ID: 920986707

View in Genome Browser
Species Human (GRCh38)
Location 1:210897525-210897547
Sequence TGGAGCTGCTGTGGAACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 406}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920986707_920986711 -9 Left 920986707 1:210897525-210897547 CCCTCTGTTCCACAGCAGCTCCA 0: 1
1: 0
2: 3
3: 46
4: 406
Right 920986711 1:210897539-210897561 GCAGCTCCAACAGGCTCCCCTGG 0: 1
1: 0
2: 0
3: 34
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920986707 Original CRISPR TGGAGCTGCTGTGGAACAGA GGG (reversed) Intronic
900091123 1:921155-921177 TGGGGCTGCCATGGAGCAGACGG - Intergenic
900158277 1:1212134-1212156 TGCAGCTGTTGGGGAACAGGAGG + Exonic
901191192 1:7410777-7410799 TGCAGATGCTGTGGAAAAGCAGG + Intronic
901258254 1:7850633-7850655 AGGAGCTGCTGGGGAAAAGAAGG + Intronic
901417385 1:9127285-9127307 TCCAGCTTCTGTGGAAAAGAAGG - Intronic
902373488 1:16019235-16019257 TGGAGCTGATCTGGGACGGAAGG - Intronic
904002686 1:27347839-27347861 TGAGGCTGCTGTGAAAGAGAAGG + Exonic
904435201 1:30490476-30490498 GGGTGCTGGTGTGGAACAGATGG + Intergenic
904783653 1:32969259-32969281 TGCAGTTGCTGTGGTACAAAGGG - Intergenic
905028876 1:34868504-34868526 TGGGGCTGCAGTGTAACAGGAGG - Intronic
906192647 1:43907914-43907936 TGGAGAGGCTGAGAAACAGACGG - Intronic
906196089 1:43931680-43931702 TGGGGATGCTGGGGAAGAGAGGG - Intergenic
906525118 1:46489359-46489381 TGCAGGTGGTGTGGAACTGATGG + Intergenic
907480221 1:54740698-54740720 TGGGCCTGCTTTGGGACAGAGGG - Intronic
908341265 1:63181929-63181951 TGGAGAGGATGTGGAAAAGAAGG + Intergenic
910650769 1:89564430-89564452 TGGAGAGGCTGTGTAGCAGATGG + Intronic
912547343 1:110460470-110460492 GGGAGCTGAAGTGGAAAAGATGG + Intergenic
915556208 1:156662128-156662150 GGGAGCTGCTGTGTCACAGCAGG - Intergenic
916125254 1:161564795-161564817 TGGAGCTGCAGTGGAGTAAATGG + Intergenic
916670497 1:167014379-167014401 TGGAGCTGCTCTTGTACATAAGG + Intronic
917364037 1:174209335-174209357 TGGACCTGCCCTGGACCAGAGGG + Intronic
918043434 1:180926988-180927010 TGGGGCTGCTGGGGAGCAGGAGG - Intronic
918369456 1:183844692-183844714 TGGAACTTCTGGGGAACAGATGG + Intronic
919194824 1:194270971-194270993 TTTAGTTGCTTTGGAACAGAGGG + Intergenic
920403235 1:205690427-205690449 TGAAGCTCCAGAGGAACAGAAGG + Intergenic
920550882 1:206859751-206859773 TAGTGCTCCAGTGGAACAGATGG - Intergenic
920727037 1:208445861-208445883 TGCAGCTGCTGTGGCAGATAGGG + Intergenic
920850383 1:209624345-209624367 TGGAGCTGCAGCTGTACAGATGG - Intronic
920986707 1:210897525-210897547 TGGAGCTGCTGTGGAACAGAGGG - Intronic
922045889 1:221945992-221946014 TGGACCTGCTCTGGGATAGAAGG - Intergenic
922169025 1:223139614-223139636 TGGGGCTGCAGTGGCTCAGAAGG + Intronic
923496659 1:234531458-234531480 GGGAGCTGCAGGGGCACAGACGG - Intergenic
1063066018 10:2609576-2609598 AGGAGCTGCTGAGGAAAAGCAGG - Intergenic
1064244239 10:13656738-13656760 TGGAGCTGGTGTGCGACAGGCGG + Exonic
1066422309 10:35274567-35274589 TGGACCTGCGGAGGAAGAGATGG - Intronic
1066439145 10:35421274-35421296 GGGAGCTCATGTGGAAGAGAAGG - Intronic
1067558873 10:47290586-47290608 TGGAGCTGCTGTGGCAGGAATGG - Intergenic
1069248826 10:66243988-66244010 TGGACCTGCCCTGGACCAGAGGG + Intronic
1069564453 10:69453938-69453960 TGGAGCTGCTCTGGCAGAGTTGG - Intronic
1069809936 10:71150970-71150992 GACAGCTGCTTTGGAACAGATGG - Intergenic
1070762612 10:79034178-79034200 TGGAGCTGCTGAGGAACACGGGG - Intergenic
1071747291 10:88436426-88436448 TGGATTTGCTGTGGAACAGGGGG - Intronic
1071894100 10:90045702-90045724 TGGTGATGCTGTGGAGAAGAGGG - Intergenic
1071896713 10:90075908-90075930 TGGATCTGCCCTGGACCAGAAGG - Intergenic
1072724233 10:97801685-97801707 TGGAGGTGCTGGGGAATGGAGGG + Intergenic
1072728224 10:97827884-97827906 CGGGGCTCCTGTGGAAGAGACGG - Intergenic
1072994239 10:100229355-100229377 TTGAGCGTCTGTGGAACACAGGG - Intronic
1073827086 10:107336608-107336630 TGGACCTGCCATGGACCAGAGGG - Intergenic
1073828806 10:107358349-107358371 GTGAGCTTCTGTAGAACAGAGGG - Intergenic
1073905477 10:108274653-108274675 TGGAACTGCTCTGGACCAGAGGG - Intergenic
