intronic
995378302 5:111502908-111502930 CAGTTCTCTTATTAGATTTGAGG - Intronic
995836716 5:116406720-116406742 CATTTCCATTTCCAGCTCTGAGG + Intronic
995986891 5:118187572-118187594 CACTTCAATTTTTTGCTCTGAGG - Intergenic
996842202 5:127859572-127859594 CAGTGTAATTTTTAAATCTGGGG + Intergenic
997658524 5:135573053-135573075 CAGGGCCATGTTTAGACCTGTGG + Intronic
999137334 5:149331048-149331070 CAGTTCCATTCTTTGCCCTGAGG - Intronic
1000250604 5:159491366-159491388 CAGATCCATGTTAAGATTTGTGG + Intergenic
1000563420 5:162818735-162818757 AAATTCAATTTTTGGATCTGTGG + Intergenic
1001364331 5:171121865-171121887 CAGTGCCATCTTGAGATCAGAGG - Intronic
1003074018 6:2967891-2967913 TAGTTCTGTTTTTAGCTCTGAGG - Intronic
1004340034 6:14799988-14800010 GAGTTCCATTGTTAGAGATGGGG - Intergenic
1004879228 6:19989703-19989725 CAGTTGCCTTTTTATTTCTGGGG + Intergenic
1006888561 6:37403150-37403172 TAGTTCTATTTTTAGTTCTTTGG + Intergenic
1007063057 6:38960712-38960734 CAGTTCTATTTTTAGTTTTTTGG - Intronic
1007190557 6:40013342-40013364 TAGTTCCATTTTTAGTTTTGAGG + Intergenic
1007335373 6:41151561-41151583 CAGTGCCATTTCCTGATCTGTGG - Intronic
1009745375 6:67806690-67806712 TAGTTCCATTTTTAGTTTTTTGG - Intergenic
1009955081 6:70444015-70444037 CACTTCCATTTTAAGAGTTGTGG - Intronic
1010621627 6:78083816-78083838 CAGTGACATTTTTGGAACTGGGG + Intergenic
1010805791 6:80234635-80234657 CAGTTCTATTTTTAGTTTTCTGG - Intronic
1011565955 6:88671905-88671927 CAGTTTCATTTTTCTACCTGTGG - Intronic
1012669134 6:102018184-102018206 CAGTCCTATTATTAGATCTCAGG + Intronic
1012902420 6:105021410-105021432 TAATTCCATTTTTAGTTCTTTGG + Intronic
1013658205 6:112267291-112267313 CAGTTCCCTTTTTACAGATGCGG - Intergenic
1015653783 6:135494419-135494441 CAGCTCCATTTTCAGATCCTTGG + Intronic
1016408771 6:143760090-143760112 CAGTTCCAGCCTTGGATCTGGGG - Intronic
1017220869 6:151963867-151963889 CACTTCCATTTTTTTATATGTGG + Intronic
1017809071 6:157971129-157971151 CAGTTACATTTTGAGATCCTGGG + Intergenic
1018302954 6:162423104-162423126 CAGTTACATTTTTATATGTAAGG - Intronic
1018453904 6:163935252-163935274 TAGTTTCATTTTAAGATCTTGGG + Intergenic
1018831529 6:167447442-167447464 CAGTCCCATTATTATTTCTGTGG + Intergenic
1020589629 7:10118363-10118385 TAGTTCCATTTTTAGTTCTTTGG + Intergenic
1021752823 7:23821188-23821210 TAGTTCCATTTTTAGTTTTTTGG + Intronic
1022998857 7:35786840-35786862 CAGTTCCATTTTGAGGACTAGGG - Intergenic
1023461325 7:40400510-40400532 CAGTTCTATTTTTAGTTAAGAGG + Intronic
1027874754 7:83754757-83754779 TAGCTCCATTTTTACATCTCTGG + Intergenic
1028123754 7:87087659-87087681 TAGTTCCATTTTTAATTATGGGG + Intergenic
1028628483 7:92905118-92905140 CAGCTCCATTACTTGATCTGGGG + Intergenic
1029519123 7:101049053-101049075 CTGTTCCCTTGTTAGATGTGCGG + Intronic
1029938222 7:104451105-104451127 CCGTTCCATTTTCAGTTCTCTGG - Intronic
1031203505 7:118722715-118722737 CACTTTCTTTTTTATATCTGAGG + Intergenic
1031498596 7:122482739-122482761 CAGTTCCATCTTTTGAACTCAGG - Intronic
1031517081 7:122714422-122714444 CATTTCCATTTTAAAATCTTTGG + Intronic
1031772720 7:125865230-125865252 AAGTTCCATTAGGAGATCTGTGG - Intergenic
1032223575 7:130012219-130012241 CTGTTCCATTTTTACAAATGAGG - Intergenic
1032329475 7:130964301-130964323 CATTTCCCATTTTAGAGCTGAGG - Intergenic
