ID: 920988412

View in Genome Browser
Species Human (GRCh38)
Location 1:210912485-210912507
Sequence TTGAACTTGCATAAAATATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920988412_920988413 5 Left 920988412 1:210912485-210912507 CCTGATATTTTATGCAAGTTCAA 0: 1
1: 0
2: 2
3: 19
4: 228
Right 920988413 1:210912513-210912535 TTAAAGTAGAGCATACTCAAAGG 0: 1
1: 0
2: 2
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920988412 Original CRISPR TTGAACTTGCATAAAATATC AGG (reversed) Intronic
900360691 1:2287561-2287583 TTGGACTTGGATAAAACATTTGG - Intronic
906891922 1:49725904-49725926 CTGAACCTGTATAAAATATGTGG - Intronic
909873435 1:80774111-80774133 TTGGGCTTGCTTAAAATTTCAGG - Intergenic
910581502 1:88830981-88831003 CTGAACATGTATAATATATCCGG - Intronic
910904738 1:92163457-92163479 TTGTATATGCATAAAATAACTGG + Intergenic
911460965 1:98190178-98190200 TTAAATTTGTATACAATATCAGG + Intergenic
911704407 1:100994216-100994238 TTTAACTTTCATAAAATTTATGG + Intronic
911752369 1:101510729-101510751 TTAAACATACATAAAATACCTGG - Intergenic
912115044 1:106395540-106395562 TTGATCTTGCATTAATTAGCTGG - Intergenic
913280553 1:117181315-117181337 TTGAACTTTCATAAGCAATCAGG - Intronic
914455717 1:147834500-147834522 ATGAACCTTCATAAAATAACAGG - Intergenic
915791692 1:158679013-158679035 ATGATTTTGCATAAAATTTCAGG + Intronic
915894604 1:159802142-159802164 TTGAAGCTGCAGAAAATGTCAGG + Intronic
915983445 1:160438556-160438578 TAGAAGTGGCATAAAATCTCAGG - Intergenic
916353997 1:163884012-163884034 TTGCACTTGAATAACACATCTGG - Intergenic
917321566 1:173788170-173788192 CTGAACTATCATAAAATATTTGG + Intergenic
917809002 1:178639222-178639244 TTCCATTTGCATGAAATATCTGG - Intergenic
918813681 1:189154142-189154164 TTGAACTGATATGAAATATCAGG - Intergenic
919364110 1:196635090-196635112 TTAAATTTGAATAAAATATTAGG - Intergenic
920298209 1:204972838-204972860 TTGTACATGCATAAAATCTCAGG + Intronic
920870798 1:209792862-209792884 TTTTACATGCATAAAATGTCTGG + Intronic
920988412 1:210912485-210912507 TTGAACTTGCATAAAATATCAGG - Intronic
921067812 1:211634967-211634989 CTGAACTTGCATAAAAGAATGGG + Intergenic
921426643 1:215010208-215010230 GTTAACTTGCGAAAAATATCTGG - Intronic
924225347 1:241917379-241917401 TTAAAATTGCAAAAAATTTCCGG - Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1062882742 10:991515-991537 TTGAAAGTACATAAAATAACAGG - Intronic
1063068261 10:2632095-2632117 GTGAACTTTAATAAAGTATCTGG - Intergenic
1065691944 10:28343354-28343376 TTGAAGTTGCTTAAAAGCTCAGG + Intergenic
1067768004 10:49103375-49103397 TTTAATTTGCATAAAATGACAGG + Intronic
1068530607 10:58181623-58181645 TTTAACTTCAGTAAAATATCCGG + Intergenic
1070216271 10:74384886-74384908 TTGAACTTGCTTAAGATACTTGG + Intronic
1070520146 10:77245502-77245524 TTGAAATGTCATAAAGTATCTGG - Intronic
1071519515 10:86320453-86320475 TTCCACTTGTATGAAATATCTGG + Intronic
1071798639 10:89032591-89032613 TTCTATTTACATAAAATATCTGG - Intergenic
1073965587 10:108985427-108985449 TTGAACTTAAATAGAATATTTGG - Intergenic
