ID: 920986734

View in Genome Browser
Species Human (GRCh38)
Location 1:210897701-210897723
Sequence TCCCTACATTCCCCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920986734_920986738 23 Left 920986734 1:210897701-210897723 CCTGCCTTTGGGGAATGTAGGGA 0: 1
1: 0
2: 3
3: 15
4: 148
Right 920986738 1:210897747-210897769 TGAAAAGCAAAACCAACCTTCGG 0: 1
1: 0
2: 2
3: 29
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920986734 Original CRISPR TCCCTACATTCCCCAAAGGC AGG (reversed) Intronic
902233845 1:15045165-15045187 ACCCTACCTTCCCCACAGGGTGG + Intronic
903230429 1:21919028-21919050 CCCCATCTTTCCCCAAAGGCAGG + Intronic
903364364 1:22796830-22796852 TCCTTACAGTCCCCAGAAGCTGG + Intronic
906279693 1:44544656-44544678 TCCTTTCAATCTCCAAAGGCTGG + Intronic
906698067 1:47838059-47838081 GCCCTAAATTACACAAAGGCAGG - Intronic
907968485 1:59357034-59357056 TGTCTTCATTCCTCAAAGGCTGG - Intronic
910293053 1:85617122-85617144 TCCTCACAAACCCCAAAGGCAGG + Intergenic
910606251 1:89087983-89088005 TCCCTATAATTCCCAAAGACAGG - Intergenic
911809419 1:102255338-102255360 TCACTACATTCCACAAATGTTGG - Intergenic
919236742 1:194855323-194855345 CACCTACATTCCCCTGAGGCAGG + Intergenic
919869750 1:201811381-201811403 CCCCTAAATTCCCCAAAGTTGGG - Intronic
920351228 1:205339314-205339336 TCCCAACATTCCCTATAAGCGGG - Exonic
920986734 1:210897701-210897723 TCCCTACATTCCCCAAAGGCAGG - Intronic
922074880 1:222233688-222233710 TCACTACATTCTCCATAGACTGG - Intergenic
923766884 1:236900818-236900840 TCCACTCATTCCCCAAAGCCTGG - Exonic
1064585685 10:16837307-16837329 TCCCTCCCTTCCCCCGAGGCTGG - Intronic
1067085925 10:43238081-43238103 TCCCTCCGCCCCCCAAAGGCGGG - Intronic
1069944838 10:71978737-71978759 GCCCTGCATTCCCTAGAGGCCGG - Intronic
1074978617 10:118601126-118601148 TCCCAACATCCCCCAGAGGTAGG - Intergenic
1075271401 10:121054730-121054752 TCTCTCCATTCTCCAAGGGCAGG + Intergenic
1075301591 10:121329407-121329429 TCCCATCACTCCCCAAGGGCTGG + Intergenic
1076305626 10:129463971-129463993 TCCCTTCATTTCCCAAAGGTAGG + Intergenic
1079701657 11:23556014-23556036 TCCCTTTCTTCACCAAAGGCAGG + Intergenic
1079923832 11:26467432-26467454 GCCCTACATTTCCCAAACCCTGG + Intronic
1081206978 11:40287332-40287354 TCTATAAATTCCCCAAAGCCAGG + Intronic
1081852250 11:46281718-46281740 TCCCTAAATCTCCCGAAGGCTGG - Intronic
1083117585 11:60477592-60477614 TCTCTACACTTCACAAAGGCAGG + Intergenic
1086438495 11:86805063-86805085 TCCCCACATTACTCAAAGGGAGG + Intronic
1088054213 11:105555634-105555656 CCTCTACATTCCCCAGAGGCTGG - Intergenic
1092571869 12:9734239-9734261 TCCCTAAATGCCACAAAGCCAGG - Intergenic
1095865287 12:46964898-46964920 TCCTGACATTTCCCGAAGGCTGG - Intergenic
1103944884 12:124520452-124520474 TCCAGACCTTCGCCAAAGGCTGG + Intronic
1107990826 13:45817786-45817808 TCCCAACAATCCCAAGAGGCAGG + Intronic
1108466412 13:50720440-50720462 TCATCACATTCCCCAAATGCAGG - Intronic
1111213473 13:85111082-85111104 CCCCTACTTTACCCAAAGTCGGG + Intergenic