1075049094 10:119169031-119169053 TGAAGCTGCTGTGGGGTAGAGGG - Intronic
1075599338 10:123755993-123756015 GTGAGCTGCTCTGGCACAGAAGG - Intronic
1075647244 10:124104595-124104617 TGGGGTTGCTGTGGTAGAGAGGG + Intergenic
1076731034 10:132438994-132439016 TGGAGCTGGTGTGGCCCTGACGG + Intergenic
1077513219 11:2983097-2983119 TGGAGATGCTGCTGAACAGTAGG - Intronic
1078137953 11:8667985-8668007 TGTGGCTGCTGTGGAAAATATGG - Intronic
1079244725 11:18743873-18743895 TGGAGCTCCTGAGGAACACCAGG + Intronic
1080707133 11:34707025-34707047 TGGACCTGCTCTGGGCCAGAAGG - Intergenic
1080876597 11:36280276-36280298 GGGACCTTCTGTGGGACAGAGGG + Intronic
1081850784 11:46273889-46273911 GGGAGCTGCTAGAGAACAGAGGG + Intergenic
1083812304 11:65112623-65112645 TGGAGGTGCTGTGGAGCCCACGG + Exonic
1085163042 11:74366699-74366721 TGGAGGAGCTGGAGAACAGAAGG + Intronic
1085178471 11:74511360-74511382 TGGACCTGCTCTGGGCCAGAGGG + Intronic
1085981622 11:81733023-81733045 TGAACCTGCTGTGGGCCAGAGGG - Intergenic
1086429941 11:86726986-86727008 TGAAGCTGCTGTGAAAGGGATGG - Intergenic
1089203085 11:116736939-116736961 TGGTTCTGCTGTTGAACTGAGGG + Intergenic
1089578847 11:119468860-119468882 TGGACCTGCTCTGGGCCAGAGGG - Intergenic
1089762186 11:120735939-120735961 TGGACCTGCCCTGGGACAGAAGG - Intronic
1090065284 11:123498140-123498162 TGGACCTGCTCTGGACCAGAGGG - Intergenic
1090364354 11:126193281-126193303 TGAAGCTGCTGATGGACAGATGG + Intergenic
1091037243 11:132245230-132245252 TGGAGCTTTGGTGGAAGAGAAGG + Intronic
1091069937 11:132553496-132553518 TGGAACTGCTGGGCCACAGAAGG + Intronic
1091205790 11:133820080-133820102 TGGAGCTGCAGTGAAACAGATGG - Intergenic
1091967176 12:4754601-4754623 TGGACCTGCTCTGGGCCAGAAGG - Intronic
1092670888 12:10859234-10859256 TGGACCTGCTCTGGTCCAGACGG + Intronic
1093882051 12:24416057-24416079 TGGAGCTGCAGTGAGACAGTGGG + Intergenic
1094409586 12:30155126-30155148 TGGAGCTGTTGGGGAATAGTTGG - Intergenic
1095133668 12:38572185-38572207 TGGAGCTGCCTTGGGCCAGAGGG + Intergenic
1095227551 12:39695339-39695361 TGGACCTGCCCTGGACCAGAGGG + Intronic
1097196515 12:57245080-57245102 AGGCTCAGCTGTGGAACAGAGGG - Intronic
1098046776 12:66408767-66408789 TGGACCTGCTCTGGGACAGAGGG + Intronic
1098649047 12:72941307-72941329 TGGACCTGCTCTGGACCACAGGG - Intergenic
1099853736 12:88138294-88138316 GGTAGCTGCTGTAGAATAGAAGG - Intronic
1101162607 12:101994257-101994279 TGGACCTGCTGTGGGCCAGAGGG - Intronic
1101949311 12:109162378-109162400 TGGGGGTTCTGTGGTACAGATGG - Intronic
1105045930 12:133003105-133003127 TGGGGCTTCTGTGGGAGAGATGG + Intronic
1106645502 13:31629705-31629727 TGGACCTGCCCTGGACCAGAGGG - Intergenic
1107588739 13:41881521-41881543 TGGCGGTTTTGTGGAACAGAAGG - Intronic
1107636162 13:42394756-42394778 GGGAGCTCCTGTAGAACAGGTGG + Intergenic
1107912006 13:45114373-45114395 TGTAGTTGCTGTGGAAAAAATGG - Intergenic
1108804877 13:54142079-54142101 TTCAGCTGCTTTGGAACAGGTGG + Intergenic
1109810685 13:67509266-67509288 TGAAGCAGCTGTGGGACACAGGG - Intergenic
1111280468 13:86016598-86016620 TGGAGCTTCAGTGGCACAGTTGG - Intergenic
1112034172 13:95482426-95482448 TGAAGCTGCTGTGGCAGAAAGGG + Intronic
1112613794 13:100982393-100982415 TGCAGCTGCTATGGAACATGAGG - Intergenic
1112901471 13:104362957-104362979 TGGATCTGCTCTGGGCCAGAGGG - Intergenic
1113112143 13:106834704-106834726 AGGAGATGTTGTGGACCAGAAGG + Intergenic
1113141711 13:107159557-107159579 AGGATCTGTTGAGGAACAGAGGG - Intergenic
1114250916 14:20959650-20959672 TGGACCTGCCGTGGGTCAGAGGG + Intergenic
1114783716 14:25570059-25570081 TGGACCTGCCCTGGGACAGAGGG - Intergenic
1114854579 14:26423016-26423038 TGAAAATGCAGTGGAACAGAAGG + Intergenic
1115282361 14:31678209-31678231 TGGACCTGCTCTGGGCCAGAGGG - Intronic
1115892334 14:38045274-38045296 TGGAGCAGATGTGAAAGAGATGG + Intergenic
1115918364 14:38342907-38342929 TGGACCTGCTCTGGGCCAGATGG + Intergenic
1117264904 14:54076708-54076730 TGGACCTGCCCTGGGACAGAGGG - Intergenic
1117326764 14:54676135-54676157 TGGAGCTGCTGTGGTATTCAGGG - Intronic
1117807649 14:59511212-59511234 TGGAGCTGCGGAGGCCCAGAGGG - Intronic