1074164668 10:110864541-110864563 TAAAACTTGCATAAAATTTTAGG + Intergenic
1075904662 10:126070661-126070683 TTCAGCTTGCATAAACTCTCGGG + Intronic
1076567511 10:131408984-131409006 TTGGACCTGACTAAAATATCTGG - Intergenic
1079056307 11:17209013-17209035 TTGAACTTTCAGCAAATAACTGG + Intronic
1079888723 11:26023196-26023218 TAATACTTGCATAAAATATTGGG - Intergenic
1086798954 11:91146639-91146661 GTGAACTTGGAGAAAATATTTGG - Intergenic
1087910665 11:103750021-103750043 TAGAATTTACATAAAATACCTGG - Intergenic
1088477428 11:110257388-110257410 TTGAACATACATAAGAAATCAGG - Intronic
1088940663 11:114452382-114452404 TTGAATTTTAATAAAATAACTGG + Intergenic
1089170038 11:116505411-116505433 TTGAGGTTCCATAAAATATATGG - Intergenic
1091921286 12:4306936-4306958 TTGAACACGCACAAAAGATCGGG - Intergenic
1094033188 12:26037268-26037290 CTGATATTGCTTAAAATATCTGG - Intronic
1098724762 12:73949314-73949336 TTTAACTTGTATAAAATGTTTGG + Intergenic
1099028400 12:77494455-77494477 TTTAATTTGCATAAAACATTGGG + Intergenic
1099703421 12:86118891-86118913 TTGAATCTACATAAAATATTAGG - Intronic
1101474211 12:105028566-105028588 TTAAACTTGCACAAGAAATCTGG + Intronic
1103129715 12:118457372-118457394 TTTAAGTTGCATACAATTTCAGG - Intergenic
1105276343 13:18931104-18931126 TTAAACAAGCATAAAATATTTGG + Intergenic
1107794181 13:44032788-44032810 TTCAACTTGGAAAAAATATCAGG - Intergenic
1108093007 13:46869827-46869849 TTGCACTTGTATAAAATATCTGG + Intronic
1108801132 13:54096039-54096061 TTGATCTGGCATAAAAATTCAGG + Intergenic
1108926058 13:55746859-55746881 TATAATTTGCATAAAATATGAGG - Intergenic
1109623754 13:64946381-64946403 TTGTATTTGTATAAAATATCAGG - Intergenic
1110052236 13:70918478-70918500 TTATACTTGCACAAAATATTAGG + Intergenic
1110356001 13:74568248-74568270 CTAAACTTCCATAAAATAACAGG - Intergenic
1110467335 13:75816698-75816720 TTGAACTTGAGAAAAATATCAGG + Intronic
1111142169 13:84133433-84133455 TTAAACTGTAATAAAATATCTGG - Intergenic
1111550550 13:89805243-89805265 TTGAACTTGCTTAAGCTCTCTGG - Intergenic
1112700675 13:102004253-102004275 TCGAACTAGCAGAAAATGTCTGG - Intronic
1112850576 13:103701131-103701153 TTGTATATGCATCAAATATCTGG - Intergenic
1112918978 13:104586781-104586803 ATAAACTTCCATAAAATATAAGG + Intergenic
1113243953 13:108373873-108373895 TAGTACTTGCATTATATATCTGG + Intergenic
1113260259 13:108553754-108553776 TTGAGATTTCTTAAAATATCGGG - Intergenic
1114135930 14:19850676-19850698 TTAAACATGCATAAGATAGCAGG + Intergenic
1114955575 14:27813900-27813922 TTGTACTCGCATAAACTTTCAGG - Intergenic
1115312396 14:31992674-31992696 TCCACCTTGCATAAAAGATCTGG - Intergenic
1117569662 14:57034261-57034283 TTGATCTTGCAGAAAACTTCTGG - Intergenic
1118858574 14:69643734-69643756 TTGAAATTGAATATAGTATCTGG - Intronic
1118927328 14:70204699-70204721 TTGAACTTGGAGATGATATCTGG - Intergenic
1120663320 14:87276506-87276528 TTGAAATTACATAAAATTTATGG + Intergenic
1121821846 14:96975967-96975989 TTGTTCTTGGGTAAAATATCAGG + Intergenic
1124716429 15:32066745-32066767 TTGAACATATATAAAATAACTGG - Intronic