1111464838 13:88595021-88595043 TTCCTACATTCTCCAGAGCCTGG - Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1113113851 13:106853893-106853915 TCCCTCTTTTCACCAAAGGCAGG - Intergenic
1118715301 14:68555566-68555588 GCCCTGCTGTCCCCAAAGGCAGG - Intronic
1120901008 14:89575463-89575485 TCCCTGCTTTTACCAAAGGCAGG + Intronic
1122102009 14:99420235-99420257 CCCCTCCAGTCCCCACAGGCAGG + Intronic
1124470936 15:29985213-29985235 ACCCTACAATCCCAACAGGCTGG + Intergenic
1124621837 15:31278447-31278469 CCCCCAAATTCCCCAAATGCCGG + Intergenic
1127053468 15:55108709-55108731 TACTTAAATTACCCAAAGGCCGG - Intergenic
1127318332 15:57818116-57818138 TTACTACATTCCCCAGAAGCTGG + Intergenic
1127831109 15:62752359-62752381 CCCACACATTCCCCAAAGGCAGG - Exonic
1129349914 15:74949789-74949811 ACCCTAGCTTCTCCAAAGGCAGG + Intergenic
1130876312 15:88017668-88017690 TCCCCCTATTCCCCAAAGTCAGG - Intronic
1130980840 15:88810952-88810974 TCTCTTCCTTCCCCAAGGGCAGG + Intronic
1133597708 16:7309296-7309318 TCCATAGGTTCCCCAAAGGGGGG - Intronic
1135413862 16:22254329-22254351 TCCCTGCCTTCCCCTCAGGCCGG + Intronic
1135762009 16:25145364-25145386 TCCCTGCATTCCCAAAAAGGTGG + Intronic
1136467741 16:30456706-30456728 TCACTACATTGCCCACAAGCTGG + Intergenic
1136662873 16:31780571-31780593 TCCCTAGATTCCCCACAGTAGGG - Intronic
1137360929 16:47814429-47814451 TGCCTACATACCTCAAAGGCAGG + Intergenic
1139853193 16:69962722-69962744 TCCCCACCATCCCCACAGGCTGG + Intronic
1139882164 16:70185630-70185652 TCCCCACCATCCCCACAGGCTGG + Intronic
1140370344 16:74409874-74409896 TCCCCACCATCCCCACAGGCTGG - Exonic
1141137121 16:81473700-81473722 TCCCCGCGTCCCCCAAAGGCAGG - Intronic
1142516253 17:431334-431356 TCCCTATAATCCCCACAGGTGGG - Intergenic
1144418007 17:15069939-15069961 TCCCCACTATACCCAAAGGCTGG + Intergenic
1144885123 17:18452424-18452446 TACTTATATTCCCCAAATGCAGG - Intergenic
1145147095 17:20491953-20491975 TACTTATATTCCCCAAATGCAGG + Intergenic
1146682849 17:34820971-34820993 TCCCTTCATTCCCCTACAGCAGG - Intergenic
1148229010 17:45919554-45919576 TCCCTACCTTCCCCCACTGCTGG + Intronic
1150728549 17:67671352-67671374 TCTCTACATTCCAGATAGGCTGG + Intronic
1152895735 17:82910077-82910099 TCCCTACAATAGCCAAAGGCTGG - Intronic
1156181163 18:34606561-34606583 GCACTGCATTCCTCAAAGGCAGG - Intronic
1159936950 18:74376557-74376579 TTGGTACATTTCCCAAAGGCTGG + Intergenic
1160273855 18:77411981-77412003 TCCCTGCTTTCCCCAGAGCCAGG + Intergenic
1161321815 19:3644920-3644942 TTCCTACAATCACCAAAGGCTGG + Intronic
1162465536 19:10837334-10837356 TCCCCAAATTCTCCAAATGCAGG - Intronic
1166094909 19:40532330-40532352 TCCCCACAAGCCCCCAAGGCAGG - Intronic
1168239954 19:55083935-55083957 TCCCTGGATCCCCAAAAGGCTGG + Intronic
925508802 2:4601108-4601130 TCCCTATATGCCCCGCAGGCAGG + Intergenic
932462379 2:71891298-71891320 TCCCCACTGTCCCCCAAGGCAGG - Intergenic
933259426 2:80115496-80115518 TGTCTTCATTCCCTAAAGGCTGG + Intronic
938592283 2:132751222-132751244 TCCCTCTATCCCCCAAAAGCTGG + Intronic
939041495 2:137194221-137194243 CTCCTGCATTCCCCAAAGGGTGG - Intronic
940179966 2:150921180-150921202 TCCATACATTTCCCAGAGGAAGG - Intergenic