1118765750 14:68908305-68908327 AGGAGCTGCTGTGCAACTCATGG - Intronic
1118891841 14:69916553-69916575 TGGAGCAGCTGGGGCAAAGAGGG - Intronic
1119486168 14:74988473-74988495 AGGAGATTCTTTGGAACAGAAGG + Intergenic
1119752131 14:77086833-77086855 TGGAGCTGTTATTGAACTGATGG - Intergenic
1120587039 14:86324841-86324863 TGGAGCTGCAGTGGACCACCTGG + Intergenic
1121956012 14:98214063-98214085 TGGAGTGGCTGTGGAGCAGAAGG - Intergenic
1122448971 14:101788189-101788211 TGGATCTGCCATGGTACAGAAGG + Intronic
1123508619 15:20972261-20972283 TGGAGCTTCTCTGGGCCAGAGGG - Intergenic
1123565840 15:21546010-21546032 TGGAGCTTCTCTGGGCCAGAGGG - Intergenic
1123602102 15:21983297-21983319 TGGAGCTTCTCTGGGCCAGAGGG - Intergenic
1125567137 15:40685357-40685379 TGGAACTGCTCTGGGCCAGAAGG - Intergenic
1126053305 15:44707159-44707181 TGGACCTGCTCTGGGCCAGAGGG - Intronic
1126716706 15:51525533-51525555 TGGATCTTCTGTGGGCCAGAAGG + Intronic
1127012469 15:54644942-54644964 TGGACCTGCCCTGGAACAGAGGG + Intergenic
1127036483 15:54923825-54923847 TGCAGCTGCTGTGGAGGACAGGG + Intergenic
1128142237 15:65310325-65310347 TGGGGCTGCTCTGGAAAAGGGGG + Intergenic
1128229960 15:66027537-66027559 TGGACCTGCAGTGGGGCAGAGGG - Intronic
1128695689 15:69760721-69760743 TGGATCTGCTGGGGAAGAGTTGG + Intergenic
1128761688 15:70220460-70220482 TGGAGAGGCTGAGGCACAGAAGG - Intergenic
1130287947 15:82571198-82571220 TGGAGCTGTTTTGCAAGAGATGG - Intronic
1131782946 15:95879871-95879893 TACTGCTGCTGAGGAACAGAGGG + Intergenic
1132293982 15:100721569-100721591 AGGAGCTGCTGGGGAAAGGAGGG + Intergenic
1202974209 15_KI270727v1_random:273103-273125 TGGAGCTTCTCTGGGCCAGAGGG - Intergenic
1133054443 16:3138508-3138530 TGCTGCTCCTGGGGAACAGACGG - Exonic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133233056 16:4375312-4375334 TGGAGCAGGTGTGGACCAGCTGG - Intronic
1133419156 16:5630928-5630950 TGCAGCTGTTTTGGAATAGATGG - Intergenic
1133804512 16:9114445-9114467 GGGAGGTGCTGGGGAACAGGTGG + Intronic
1133821280 16:9238675-9238697 TGGAGCTGCTGGAGAAATGAGGG + Intergenic
1133885577 16:9824472-9824494 TGCAGCTCCTCTGCAACAGACGG - Intronic
1133893938 16:9907806-9907828 TGGAGCTGCAGAGGAAGTGAGGG - Intronic
1133897971 16:9947440-9947462 AGGAGCTGCTGCTGAACTGAAGG + Intronic
1134472017 16:14533552-14533574 TGGAGCAGCTGTGGGGCAGCGGG - Intronic
1136279826 16:29201680-29201702 AGCAGCTGTTGTGTAACAGAGGG + Intergenic
1136389148 16:29951383-29951405 TGGACCTGCTGTGGGCCAGAGGG - Intronic
1136617896 16:31410019-31410041 TTGATGTGCTTTGGAACAGAGGG + Intronic
1137017899 16:35394539-35394561 GGTGGCTGCTGTGGGACAGATGG - Intergenic
1137070961 16:35904444-35904466 AGGAGCTGCTGTGGACCACAGGG + Intergenic
1138169665 16:54836788-54836810 TGGACTTCCTGTGGTACAGAAGG + Intergenic
1139004898 16:62558591-62558613 TGGACCTGCTCTGGGACAGAGGG - Intergenic
1141998018 16:87647432-87647454 TGGTGCAGCTGTGAAACTGACGG + Intronic
1142084219 16:88167790-88167812 AGCAGCTGTTGTGTAACAGAGGG + Intergenic
1142312307 16:89321137-89321159 TGCATCTCCTGTGGAGCAGAGGG - Intronic
1142891770 17:2948501-2948523 TAGAGCTGCTGTGGACCAGGGGG + Intronic
1142891801 17:2948639-2948661 TAGAGCTGCTGTGGACCAGGGGG + Intronic
1142891831 17:2948777-2948799 TAGAGCTGCTGTGGACCAGGGGG + Intronic
1143011847 17:3870322-3870344 TGGAGCTGATGTGGCGCTGAGGG - Intronic
1143353577 17:6307636-6307658 TGGGGCTGAAGGGGAACAGAGGG + Intergenic
1144350759 17:14393923-14393945 GGGAGCTGCTGTGAACAAGAGGG + Intergenic
1144506025 17:15831749-15831771 TGATGCAGCTGTGGAAAAGATGG + Intergenic
1145170200 17:20649671-20649693 TGATGCAGCTGTGGAAAAGATGG + Intergenic
1145273121 17:21415088-21415110 TGGAGCTGCTGGGGGCCCGAAGG + Intronic
1145311314 17:21702532-21702554 TGGAGCTGCTGGGGGCCCGAAGG + Intronic
1146377487 17:32304328-32304350 TCTAGATGCTGTTGAACAGAGGG + Intronic
1146626762 17:34440768-34440790 TGGTGATGCTGTGGGACAGAAGG + Intergenic
1147766344 17:42838884-42838906 TGGGGCTGCTGTGGATGACATGG + Intronic
1148391998 17:47279416-47279438 TGGTGCTCTTCTGGAACAGAGGG + Intronic
1148588844 17:48800475-48800497 TGGAGCTCCTGTTGACCTGATGG + Intronic
