ID: 920988802

View in Genome Browser
Species Human (GRCh38)
Location 1:210915838-210915860
Sequence AGCTCGGATAATCTATATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920988796_920988802 23 Left 920988796 1:210915792-210915814 CCAAGTTGTAATGAGATGTTCAG 0: 1
1: 0
2: 2
3: 5
4: 121
Right 920988802 1:210915838-210915860 AGCTCGGATAATCTATATTATGG 0: 1
1: 0
2: 1
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920988802 Original CRISPR AGCTCGGATAATCTATATTA TGG Intronic
909012288 1:70348241-70348263 AGATAGGATAATCTATTTCATGG - Intronic
920779477 1:208974667-208974689 AGCTCTGGTAAGCCATATTATGG - Intergenic
920988802 1:210915838-210915860 AGCTCGGATAATCTATATTATGG + Intronic
1078382414 11:10856738-10856760 AGATGAGATAATCTATATGAGGG - Intronic
1080307376 11:30851257-30851279 AGGTCAGATAATTTATTTTAGGG + Intronic
1081172607 11:39887325-39887347 AGCTGAGATAATTTATATTTTGG + Intergenic
1086021402 11:82234574-82234596 ATCCAGGATAATCTATTTTAAGG + Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1097615032 12:61873790-61873812 AACTTGGATATTCTATATTCAGG - Intronic
1098003446 12:65969778-65969800 AGCTAGGATTAACTATGTTAGGG - Intergenic
1100637349 12:96447660-96447682 AGGTCTAATAATCTTTATTAAGG + Intergenic
1112945466 13:104921390-104921412 AGCTGGGAAAATATATATGAGGG + Intergenic
1116715515 14:48420585-48420607 ATCCAGGATAATCTATTTTAAGG + Intergenic
1121012563 14:90529490-90529512 ATCTCTGATTATCTATCTTAGGG - Exonic
1126928901 15:53624902-53624924 AACTCAGAAAATATATATTATGG - Intronic
1133625826 16:7569539-7569561 ATCCAGGATAATCTATTTTATGG + Intronic
1135664337 16:24323382-24323404 ATCTTAGATAATCTTTATTAGGG - Intronic
1137752830 16:50879583-50879605 AACTCGGATTATCTGAATTATGG - Intergenic
1149167614 17:53771838-53771860 ACATCGGAAAATCTATCTTAAGG + Intergenic
1163208948 19:15826082-15826104 AGCTGGCATAATATATAATAAGG + Intergenic
929319289 2:40522188-40522210 AGCTTGGATAATCTAACTAAAGG + Intronic
939186234 2:138863893-138863915 AGCTTGGGAAATCTATTTTAGGG - Intergenic
1169977079 20:11341620-11341642 AGATCAGGTAATTTATATTAAGG - Intergenic
1170063681 20:12287498-12287520 AGCTGGGATAATCTATTTTAAGG + Intergenic
1179216441 21:39371123-39371145 AACTAGGTTAATCTAAATTAAGG + Intergenic
951092722 3:18593753-18593775 AGCTCTAATAATCTATAATATGG - Intergenic
952908044 3:38156551-38156573 AAATAGGATGATCTATATTAAGG - Intergenic
956154478 3:66281128-66281150 AACTCAGATAATCCAGATTATGG - Intronic
960414375 3:117366111-117366133 ATCTCTAATAGTCTATATTAAGG + Intergenic
963880934 3:150527460-150527482 AGCTCAGATAATCTACATGTTGG + Intergenic
971640863 4:29131069-29131091 TACCCAGATAATCTATATTAAGG + Intergenic
973023277 4:45232126-45232148 AGTTAGGATAATGTATTTTATGG - Intergenic
973301962 4:48595203-48595225 AGCTCAGAGAATTTATAGTAGGG - Intronic
978733853 4:112063002-112063024 TGCTGGGATATTCTTTATTATGG - Intergenic
986378353 5:7157573-7157595 AGCTTGGAAAATCTATTTAAGGG - Intergenic
993956447 5:94240188-94240210 AACTCGGCTAACCCATATTAAGG + Intronic
999124472 5:149236878-149236900 AACTGGGTTAATCTATATAAGGG + Intronic
1000550884 5:162662722-162662744 AGCTCTTACCATCTATATTAGGG + Intergenic
1007086591 6:39151858-39151880 TGCTTAGATAATCTTTATTAGGG - Intergenic
1021066845 7:16185988-16186010 AGCTGCTATAAACTATATTATGG - Intronic
1022068824 7:26889213-26889235 AGTTCAGATAATTTATTTTATGG + Intronic
1026577801 7:71588467-71588489 AGCTCTAATAGTCTATATCAAGG - Intronic
1034014893 7:147571678-147571700 AGCTCTCCTATTCTATATTAGGG + Intronic
1036431066 8:8691174-8691196 AGCTGGATTAATCTATATTTGGG - Intergenic
1048647008 8:136432984-136433006 TGCTGGGATAATTTTTATTATGG - Intergenic
1049403183 8:142439974-142439996 AGCTCGGCTCCTCTATATCATGG - Intergenic
1056903240 9:90620901-90620923 AGATAGGATAATCTAGATAATGG - Intronic
1187743059 X:22377052-22377074 AAATCAGATAATTTATATTATGG + Intergenic