942222722 2:173787265-173787287 GCCCTACCTTCCCCAAAAGTAGG + Intergenic
948685301 2:239666162-239666184 TCACTCCCTTCCCCATAGGCTGG - Intergenic
949047717 2:241879710-241879732 TGGAGACATTCCCCAAAGGCTGG - Intergenic
1171779471 20:29405977-29405999 TCCCTTCCTTTCCTAAAGGCAGG - Intergenic
1179576373 21:42310785-42310807 TCCCTCCAGCCCTCAAAGGCTGG + Intergenic
1180609723 22:17087322-17087344 TCCCTCATTTCCACAAAGGCAGG + Intronic
1180661587 22:17472132-17472154 TCCCAGGAGTCCCCAAAGGCTGG - Intronic
1181142527 22:20816960-20816982 TCCTAAAATGCCCCAAAGGCAGG + Intronic
1181183041 22:21080585-21080607 TGCCTCCATTCCACAAAGTCAGG - Intergenic
1181831952 22:25566816-25566838 TCCCTCCACCACCCAAAGGCAGG + Intronic
1182287229 22:29255604-29255626 ACCCTACACTCCTCAAGGGCAGG - Intronic
1182634137 22:31710951-31710973 CCTCTACATTGCCAAAAGGCAGG + Intronic
1183745462 22:39689137-39689159 TCCCCACTTTCCCCACAGCCAGG - Exonic
950230395 3:11271059-11271081 CCCCCACCCTCCCCAAAGGCAGG - Intergenic
951197471 3:19840294-19840316 TCCCTGGCTTCCCCAAAGTCTGG + Intergenic
952157014 3:30654428-30654450 TCCCTACAGTGACCAAGGGCAGG + Intronic
954180974 3:48881158-48881180 TCCCTGCATTCACCCCAGGCAGG + Intronic
954610540 3:51942563-51942585 TCCCAACAATCGCCAGAGGCCGG - Exonic
956178310 3:66495203-66495225 TCCCTAAATTTCCCACAGGCTGG + Intronic
957085672 3:75674675-75674697 TCCCTTCCTTTCCTAAAGGCAGG + Intergenic
957489027 3:80899228-80899250 TCCCTTCATTTCCCACAGTCAGG + Intergenic
960876102 3:122296498-122296520 TCCAGACATTCCCCTAAGGTGGG + Intergenic
961017707 3:123480470-123480492 TCCCCAAAATCCCCAAAGCCAGG - Intergenic
963790262 3:149576030-149576052 TCACAGCATTCCCCAAAGGCTGG + Intronic
963901283 3:150735693-150735715 TCCCTCCATTGCCCAAACCCCGG + Intergenic
964504907 3:157388516-157388538 TGCCTACATTCTCCAGAGGAGGG - Intronic
965293712 3:166916897-166916919 TACCTCCACTCCCCTAAGGCTGG + Intergenic
967323485 3:188216721-188216743 TCCCAACACTCCCACAAGGCAGG + Intronic
967362821 3:188651357-188651379 TCCCCAAATTCCCAAAAGCCAGG - Intronic
971097451 4:23423851-23423873 TTCCTCCAGTCCCCAAAGACAGG + Intergenic
971198020 4:24487702-24487724 TCCCTTGATTCTCCAAAGGCAGG + Intergenic
972003874 4:34073708-34073730 TTCCTACATGACCCAAATGCAGG + Intergenic
975587981 4:75970230-75970252 TCCCTGAAAACCCCAAAGGCAGG + Intronic
976967571 4:91063601-91063623 TCCTTATATTCCCCAAAGTGAGG + Intronic
978545431 4:109867561-109867583 TCCCTACTTTCTCAAGAGGCAGG + Intronic
983169569 4:164520742-164520764 TCTCTAGATTCCTCAAAGGCAGG - Intergenic
985803620 5:2022155-2022177 TCCTAGCATTTCCCAAAGGCAGG - Intergenic
986668849 5:10126167-10126189 ATCCTACAATCCCCACAGGCAGG + Intergenic
988977558 5:36529942-36529964 TCTCTACATTCCCCAATATCTGG + Intergenic
989272011 5:39544729-39544751 TCCCTGCCTTCCCCAAGGGAGGG + Intergenic
997028160 5:130090610-130090632 TCCCTGCATTCTCCAAATTCTGG + Intronic
1000841533 5:166225025-166225047 TCCCCAAATTCCTCAAAAGCAGG - Intergenic
1001630121 5:173168705-173168727 TCCCTTCAGTCCCCAACAGCAGG + Intergenic
1001689159 5:173619669-173619691 CCTCTAAATTCCACAAAGGCAGG + Intergenic