1148764282 17:50028289-50028311 TTGAGCTGCTGTGAGTCAGAAGG - Intergenic
1148863856 17:50618587-50618609 TGGAGCTGTTGTGGAAAATCAGG - Intronic
1148963212 17:51410814-51410836 TGTTGATGGTGTGGAACAGAAGG + Intergenic
1149157332 17:53647658-53647680 TGGACCTGCTCTGGGCCAGAGGG - Intergenic
1150119812 17:62591378-62591400 TGGAGCTACTTTGGAATTGAGGG + Intronic
1150204232 17:63389516-63389538 TGGTGCTGCTGTGCAAGAAACGG + Exonic
1150434128 17:65140969-65140991 TGGAGCTGCAGGGGCACAGGAGG - Intronic
1150467032 17:65402802-65402824 TGGAGATGCTGGAGGACAGATGG + Intergenic
1151452430 17:74206520-74206542 GGGAGCTGGTGTTTAACAGAGGG - Intronic
1152816113 17:82408982-82409004 TGGAGCTGCCGGGAAACAGCAGG - Intronic
1154109335 18:11552401-11552423 TGGATCTGCTGGTGAACAGTGGG + Intergenic
1154289105 18:13090746-13090768 TGGGGCTGTAGTGGGACAGATGG - Intronic
1155546875 18:26924719-26924741 AGGAGTAGCTGTGGCACAGAGGG - Intronic
1155927391 18:31671379-31671401 TGGAGCTGTTGTGGAAAAATAGG - Intronic
1156614707 18:38769617-38769639 TTGATCTGATGTGGGACAGAGGG - Intergenic
1157801649 18:50626333-50626355 AGGAAATGCTGTGGACCAGATGG + Intronic
1157936997 18:51884123-51884145 TGGACCTGCTGTGGGCCAGAGGG + Intergenic
1158090026 18:53700121-53700143 TGTAGTGTCTGTGGAACAGAGGG - Intergenic
1158948984 18:62474620-62474642 TGGACCTGCTCTGGGACAGAGGG - Intergenic
1158981953 18:62771467-62771489 TGGGGCTGTTGTTTAACAGATGG - Intronic
1163125693 19:15243157-15243179 TGCAGCTGCTGCTGCACAGAGGG + Exonic
1164428380 19:28165457-28165479 GGCAGGTGCTGGGGAACAGAAGG - Intergenic
1164659305 19:29949152-29949174 TGGGGCGGCTGTGGGGCAGAGGG + Intronic
1165008608 19:32826480-32826502 TGGAGCTGCGGGGCAACATAAGG + Intronic
1167337687 19:48896694-48896716 AGGAGCTGCTGAAGAACTGAGGG - Intronic
1168378833 19:55903421-55903443 TGGTGCAGGTGTGGAATAGAGGG - Intronic
1168383492 19:55943743-55943765 TGGAGCTGTTGAGAAACAGCAGG - Intergenic
1168504129 19:56919073-56919095 TGGGGTGGCTGTGGAACAGGAGG - Intergenic
925414732 2:3661431-3661453 TGGATCTGCTGTGAAACAAGAGG + Intronic
926095012 2:10075614-10075636 TGCAGCTGCTATGGAACTCACGG - Intronic
926318140 2:11726544-11726566 TGAAGCTGCTCTTAAACAGATGG - Intronic
926324377 2:11771658-11771680 TGGAGCTGCTGGAGAGCAGCAGG + Exonic
927113593 2:19881487-19881509 AGGAGTGGCTGGGGAACAGAGGG + Intergenic
927239950 2:20912614-20912636 TGGTTCTGCTGTTGATCAGAAGG - Intergenic
927921727 2:26977704-26977726 TGGACCTGGTGTGGCACAGGGGG - Intronic
928187819 2:29129973-29129995 AGCAGCTGCTCTGGAACACAGGG + Intronic
928532087 2:32202874-32202896 TGCAGCTTCTGTGGAACATTTGG + Intronic
928863938 2:35895417-35895439 TGGACCTGCTTTGGGACAGGGGG - Intergenic
929998481 2:46845187-46845209 TGGAGCAGCAGTTGAAGAGAGGG + Intronic
931572286 2:63681281-63681303 TGGATCTGCTGTGGAGCAGAGGG + Intronic
931600828 2:64001276-64001298 TGGACCTGCCCTGGACCAGAGGG - Intronic
932858762 2:75266797-75266819 TGGACCTGCTCTGGGCCAGAGGG - Intergenic
933097922 2:78210995-78211017 TGGACCTACTGTGGGCCAGAAGG + Intergenic
933776143 2:85772367-85772389 GGGAGCTCCGCTGGAACAGAGGG + Intronic
934645160 2:96055026-96055048 GGGGGCTGCTATGGGACAGAGGG + Intergenic
934838564 2:97611115-97611137 GGGGGCTGCTATGGGACAGAGGG + Intergenic
935262354 2:101366218-101366240 TGGAACGGCTGTTGAAGAGATGG - Intronic
936393969 2:112104577-112104599 TGGAGAGGATGTGGAACAGCTGG + Intronic
936484091 2:112911734-112911756 TGGTGCTGCTGAAGGACAGAAGG - Intergenic
937439394 2:121903588-121903610 TGGAGGTGCTGAGGAAGGGATGG + Intergenic
937557775 2:123180537-123180559 TGGAGCTGCCCTGGGCCAGAGGG + Intergenic
937702014 2:124873481-124873503 TTGAACTGCCGTTGAACAGATGG + Intronic
938177912 2:129153118-129153140 TGGACCTGCTCTGGTCCAGAGGG - Intergenic
938484098 2:131686102-131686124 TCACGCTGCTGTGGAATAGAAGG + Intergenic
939613797 2:144340108-144340130 TGGACTCCCTGTGGAACAGAAGG + Intergenic
940518508 2:154712941-154712963 GGCAGATGCTGTGGAACAGCTGG + Intronic
940909053 2:159194426-159194448 AGCAGCTGCTGCGTAACAGAGGG - Exonic
941751506 2:169139816-169139838 TGGAGTAGCTGTGGCACTGAGGG + Intronic