1124814926 15:32980383-32980405 TTAAACTTGCTTTATATATCTGG + Intronic
1125082612 15:35693279-35693301 TTGTCATTCCATAAAATATCTGG + Intergenic
1128576732 15:68781118-68781140 TTCAACTTGCATATACTTTCAGG - Intronic
1128718193 15:69925650-69925672 TTGAGCTTGCAAAAAATATGGGG - Intergenic
1128927124 15:71667731-71667753 GTGAACATGCAAAAAATATTAGG - Intronic
1129122630 15:73410673-73410695 TTGAACTTGGATGACATGTCTGG - Intergenic
1130133830 15:81165135-81165157 CTAAACTTCCCTAAAATATCAGG - Intronic
1133637836 16:7686630-7686652 TTCAACTTGCACAAAAGGTCTGG + Intronic
1134337703 16:13316536-13316558 TGGTACTGGCTTAAAATATCAGG - Intergenic
1136481637 16:30545662-30545684 TGAAACTTGCATCAAATATTGGG + Intronic
1137498442 16:48990693-48990715 TTGAAATTGCATTAAATATCTGG + Intergenic
1141107183 16:81243241-81243263 TTTAAATTGCAGAAAATATCTGG + Intronic
1141625143 16:85257452-85257474 TTGAAGTTGGATAAAATATAAGG - Intergenic
1150198374 17:63325648-63325670 TTGAACTTCCATTGTATATCAGG - Intronic
1152885028 17:82844724-82844746 TTGAACATGTAAAAAATAGCGGG - Intronic
1153485439 18:5593257-5593279 TGGAACATACATGAAATATCAGG - Intronic
1155807100 18:30185084-30185106 TGTAACTTTTATAAAATATCTGG + Intergenic
1156974888 18:43208427-43208449 ATCAACTTACATAAAATATAAGG + Intergenic
1158768305 18:60483194-60483216 ATGAAATTGCACAAAATAACAGG - Intergenic
1159980141 18:74768377-74768399 GTCAATTTACATAAAATATCAGG + Intronic
1163773606 19:19205322-19205344 ATGAATTTGAATAAAATATGTGG + Intergenic
1166170191 19:41022920-41022942 TTGCACTTGCAAAAAGTGTCTGG + Intergenic
924970712 2:125290-125312 TTTTACTTGCCTAAAATCTCGGG + Intergenic
927780317 2:25934138-25934160 TTCCATTTACATAAAATATCTGG + Intronic
929447497 2:42012714-42012736 TTATACTTTCATAAAATATTGGG - Intergenic
930674994 2:54191005-54191027 TTCTACTTGCAAAATATATCTGG + Intronic
931304417 2:61014757-61014779 ATGAACTTGCTTAAAATTTGTGG + Intronic
931686456 2:64798100-64798122 TTGCAGTTGTATAAAATAACAGG + Intergenic
932188927 2:69722538-69722560 TTCTACTTGTATAAAATATCGGG + Intronic
933102572 2:78279411-78279433 TTCCCATTGCATAAAATATCTGG - Intergenic
933501309 2:83115020-83115042 TTCAAAGTGCATAAAATAACTGG + Intergenic
934481701 2:94654984-94655006 TTTTACTTGCATAAACTTTCAGG + Intergenic
935883300 2:107588594-107588616 ATGACCTTGCATAAAATAGATGG + Intergenic
936670403 2:114649629-114649651 ATGAACTTTCAAAAAATCTCAGG - Intronic
937074650 2:119092707-119092729 TTAAAATAGCATAAAATATTAGG - Intergenic
938231549 2:129665431-129665453 TTGCACTTCCATATAATATGTGG - Intergenic
938638715 2:133257269-133257291 TTGCAATTTCATAAAGTATCTGG - Intronic
938745538 2:134274786-134274808 TTCAACTTGGATTAAATACCAGG - Intronic
940558411 2:155262660-155262682 TATAACTTGAGTAAAATATCAGG + Intergenic
940958757 2:159758564-159758586 TTCTACTTACATAAAATATCTGG - Intronic
942913921 2:181279345-181279367 TTGTACATGTATAAAATATTGGG + Intergenic
944115362 2:196180082-196180104 TTGAACCTGCATCAAATTACTGG - Intergenic
944742295 2:202624369-202624391 ATGCACATGCATAGAATATCTGG - Intergenic