1002040136 5:176507384-176507406 TCCCTCTCTTCCCCAGAGGCAGG - Exonic
1004316202 6:14590170-14590192 TCACTAAGGTCCCCAAAGGCAGG - Intergenic
1008456911 6:51721732-51721754 TCTCCACAGTCCCCAAAGTCAGG + Intronic
1011794758 6:90940119-90940141 TCCCTGCTTGCCCCAAAGGCAGG - Intergenic
1012459189 6:99442027-99442049 TCCCTACAATGCCCAAACCCTGG + Intronic
1014696368 6:124626304-124626326 TCCCAACACTCCACAAATGCAGG - Intronic
1014866525 6:126538175-126538197 TCCCCACCCTCCCCCAAGGCAGG + Intergenic
1016283923 6:142451383-142451405 GTCCTACATCCCCCAAAGTCTGG - Intergenic
1018393092 6:163355650-163355672 TCCCTGCAGTCCCCAGTGGCTGG - Intergenic
1018903994 6:168064678-168064700 TCCTTACCACCCCCAAAGGCAGG - Intronic
1020766795 7:12332033-12332055 TCCCTACCTTCCCCAAAGGAGGG - Intronic
1022288149 7:28974991-28975013 TCCCTACATTCCCTACATCCTGG - Intergenic
1023020864 7:36010735-36010757 TCCTAACAACCCCCAAAGGCAGG - Intergenic
1023576528 7:41634357-41634379 TCCCTAAGTTCCCCTAAGACTGG + Intergenic
1026970505 7:74464872-74464894 TCCCCAAAGTCCTCAAAGGCTGG + Intronic
1030104370 7:105974537-105974559 TCCCTGCTCTTCCCAAAGGCTGG + Intronic
1032999742 7:137491336-137491358 ACCCTGAATTCCCCAAAAGCTGG + Intronic
1033509410 7:142039814-142039836 TCCCAACATTCCCAAATGGTGGG - Intronic
1035091486 7:156316541-156316563 TCCCTTCATTCCCCAAAGCCAGG + Intergenic
1038691759 8:29770616-29770638 TCCCAACATGTCCCAAATGCAGG - Intergenic
1039546583 8:38415094-38415116 TCCCTTCCTTCCCCAAAGACTGG + Intronic
1043655970 8:82665398-82665420 TCCCCACTTTCCCCAAAGTGGGG + Intergenic
1044319982 8:90791318-90791340 GCCCGACCTTCCCCAAAGGCGGG - Intronic
1045077142 8:98582572-98582594 TCCCAACACCCCCTAAAGGCAGG + Intronic
1045320623 8:101079435-101079457 GGGCTATATTCCCCAAAGGCAGG - Intergenic
1047104160 8:121714950-121714972 TCCCTTCATTTCTCAAGGGCTGG + Intergenic
1047915611 8:129580874-129580896 TCACTACATCTCCCAAAGGATGG - Intergenic
1048197023 8:132339791-132339813 TTCCCCCATTCCCCAAAGCCTGG + Intronic
1049435227 8:142583395-142583417 TCCCTACAGTCCCCAAAGCCAGG - Intergenic
1051338756 9:16092180-16092202 TTCCTTCATTCCCTAAAGCCTGG + Intergenic
1053005211 9:34599769-34599791 TTCCTAGATTCCCCAAGTGCTGG + Intergenic
1055809082 9:80130621-80130643 TCCCACCATTCCGCCAAGGCAGG + Intergenic
1057168240 9:92945035-92945057 TCACTACATTCCCACATGGCAGG - Intergenic
1057169292 9:92951133-92951155 GCCCCACATTCCTTAAAGGCCGG - Intronic
1059420293 9:114186404-114186426 CCTCTACACTCCCCAAGGGCAGG - Intronic
1059438060 9:114288399-114288421 TCCCCACATTCCCCAGGAGCAGG + Intronic
1060069523 9:120534031-120534053 TCAATCCATTCCCCAAGGGCAGG + Intronic
1189631419 X:42957903-42957925 TGCCTACATTCCCCTAGGGAAGG + Intergenic
1190215375 X:48476460-48476482 TCCCTCCTTTCCCCGCAGGCGGG - Intronic
1190280736 X:48927778-48927800 TCTCTCCCCTCCCCAAAGGCTGG + Intronic
1193304833 X:79936237-79936259 TCCCTCCCTTCCCCAAACTCTGG + Intergenic
1194974449 X:100379483-100379505 TCTTTACATTCCTCAAAGGCAGG - Intronic
1201532286 Y:15005206-15005228 GCACACCATTCCCCAAAGGCTGG + Intergenic