942142460 2:172991188-172991210 TGTAATAGCTGTGGAACAGAAGG + Intronic
942444657 2:176070123-176070145 TGGAGCTGCTGAGGCAGAGCTGG - Intergenic
942710475 2:178829334-178829356 TGAAACTGCTGTTGAACAGAAGG + Intronic
943226760 2:185187932-185187954 TGGACATGCTGTGGGTCAGAGGG - Intergenic
943237170 2:185337627-185337649 TGGACCTGCTGTGGGCCTGAGGG - Intergenic
943237222 2:185337942-185337964 TGGACCTGCCCTGGACCAGAGGG - Intergenic
943479878 2:188404811-188404833 TGGAGCTGGTCTGGAACCTAGGG - Intronic
944567489 2:201005388-201005410 TTGAGGTGATGTGGAAAAGACGG - Intronic
944955097 2:204799109-204799131 TGGACCTGCTATGGGCCAGACGG + Intronic
946238765 2:218341456-218341478 TGGAGATGCTGTGGTAAAGAAGG + Intronic
947046409 2:225991863-225991885 TGGAGCTGGTGTGAAGCATAAGG + Intergenic
947505311 2:230704044-230704066 TGGACCTGCCCTGGACCAGAGGG - Intergenic
947729056 2:232418219-232418241 TGCTGATGCTGTGGAGCAGAAGG - Intergenic
947741012 2:232485019-232485041 TGCAGACGCTGTGGAACAGAAGG - Exonic
948040642 2:234898920-234898942 TGGAGATGGTGTGGAGGAGAAGG + Intergenic
948600855 2:239106799-239106821 TGGAGCTGGCGTGGCACGGAGGG - Intronic
948650909 2:239443128-239443150 TGGAGCTGCTGTGACCCAGGAGG - Intergenic
948723698 2:239919179-239919201 TGGACCTTCGGTGGCACAGAAGG + Intronic
948873720 2:240816874-240816896 TGGGGGTGCTGTGGGGCAGAGGG - Intronic
949059957 2:241951089-241951111 TGGAGCTGCTGGGGCTGAGATGG + Intergenic
1169759816 20:9079224-9079246 GGGCCCTGCTGGGGAACAGATGG + Intronic
1169880144 20:10338404-10338426 GGGGGCGGCTGTGGAACAGCAGG + Intergenic
1170668414 20:18406786-18406808 TGGATCTGCTCTGGGCCAGAGGG + Intronic
1170709243 20:18775277-18775299 TGGACCTGCTCTGGGCCAGAGGG - Intergenic
1170915310 20:20618268-20618290 TGGAGCTACTGAGGGACAAAGGG + Intronic
1171466057 20:25328827-25328849 AGGTGCTGCTGTGGAAGAGAAGG - Intronic
1175080768 20:56418508-56418530 TCAGGCTGCTGTGCAACAGATGG + Intronic
1175296443 20:57912097-57912119 CAGAGCTTCTGTGGACCAGAGGG - Intergenic
1177210437 21:18064269-18064291 TGGAGCTGACATGGAAGAGATGG - Intronic
1177289498 21:19093326-19093348 TGGAAATGCTTTGGAAGAGATGG + Intergenic
1177651949 21:23968882-23968904 TGTAGCTGCTGAGGAAGGGAGGG + Intergenic
1179389762 21:40977082-40977104 TGGCACTGCTGAGGGACAGAGGG - Intergenic
1179536059 21:42053411-42053433 TGGTGCTGCTGTGGAGCAACTGG - Intergenic
1180127355 21:45801405-45801427 AGGAGCTGCAGAGGAGCAGATGG + Intronic
1181315444 22:21968060-21968082 TGGAGCTGCTGTGGCTGACACGG - Intronic
1181673637 22:24437911-24437933 TGAAGCTGCTGGGGAAGGGAAGG - Intronic
1181873901 22:25924872-25924894 TGGAGCTGATTTGGAATTGATGG + Intronic
1182364281 22:29767434-29767456 TGGAGGTCCTGCGGAACAGCAGG - Exonic
1182507874 22:30798010-30798032 AGCAGCTGCTGTGGAAAATAGGG - Intronic
1183172398 22:36197941-36197963 TGGAACTTCTGTGGCACAGGTGG - Intronic
1183638898 22:39081652-39081674 AGGACCTGGTCTGGAACAGAGGG - Intronic
1183675507 22:39296990-39297012 TGGGGCTGGTGGGGAACAGGCGG + Intergenic
1183957141 22:41387594-41387616 TGGGGATGCTGTGGAAGAGCTGG - Exonic
1185128883 22:49026223-49026245 TGGTGTTGCTCTGGCACAGAAGG + Intergenic
1185311482 22:50158134-50158156 TGGAGATGCTGTGGGCCAGGAGG - Exonic
949514883 3:4798459-4798481 TGGTGATGCTGTGGATCAGATGG + Intronic
950850874 3:16061076-16061098 TGGAGCTGCAGTGAATCAGAGGG + Intergenic
951252637 3:20411855-20411877 AGGAGCTGCTTTGGTAGAGAGGG + Intergenic
952691928 3:36218704-36218726 TGGTGCTGCAGTGGAAAAGTAGG - Intergenic
952707822 3:36398152-36398174 GGCAGCAGCTGTGAAACAGAAGG + Intronic
952811863 3:37411420-37411442 TGGACCTGCTCTGGGCCAGAGGG - Intronic
953795481 3:45982555-45982577 TGCCTCTGCTGTGGGACAGAGGG + Intronic
954104867 3:48404500-48404522 TGCAGCTGCTGTGGAAAACAAGG - Exonic
955033234 3:55241060-55241082 TTGAGCTGCTGGGGACCACAGGG - Intergenic
955385224 3:58474080-58474102 TGGAGCTGCAGGTGAACACATGG + Intergenic
955673033 3:61421915-61421937 TGGTGGAGGTGTGGAACAGATGG - Intergenic
957915839 3:86687059-86687081 TGGACCTGCTATGGACCAGAGGG + Intergenic
958631176 3:96685714-96685736 TGGAGCTGCTCTGGGCCAGAGGG - Intergenic
958847220 3:99279029-99279051 TGGTCCTGCTGTGGGCCAGAGGG + Intergenic