945218371 2:207459353-207459375 CTGAACTTGTATAAATAATCAGG + Intergenic
945902376 2:215553427-215553449 TTGAAGTTGCAAAAACTATGTGG - Intergenic
947610655 2:231522980-231523002 TAGGACTTGCATAAACCATCTGG - Intergenic
1169294630 20:4384033-4384055 TTGAACTTGAAGATAAGATCGGG + Intergenic
1169755979 20:9043826-9043848 TTCAAATTTCATAAAATGTCAGG + Intergenic
1170550379 20:17471329-17471351 TTGATCTTGCATAAAGTTCCTGG - Intronic
1173400021 20:42717370-42717392 TTGAACCTTTATAATATATCAGG - Intronic
1174753229 20:53132815-53132837 TTGTCCTGACATAAAATATCAGG + Intronic
1177240909 21:18455498-18455520 CTGTACTTGCAAGAAATATCAGG + Intronic
1177519422 21:22199126-22199148 TTCAAAATGGATAAAATATCTGG - Intergenic
950986087 3:17368773-17368795 TTAAAATTCTATAAAATATCTGG + Intronic
951300699 3:20992620-20992642 TTGACCTAACATAAAATAACTGG - Intergenic
953285604 3:41604536-41604558 TTAAACATACATGAAATATCTGG + Intronic
956806256 3:72815380-72815402 TTGAATCTGCATGGAATATCAGG - Exonic
956873195 3:73438271-73438293 TTGAACTTCCATAAGTCATCAGG + Intronic
956971220 3:74528728-74528750 TTGAAAATACATAAAATATCAGG - Intergenic
957565080 3:81875185-81875207 GTGAACTTGACTAAAATTTCAGG + Intergenic
957745894 3:84341802-84341824 TTGCACTTTCCTAAATTATCAGG + Intergenic
958150446 3:89686371-89686393 GTGATTTTTCATAAAATATCTGG + Intergenic
958472601 3:94540241-94540263 TTGAATTTTCAGAAAATATATGG - Intergenic
958610930 3:96425137-96425159 TGGAACAGGCATAAAATAACTGG - Intergenic
959723402 3:109516810-109516832 TTGAACTTACCTAAATAATCAGG + Intergenic
960416780 3:117394672-117394694 CTGAACTTGCAAAATATTTCTGG - Intergenic
960519035 3:118634193-118634215 TTGAGTTTGCATAAAATACAAGG + Intergenic
962069903 3:132022456-132022478 TTGATGTTGCATAAAAAAACAGG + Intronic
965485920 3:169278289-169278311 TTGATCTTGCCAAAAATCTCTGG + Intronic
967486361 3:190036011-190036033 TTGCAATTGAATAAAATAACTGG - Intronic
970877125 4:20884445-20884467 TTAAACTTGCAAAATAAATCTGG + Intronic
972087620 4:35240181-35240203 TTCAACATGGATAAAATATTAGG + Intergenic
972695500 4:41441516-41441538 TGGAATTTGCATTAAATATTTGG + Intronic
973092195 4:46150701-46150723 ATGTAGTTGCATAAAATATGTGG - Intergenic
973599881 4:52531677-52531699 TAGAGCTTGGATAAAAGATCAGG - Intergenic
973754416 4:54060253-54060275 TTAATCTTCCATAACATATCTGG + Intronic
974533814 4:63148532-63148554 TTGGACTTTCATTTAATATCTGG + Intergenic
976814931 4:89137456-89137478 TTGAATTTGAATAAAATTTACGG - Intergenic
977417531 4:96752823-96752845 TGGAACTTGGATAAATTAACAGG - Intergenic
978135366 4:105251254-105251276 TAGAACTTCCAGAAAATGTCAGG + Intronic
979015072 4:115421951-115421973 TTTAACTTTAATAAAAAATCTGG - Intergenic
980407209 4:132368122-132368144 TTTATCTTGCATAAATTCTCAGG + Intergenic
980520262 4:133922375-133922397 TAGAACATGCATAAAAAATGTGG + Intergenic
981482089 4:145249455-145249477 TTGAACTTGGATGGAATACCTGG + Intergenic
982377477 4:154709005-154709027 TTGATTTTGTAGAAAATATCAGG - Intronic
984331525 4:178326435-178326457 TTGAACTGGCTTACAATATGAGG - Intergenic