1034698899 7:153079724-153079746 CAGTTCTATTTTTAGTTCTTTGG + Intergenic
1036484512 8:9167074-9167096 AAGTTTAATTTTTAGTTCTGCGG - Intronic
1039665356 8:39520638-39520660 AAGCTCTATCTTTAGATCTGGGG + Intergenic
1040630702 8:49206861-49206883 TAATTCTATTTTTAGGTCTGGGG + Intergenic
1043234219 8:77841170-77841192 CAGTTCCATTTCTACATTAGTGG - Intergenic
1044451261 8:92338072-92338094 CAGTTTCATTCTTCGATATGTGG - Intergenic
1044477887 8:92649779-92649801 CAGTTACATTTTTTTTTCTGAGG - Intergenic
1046131077 8:109969454-109969476 CTTTTCCATTCCTAGATCTGAGG + Intronic
1046233035 8:111382696-111382718 CAGTTCCATTCTTCTATATGTGG + Intergenic
1046394962 8:113630082-113630104 CAGTTTCATTTTTCTACCTGTGG - Intergenic
1046534708 8:115494061-115494083 CAGTCCCATTGTTAAATCTAGGG - Intronic
1048049546 8:130804456-130804478 CAGTTACATTTTGAGATCCTTGG + Intronic
1048682900 8:136865943-136865965 CAGTTCCATTTTGAGGAATGGGG + Intergenic
1049293036 8:141813957-141813979 CACTTCAAACTTTAGATCTGAGG + Intergenic
1051572636 9:18577569-18577591 AAGCTCCATTTTTCAATCTGTGG + Intronic
1051675813 9:19557171-19557193 CATATCTATTTTTAGAACTGAGG - Intronic
1051799572 9:20917340-20917362 AAATTCAATTTTTAGATATGCGG - Intronic
1052390488 9:27873263-27873285 AAGGTCCATGTTTAAATCTGAGG + Intergenic
1053542531 9:38989265-38989287 TAGTTCTGTTTTTAGTTCTGTGG + Intergenic
1053806983 9:41812782-41812804 TAGTTCTATTTTTAGTTCTGTGG + Intergenic
1054623609 9:67374645-67374667 TAGTTCTATTTTTAGTTCTGTGG - Intergenic
1054717329 9:68569148-68569170 CAGTCCCATTTTTATAGATGAGG + Intergenic
1055830176 9:80368944-80368966 CAGTTGCCTTTCTATATCTGTGG - Intergenic
1056754767 9:89374747-89374769 CTGTTACATTTTTAAATGTGAGG - Intronic
1058169658 9:101665187-101665209 GAGTTTCATTTTTAGATTTGGGG + Intronic
1059530443 9:115030604-115030626 CAGTTCTTTTTTCTGATCTGAGG + Intronic
1061897342 9:133655346-133655368 CAGTTCCCTTTTGATGTCTGTGG + Intronic
1062434972 9:136542984-136543006 CAGTGCCCATTTTACATCTGAGG + Intronic
1185895574 X:3855518-3855540 CAGATCTATTTTTAGTTCTTTGG + Intergenic
1185900693 X:3893942-3893964 CAGATCTATTTTTAGTTCTTTGG + Intergenic
1185905809 X:3932381-3932403 CAGATCTATTTTTAGTTCTTTGG + Intergenic
1186320082 X:8414598-8414620 TAGTTCTATTTTTAGTTCTTTGG - Intergenic
1188930852 X:36109336-36109358 TAGTTCCATTTTTAGGTCTTTGG + Intronic
1188967711 X:36575651-36575673 GAGTTGCATATTTAGATCTAGGG - Intergenic
1191212230 X:57898028-57898050 TAGTTCTATTTTTAGTTCTTCGG - Intergenic
1192149597 X:68703968-68703990 CAATTCCATTTCTAGTGCTGTGG + Intronic
1192301809 X:69912714-69912736 TTGTTCCATTTCTAGAGCTGAGG + Intronic
1193227638 X:79003297-79003319 CAGTTCCATTTTTATATTTATGG - Intergenic
1193487993 X:82110946-82110968 CAGCTCAATTTTTAGTTTTGAGG + Intergenic
1193908192 X:87268568-87268590 CTGTTTCATTTTTAGAGATGGGG - Intergenic
1194449214 X:94022445-94022467 TAATTCTATTTTTAGATTTGAGG - Intergenic
1197056318 X:122124123-122124145 CAGTTCTATTTTTAGTTTTCTGG - Intergenic
1198955817 X:142129142-142129164 CCATTCCCTTATTAGATCTGTGG + Intergenic
1199111823 X:143944642-143944664 CTGTTCCATTTGCAGATCTTTGG - Intergenic
1199937418 X:152588557-152588579 CTGCTACATTTGTAGATCTGAGG + Intergenic
1201381912 Y:13389529-13389551 TAATTCCATTTTTATATATGTGG + Intronic
1201549250 Y:15202122-15202144 TAGTTCTATTTTTAGTTCTTTGG - Intergenic