958907717 3:99960392-99960414 AGGAGCAGCTGTGGTAAAGAGGG - Intronic
959448272 3:106467158-106467180 TGGACCTGCTGTGAGTCAGAGGG - Intergenic
960548440 3:118945684-118945706 AGGACCTGATGTGGAACAGTTGG - Intronic
960819435 3:121712815-121712837 TGGAGAAGATGTGGAACAAATGG + Intronic
961550414 3:127667756-127667778 TGGAGCTGGGCTGGAACAGAGGG - Intronic
964286006 3:155119157-155119179 TGGTGCTGGTGAGGACCAGAGGG + Intronic
965401804 3:168221297-168221319 TGGAGCTTCTCTGGAACATCAGG - Intergenic
965515352 3:169615904-169615926 TGGAATTGCTGTGTGACAGAAGG - Intronic
966151701 3:176873734-176873756 TGGACCTGCTCTGGGCCAGAAGG + Intergenic
966478556 3:180378708-180378730 TGGAACTGGTGGGGAACAGAAGG - Intergenic
967261735 3:187649248-187649270 TGGAGATGCTATGGGAAAGAGGG - Intergenic
967606377 3:191451827-191451849 AGGATCTGCTGTGGAATGGAGGG + Intergenic
968480036 4:829195-829217 TGGAGCATCTGAGGAGCAGAGGG - Intergenic
968567048 4:1318521-1318543 TGGAGCTGCTGTGTGGAAGAAGG + Intronic
968754338 4:2407601-2407623 GGGAGCTTCTGAGGCACAGAGGG - Intronic
968932063 4:3586277-3586299 TGGGGGTCCTGTGGTACAGAAGG + Intronic
969487433 4:7480133-7480155 TGGAGCGGCTGTGGCTCACAGGG + Intronic
969573881 4:8025372-8025394 TGGAGGGGCTGTGGCATAGACGG + Intronic
971026630 4:22595133-22595155 AGGAGTAGCTGTGGCACAGAGGG - Intergenic
971491332 4:27215262-27215284 TGGAGCTGCTGTTTTGCAGATGG + Intergenic
972207802 4:36798903-36798925 TGGACCTGCCCTGGACCAGAAGG + Intergenic
973763263 4:54140034-54140056 TGGACCTGCCATGGACCAGAAGG + Intronic
975203095 4:71614807-71614829 TGCAGCTGCTGTGGGACATGGGG - Intergenic
975704146 4:77095270-77095292 TGAAGCTGCTGTGGAATATGAGG - Intergenic
977137889 4:93328767-93328789 TGGAGCTGCTCAGGATCAGTAGG + Intronic
977409669 4:96645889-96645911 TGGAGAGGCTGTGGAAAAAAAGG - Intergenic
978718727 4:111878228-111878250 TTGAGCTGATGTGGAAAACAAGG + Intergenic
978839513 4:113193443-113193465 AGAAGCCGCTGTGGAAGAGAAGG + Intronic
978934579 4:114359399-114359421 TGAACCTGCTCTGGATCAGAGGG - Intergenic
980686855 4:136240421-136240443 GGGACATGCTGTGGACCAGAGGG + Intergenic
980792864 4:137642236-137642258 TGGGGCAGCTGAAGAACAGATGG - Intergenic
981565645 4:146098772-146098794 TGGAGCTGCAGGGGAACCGCTGG - Intergenic
982309324 4:153967939-153967961 TGGAGCTGGGGTGCAAGAGAAGG + Intergenic
983456299 4:167968866-167968888 TGCACCTGCCCTGGAACAGAGGG + Intergenic
983501968 4:168509839-168509861 TAGACCTGCTGTTTAACAGAGGG - Intronic
984305110 4:177979509-177979531 TGGAACTCCTGTGTAACAGGTGG - Intronic
985712893 5:1439916-1439938 TGCAGATGCTGAGGACCAGAGGG - Intronic
986657559 5:10030490-10030512 TGGACCTGCTCTGGGTCAGAGGG - Intergenic
986853141 5:11836429-11836451 TGGAGCTAATGTGTTACAGAAGG - Intronic
987072380 5:14350747-14350769 TGGAGGTGGGGAGGAACAGAGGG - Intronic
988685313 5:33519860-33519882 TGAGGGTGCTCTGGAACAGAGGG + Intergenic
989181602 5:38583144-38583166 TAGAGCTGCTGTTGAACTGAAGG + Intronic
990476347 5:56164773-56164795 TGGACCTGCTGAGAAGCAGAGGG + Intronic
991018649 5:61957999-61958021 TGGACCTGCCCTGGACCAGAGGG - Intergenic
991465938 5:66912140-66912162 TGTGGCTGCTGTGGAACAAGTGG + Intronic
991507686 5:67342494-67342516 TGGAGCAGCTCAGAAACAGAAGG + Intergenic
992361387 5:76041963-76041985 AGGAGCTGCTGTGGGTGAGAAGG - Intergenic
992744578 5:79806561-79806583 TGGGGCTGCAGTGGAACACGGGG + Intergenic
993065857 5:83096212-83096234 GGGATCTGCTGTGGGATAGAGGG + Intronic
993736933 5:91488547-91488569 TGGAGCTACTGTGGAGTAGATGG - Intergenic
994003959 5:94815847-94815869 TGGAGCTGGTGTCAAAGAGAGGG + Intronic
994791522 5:104232631-104232653 AGGTGCTGCAGTGGAAGAGATGG + Intergenic
996072442 5:119148825-119148847 TGGAGATGCAGAGTAACAGATGG + Exonic
996461742 5:123752757-123752779 GGGATTTGCTGGGGAACAGAAGG - Intergenic
997104723 5:131005787-131005809 TGGACCTGCCCTGGGACAGAGGG + Intergenic
997139921 5:131367934-131367956 TGAAGTCGCTGTGGGACAGAGGG - Intronic
998657620 5:144199685-144199707 TGAAGCTGTTCTGGAACAAATGG - Intronic
1000113449 5:158131563-158131585 TAGAGCTGCAGAGGCACAGAAGG - Intergenic