985409254 4:189665395-189665417 TTCAATTTTCATAAAATCTCCGG + Intergenic
986635198 5:9814487-9814509 TTGAACTTTCATGGAATATCTGG - Intergenic
988360629 5:30232252-30232274 TTGAACATTCTTCAAATATCAGG + Intergenic
988481684 5:31636927-31636949 AAGAACTTGCCAAAAATATCTGG + Intergenic
988669345 5:33364195-33364217 TTGAACTTCCTTAAAAAATGTGG - Intergenic
988853487 5:35202427-35202449 TTGCAATTGCCCAAAATATCAGG + Intronic
989385805 5:40853702-40853724 TTTCACCTGAATAAAATATCTGG - Exonic
989971479 5:50530229-50530251 TCCCACTTGTATAAAATATCTGG + Intergenic
992043772 5:72864193-72864215 TTTAATATGCATTAAATATCAGG - Intronic
993048825 5:82900790-82900812 TAGAACATTCATAAAATATTGGG - Intergenic
993237954 5:85339494-85339516 TTCAAGTTGCATTAAATATAAGG + Intergenic
993952113 5:94188765-94188787 TTTTACTTGAATAAAATAGCTGG + Intronic
996042822 5:118834948-118834970 TTGGATTTCCATAAAATATCAGG - Intergenic
996209901 5:120795648-120795670 TGGAACATGCATACAATGTCTGG - Intergenic
996572711 5:124949442-124949464 TTGAATATGTATAAAATAACAGG - Intergenic
998702695 5:144722202-144722224 TTGAGCCTGTATAATATATCTGG + Intergenic
998869328 5:146536894-146536916 TTGATCTTACATGAAATATCAGG - Intergenic
999938649 5:156516253-156516275 ATGCTCTTGCATAAAATATCTGG - Intronic
1001760341 5:174203197-174203219 TGGAAGTTGCACAGAATATCTGG + Intronic
1003411976 6:5873316-5873338 TTATACTTGCATAAAACATGGGG - Intergenic
1003993294 6:11510294-11510316 ATGAACATGGATAAAATCTCTGG + Intergenic
1007050036 6:38817805-38817827 ATGAATTTACATAAAATACCTGG + Intronic
1012032480 6:94089478-94089500 CTGAACTTGTATAGAATCTCTGG + Intergenic
1012536478 6:100304267-100304289 TTAAAACTGCATAAAATATTTGG + Intergenic
1012729613 6:102865434-102865456 TTGAAGTTAGATAAAATACCTGG - Intergenic
1012905869 6:105065007-105065029 TTGGACTTGTATAAACAATCTGG + Intronic
1013581362 6:111537909-111537931 TTGATATAGCATACAATATCAGG + Intergenic
1016138029 6:140570789-140570811 TTGACCTTGTTTAAAATCTCAGG - Intergenic
1018513506 6:164552540-164552562 TTGTACTTTCATAAAGTTTCAGG - Intergenic
1018515686 6:164577704-164577726 TTGAACTAGATCAAAATATCTGG - Intergenic
1018670521 6:166173172-166173194 TTGGCCCTGAATAAAATATCTGG + Intergenic
1019876524 7:3816746-3816768 TTGAACTTGCTTAAATTGTGAGG + Intronic
1020496914 7:8865576-8865598 ATGAACTTTTAAAAAATATCAGG + Intergenic
1021247224 7:18278691-18278713 TTTAAATTGACTAAAATATCAGG + Intronic
1023265035 7:38395611-38395633 TTGATCTTATATAATATATCCGG + Intronic
1023702770 7:42909284-42909306 TGCATCTTGCATTAAATATCTGG - Exonic
1027633798 7:80643900-80643922 TATAACTTGCAGAAAATATTTGG + Intronic
1027933936 7:84578239-84578261 TGGAAATAGCATAAAATATCAGG + Intergenic
1030973886 7:116096633-116096655 TTTAAAATGCACAAAATATCGGG - Intronic
1033232903 7:139615482-139615504 CTGAACTTGCATGAAAAATGAGG + Intronic
1033993943 7:147322092-147322114 TAGAACTTGGATGTAATATCTGG - Intronic
1034737582 7:153443259-153443281 TTGAATTAGCAGAAAACATCAGG + Intergenic
1040717492 8:50274871-50274893 TTGAACTAGCGTCAAATATGTGG + Intronic