1001849389 5:174950572-174950594 AGGAGATGCTGTGAGACAGATGG + Intergenic
1002565725 5:180112239-180112261 TGGAGGTGATGTGGACAAGATGG - Intronic
1003049882 6:2770329-2770351 TGTTGCTGCTGTGGCTCAGAGGG - Exonic
1003601975 6:7526050-7526072 TGGTGCTGGTGTGGAAAGGAAGG + Intergenic
1003904891 6:10690153-10690175 GGCAGCAGCTGTGGAACAGAAGG + Intronic
1003952348 6:11127924-11127946 TGGACCTGCTCTGGGCCAGAGGG - Intronic
1005311430 6:24563107-24563129 AGGAGGTGCTGGGGAACAGCAGG - Intronic
1005794005 6:29337990-29338012 TGTTTCTTCTGTGGAACAGAAGG + Intergenic
1005995018 6:30925709-30925731 TGGAGCTGCAGGTGACCAGAGGG + Exonic
1007889122 6:45270153-45270175 TGGAGCTTATGTTGAACATAAGG - Intronic
1010447836 6:75967990-75968012 TGGAGACGCTGTGGGATAGAAGG + Intronic
1010560261 6:77340575-77340597 TGGACCTGCCCTGGACCAGAGGG - Intergenic
1010775367 6:79878999-79879021 TGGACCTGCCCTGGACCAGAGGG + Intergenic
1011249898 6:85360110-85360132 TGGTGCTACTGTGGAAAGGAGGG - Intergenic
1011343265 6:86340692-86340714 TGGACCTACTCTGGGACAGAAGG + Intergenic
1011618808 6:89222871-89222893 TGGAGCTGTTGTGGAACGCTGGG - Intronic
1012284013 6:97366540-97366562 AGGAGCTGCATTGAAACAGAGGG + Intergenic
1012477930 6:99635503-99635525 TGGAGTTGCTTTGATACAGAGGG + Intergenic
1012620594 6:101339617-101339639 TGGACCTGCTGTGGGCCAGAGGG - Intergenic
1012824094 6:104125921-104125943 TGGACCTGCCCTGGGACAGAGGG - Intergenic
1013420389 6:109961644-109961666 TGGAGCTGCTTTGGAAAAACAGG + Intergenic
1016305572 6:142680197-142680219 TGGAGCTGCTTTGGAATGGCTGG - Intergenic
1017748251 6:157466320-157466342 GGGTGCTACTGTGGAGCAGATGG - Intronic
1017872511 6:158499010-158499032 GGGAGCTGCTGGAGCACAGATGG + Intronic
1018216641 6:161534456-161534478 TGGAGCTGCTGTGGGGCCGCTGG - Intronic
1019365889 7:632580-632602 TGGGGCTGCCTTGGTACAGATGG + Intronic
1019560814 7:1656112-1656134 TCGTGCGGCTGAGGAACAGATGG + Intergenic
1022348266 7:29539311-29539333 TGGACCTGCTCTGGGCCAGAGGG + Intergenic
1023249247 7:38239774-38239796 TGGAGGAGCTGTGGAAAACATGG + Intergenic
1023250893 7:38259838-38259860 TGGAGGAGCTGTGGAAAACATGG + Intergenic
1023302915 7:38792840-38792862 TGGAGCAGATGTGGAGGAGAGGG - Intronic
1023783227 7:43678875-43678897 TGCAGCTGCTGTGGAAAATATGG + Intronic
1023964592 7:44956447-44956469 CGGAGCTCCTGAAGAACAGATGG - Intergenic
1025025882 7:55515689-55515711 TGCTGCTCCTGTGGCACAGAGGG - Intronic
1027591528 7:80125044-80125066 CGGAAGTGGTGTGGAACAGAGGG + Intergenic
1027599948 7:80227699-80227721 TGGAACTGTGCTGGAACAGACGG - Intergenic
1028207527 7:88033950-88033972 TGGATCTGCTCTGGGCCAGAGGG - Intronic
1029156682 7:98522206-98522228 AGGAGCTGCTGTGGATGAGGAGG - Intergenic
1029493867 7:100886868-100886890 AGGAGCTGCTGGGGAGCAGCGGG + Exonic
1031115889 7:117667980-117668002 TGGAGCTTCTGTGGAAAGAAGGG - Exonic
1032372171 7:131367610-131367632 TGAAGCAGATGTAGAACAGAAGG - Intronic
1033138503 7:138804286-138804308 TGGATGTGCTGGGGGACAGATGG - Exonic
1034649079 7:152675609-152675631 TGGAGCTTTTCTGGAACAGGTGG - Intronic
1035248730 7:157582508-157582530 TGGAGAGGATGTGGAAGAGACGG + Intronic
1037034146 8:14144719-14144741 TGGACCTGCTGTGGGCCAGAGGG + Intronic
1037485989 8:19347201-19347223 TGGAGGTGCTGGGGAATAGCTGG + Intronic
1037973660 8:23193090-23193112 GGGTGCTGCAGTGGAAGAGATGG - Intronic
1038506862 8:28092166-28092188 TGCAGCTGTTTAGGAACAGAAGG + Intronic
1038650929 8:29402530-29402552 CCGAGCTGCTGTGGGAGAGAAGG - Intergenic
1039797392 8:40926899-40926921 TGTAGCTGGAGTGGAACTGAGGG - Intergenic
1040551070 8:48437993-48438015 CGGAACTGCAGGGGAACAGAAGG - Intergenic
1040631704 8:49220934-49220956 TTTTGCTGCTGTGGAAAAGAGGG + Intergenic
1041643971 8:60232355-60232377 TGGAGTTCCAGTGGATCAGATGG + Exonic
1042732394 8:71951718-71951740 TGTAGCAGCTTTGGAACAGAAGG + Intronic
1043323339 8:79018058-79018080 TGGACCTGCTGTGGGCCAGAGGG - Intergenic
1043512889 8:80967035-80967057 TGCAGATGGGGTGGAACAGAAGG + Intergenic
1044362637 8:91306469-91306491 TGAAGATTCTGTGGAACAGGTGG + Intronic
1045326377 8:101120636-101120658 TGTTGCTGCTCTGGAACACATGG + Intergenic
1047239476 8:123072969-123072991 ATGACCTGCGGTGGAACAGATGG + Intronic
1047696963 8:127413409-127413431 TGGAAATGCTGAGGTACAGAAGG - Intergenic
1048193172 8:132308783-132308805 TGGAGATACTGAGGATCAGAGGG + Intronic
1048613343 8:136048121-136048143 TGGGGCAGCTGTAGAAAAGATGG - Intergenic
1049216024 8:141408797-141408819 ACCAGCTGCTGGGGAACAGAGGG + Intronic
1049354318 8:142180058-142180080 TGGGGCTGCTGTGGGCCAGAAGG + Intergenic
1049643832 8:143727420-143727442 TGGAGCTGCGCTGGACCAGGGGG + Exonic
1050263203 9:3862763-3862785 TGTAGCCGCCGTGGAAGAGACGG - Intronic
1051650514 9:19319549-19319571 TAGAGGTGCTGTGGAAGATAAGG + Intronic
1052006654 9:23357615-23357637 TGTGGCTGCTGTGGGGCAGAGGG + Intergenic
1053394339 9:37759009-37759031 TGGTGGTGCTGTGGAACATTTGG + Intronic
1054458072 9:65445654-65445676 TGGGGGTCCTGTGGTACAGAAGG - Intergenic
1055181191 9:73388789-73388811 TGGACCTGCCCTGGGACAGAAGG - Intergenic
1055243747 9:74216909-74216931 TGGACCTGCTGTGGGCCAGAAGG - Intergenic
1056180395 9:84076891-84076913 TGGACCTGCCCTGGAGCAGAGGG + Intergenic
1056391554 9:86145969-86145991 GGGAGCTGCTGAAGAACAGAAGG + Intergenic
1059445763 9:114336963-114336985 TGGAGCTGCTGAGGCCCAGAAGG - Exonic
1059503688 9:114778728-114778750 TGTAGTTGCTGTAGAGCAGATGG + Intergenic
1059571916 9:115446781-115446803 TGTAGCTGTTATGTAACAGAAGG - Intergenic
1059960137 9:119556539-119556561 GGGAGATGTTGTGGAGCAGACGG + Intergenic
1060172726 9:121474991-121475013 TGGAGTTGCTGTGGTTCAAACGG - Intergenic
1061005846 9:127928090-127928112 TGGAGGTGCTGAGGAACTGCAGG + Exonic
1061516270 9:131092331-131092353 GGGAGCTGCTGTGAAACAGAGGG - Exonic
1061662854 9:132141764-132141786 TGGAGCTGCCGTGGAGCTGACGG - Intergenic
1061871656 9:133524201-133524223 TGGAGCTGCTCTGGTTCAGGAGG - Intronic
1062619122 9:137411632-137411654 TGGTGGTGCTGTGGCACCGATGG - Intronic
1186084433 X:5971425-5971447 TGGAGCTGGTGTGAATAAGAAGG - Intronic
1186482190 X:9904500-9904522 TGGGGCTGCTGGGAAACAAAGGG - Intronic
1186649877 X:11547777-11547799 AGGAACTGCTGTGGAACAAAAGG + Intronic
1189173123 X:38928564-38928586 TGGAGAGGCTGTGGAGAAGAGGG + Intergenic
1189890022 X:45591516-45591538 TGGACCTGCCTTGGGACAGAGGG - Intergenic
1190416141 X:50182432-50182454 TGGAGTTGGGGTGGGACAGATGG + Intergenic
1192174954 X:68879673-68879695 TGGAGGTGCTTTGGAGCAGGAGG - Intergenic
1192640722 X:72859554-72859576 TGGACCTGCTCTGGGCCAGAGGG + Intergenic
1192640989 X:72861222-72861244 TGGACCTGCTCTGGGCCAGAGGG - Intergenic
1192826704 X:74704626-74704648 TGGACCTGATCTGGGACAGAGGG - Intergenic
1193585095 X:83311504-83311526 TGGACCTGCCTTGGATCAGAAGG + Intergenic
1193894870 X:87100705-87100727 TGGACATGTTCTGGAACAGAGGG + Intergenic
1194274791 X:91865905-91865927 TGGACCTGTGCTGGAACAGAGGG - Intronic
1194522068 X:94931476-94931498 TGGACCTGCCGTGGGACAGAGGG - Intergenic
1194877535 X:99208128-99208150 TGGACCTGCTCTGGGCCAGATGG - Intergenic
1195502107 X:105613575-105613597 TAGACCTGCTGTGGGCCAGAGGG + Intronic
1195834873 X:109102838-109102860 TGGACCTGCCTTGGGACAGAGGG - Intergenic
1195852133 X:109294999-109295021 TGGACCTGCTCTGGGCCAGAAGG - Intergenic
1197028315 X:121782511-121782533 TGGACCAGCTGTGGGCCAGAGGG - Intergenic
1197664607 X:129210416-129210438 TGCAGCTGCTGTGGAAGATGGGG + Intergenic
1198079754 X:133228101-133228123 TGGAGTTGGAGTGGAAGAGAAGG + Intergenic
1198770562 X:140126007-140126029 TGGAGCTGCACTGGGCCAGAAGG - Intergenic
1198788204 X:140313977-140313999 TGGACCTGCCGTGGGCCAGAAGG + Intergenic
1198846751 X:140920476-140920498 TTGAACTGCTGTGGAACTGTGGG - Intergenic
1199317307 X:146395709-146395731 TGAACCTGTTGTGGGACAGAGGG - Intergenic
1199416407 X:147587808-147587830 CGGAGATCCTGTGGACCAGATGG - Intergenic
1199851526 X:151727512-151727534 TGGAGCAGATTTGGAGCAGAGGG + Intergenic
1200315887 X:155132828-155132850 TGGACCTGCTCTGGGCCAGAGGG + Intronic
1200592033 Y:5087306-5087328 TGGACCTGTGCTGGAACAGAGGG - Intronic
1200985967 Y:9303838-9303860 TGGAGCTGCTGTGGATAGAAGGG - Intergenic
1202340145 Y:23855570-23855592 TGGAGGTGCTGAGGAAGATATGG - Intergenic
1202530621 Y:25814512-25814534 TGGAGGTGCTGAGGAAGATATGG + Intergenic