1040798899 8:51319469-51319491 TTGCACTTACAGAAAACATCTGG - Intergenic
1041159770 8:55027621-55027643 TTGAATTGGCCTGAAATATCTGG + Intergenic
1044182047 8:89208298-89208320 TTCAACATACATAAAATTTCAGG + Intergenic
1044399273 8:91751341-91751363 TGGAGCTTACATAAAATATATGG - Intergenic
1045835713 8:106519147-106519169 ATTCACTTGCATAAAACATCTGG - Intronic
1045842766 8:106598878-106598900 TTATATTTGCTTAAAATATCAGG - Intronic
1045866526 8:106872068-106872090 TTAAAATTGTATAAAATATCTGG + Intergenic
1046363975 8:113201307-113201329 TTGAACTTTTATAATATATGAGG - Intronic
1046587768 8:116168536-116168558 ATGACCTTGAATAAAATATCAGG + Intergenic
1046657268 8:116908658-116908680 TTTAAATAGCATAAAACATCTGG + Intergenic
1046979422 8:120320529-120320551 TTGAACTTGAGTCAACTATCTGG + Intronic
1047234075 8:123023616-123023638 TTGAAATTGCATTAACTATGGGG - Intronic
1048691010 8:136963363-136963385 TAGAGAATGCATAAAATATCTGG + Intergenic
1049605542 8:143527560-143527582 TGAATCTTGCATAAATTATCAGG - Intronic
1050222894 9:3415669-3415691 TTGAAGTTGCAAAATATTTCAGG - Intronic
1050895458 9:10880536-10880558 TTGATATTGCATAAAATTTGAGG + Intergenic
1052231233 9:26156162-26156184 TTAAAATTTCAGAAAATATCAGG - Intergenic
1053031601 9:34784364-34784386 CAGAATTTGCATAATATATCTGG + Intergenic
1053402112 9:37834490-37834512 TTGGACTTTCATAAAAAATAGGG - Intronic
1053676135 9:40429957-40429979 TTTTACTTGCATAAACTTTCAGG - Intergenic
1053883226 9:42616532-42616554 ATGAACTTGCCTAAAATAAAAGG - Intergenic
1053889443 9:42677767-42677789 ATGAACTTGCCTAAAATAAAAGG + Intergenic
1053925909 9:43056069-43056091 TTTTACTTGCATAAACTTTCAGG - Intergenic
1054222249 9:62424005-62424027 ATGAACTTGCCTAAAATAAAAGG - Intergenic
1054228464 9:62485167-62485189 ATGAACTTGCCTAAAATAAAAGG + Intergenic
1054287585 9:63194936-63194958 TTTTACTTGCATAAACTTTCAGG + Intergenic
1054289204 9:63265481-63265503 TTTTACTTGCATAAACTTTCAGG - Intergenic
1054387236 9:64570028-64570050 TTTTACTTGCATAAACTTTCAGG - Intergenic
1054508487 9:65946337-65946359 TTTTACTTGCATAAACTTTCAGG + Intergenic
1057596636 9:96419817-96419839 TTAGACGTACATAAAATATCTGG + Intergenic
1059420069 9:114185328-114185350 TGGGACTTGCATAAAATGCCAGG + Intronic
1060117306 9:120952299-120952321 CTGATCTAGCATAAAATAACAGG + Intergenic
1062667688 9:137685323-137685345 TTCCACTTACATGAAATATCGGG - Intronic
1185678183 X:1865778-1865800 TTGCGCTTGCAAAAAATATGGGG - Intergenic
1186609556 X:11125717-11125739 TTGATCTTTCAAAAAATATCAGG + Intergenic
1187053485 X:15717530-15717552 TTCCAGTTGCATAAAATATTAGG - Intronic
1188277765 X:28222076-28222098 ATGAACTTTTATAAAATACCTGG - Intergenic
1188777156 X:34234035-34234057 TTGATATTGCAAAAAATATCAGG - Intergenic
1197068294 X:122261453-122261475 TTGAACTGGGAAAAAATGTCTGG - Intergenic
1197129401 X:122987597-122987619 TTGAACTTACATAAGTTCTCTGG - Intergenic
1198146856 X:133866665-133866687 TTAAAGAAGCATAAAATATCAGG - Intronic
1202305990 Y:23471654-23471676 TTGAACTTTCAGAAAATGGCAGG + Intergenic
1202564819 Y:26198935-26198957 TTGAACTTTCAGAAAATGGCAGG - Intergenic