ID: 920993988

View in Genome Browser
Species Human (GRCh38)
Location 1:210969189-210969211
Sequence TTCATCCATCCTCATGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920993986_920993988 28 Left 920993986 1:210969138-210969160 CCTTTTCTGTACATTATGAATTC 0: 1
1: 0
2: 1
3: 30
4: 357
Right 920993988 1:210969189-210969211 TTCATCCATCCTCATGAGTGAGG 0: 1
1: 0
2: 2
3: 13
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920993988 Original CRISPR TTCATCCATCCTCATGAGTG AGG Intronic
900880948 1:5380972-5380994 TGCATACCACCTCATGAGTGAGG + Intergenic
901588970 1:10323228-10323250 TTCATCCTCTCTCATTAGTGAGG + Intronic
909484425 1:76157552-76157574 TTCTTCCATCCACTTTAGTGAGG + Intronic
910155171 1:84209198-84209220 TTCATCCAGTCTCATGACTCAGG + Intronic
913162760 1:116159980-116160002 TTCATCCTTCCTGATGATTTTGG + Intergenic
914415205 1:147474071-147474093 TTCTTCCATCTTCATCAATGTGG - Intergenic
916003122 1:160635298-160635320 TTCATCTATCGTGATGTGTGTGG + Intronic
916494313 1:165331122-165331144 ATCATCCTTCCTCTTGAGTATGG - Intronic
917063017 1:171061178-171061200 TTCAGTCATCCTCATGGGTTTGG - Intronic
917113811 1:171580779-171580801 GTCATCCATACTCATGATGGTGG + Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
920993988 1:210969189-210969211 TTCATCCATCCTCATGAGTGAGG + Intronic
924592623 1:245418065-245418087 TTCATCGATGCTGTTGAGTGGGG + Intronic
1063931886 10:11036944-11036966 TTCTTCCAGCCTCCTGACTGTGG + Intronic
1065438260 10:25723874-25723896 TTCATTCATTTTCAAGAGTGAGG + Intergenic
1065524970 10:26610941-26610963 AGCCTCCATCCTCATGAATGGGG + Intergenic
1067394820 10:45905380-45905402 TTCAGCCAACCTTCTGAGTGGGG - Intergenic
1067863142 10:49874511-49874533 TTCAGCCAACCTTCTGAGTGGGG - Intronic
1073613139 10:104964590-104964612 TTCATCCAACCTATTGACTGAGG - Intronic
1074319575 10:112389311-112389333 GTCATCCATCCACAGGAGAGGGG + Intronic
1074556888 10:114499698-114499720 TTCATCCACCCTCAGGTTTGTGG - Intronic
1075876438 10:125810174-125810196 GTCATCCCTCCGCTTGAGTGTGG + Intronic
1081935727 11:46902783-46902805 TACATCCATCCTCATCGCTGTGG + Exonic
1082917358 11:58451849-58451871 TTCATCCATCTTCATAAATGTGG - Intergenic
1083067721 11:59942993-59943015 TTCTACCATCCTCATGACTGTGG + Intergenic
1083849256 11:65355523-65355545 TTCATCCTTCTTCCCGAGTGAGG + Intronic
1084762581 11:71283351-71283373 GTCATCCAGCCTCAGGAATGGGG - Intergenic
1089082718 11:115790496-115790518 TTCATTCATCATCATAAGTTGGG + Intergenic
1090284719 11:125489748-125489770 TTCATCCAGACTCACCAGTGGGG + Exonic
1092293234 12:7177820-7177842 TTCTTACAGCCTCATGAGGGAGG + Intergenic
1095077979 12:37956343-37956365 TTCATCCATTCTTTTGATTGAGG - Intergenic
1102528875 12:113531751-113531773 TTTATCCAACCTCAGGAATGTGG + Intergenic
1103225715 12:119285581-119285603 CTCTTCCAAGCTCATGAGTGTGG + Intergenic
1106169454 13:27276210-27276232 TACCTCTATCCTCATGAGAGAGG + Intergenic
1106642004 13:31594321-31594343 TTCTACCATGCTCTTGAGTGTGG - Intergenic
1106673831 13:31935871-31935893 TTCATTCACCCTCGTGAGTGTGG - Intergenic
1107266637 13:38563279-38563301 GTCATCAAACCTCATCAGTGGGG - Intergenic
1107507881 13:41053483-41053505 TTCATCCATTCTCCTCAGTGTGG + Intronic
1107543978 13:41419775-41419797 TTAATGCATCCTCCTGAGGGTGG - Intergenic
1110523380 13:76506712-76506734 CTCAGGCATCCTCATGGGTGAGG + Intergenic
1110813626 13:79838297-79838319 TGCCTTCATCCTCATGACTGTGG + Intergenic
1112228364 13:97563618-97563640 TTCATGCAACCCCATGAGGGAGG + Intergenic
1113249026 13:108430731-108430753 TTCATCCATGATCATCAGTGTGG - Intergenic
1114965770 14:27957329-27957351 TTCCTCCATCCCCATCAGAGGGG - Intergenic
1118318507 14:64739797-64739819 GGGCTCCATCCTCATGAGTGGGG - Intronic
1118416939 14:65549653-65549675 CTCATCCATCATCATTAGTTAGG - Intronic
1119118132 14:72046079-72046101 GTCATCCATCCTCCTGATGGAGG + Intronic
1120324137 14:83004293-83004315 TTCTTCCATACTCAAGATTGTGG - Intergenic
1124184744 15:27514664-27514686 TTGTTCCTTCCTCGTGAGTGTGG - Intronic
1125421778 15:39511432-39511454 TTCAACCAGCCTCAAGACTGAGG + Intergenic
1131869251 15:96744745-96744767 TTCACCCATTCTCATCTGTGAGG + Intergenic
1136144801 16:28310213-28310235 TTCCTCCACCCTCTTGAGTGTGG + Intronic
1136636531 16:31527909-31527931 TTCACGCACCCTCAAGAGTGTGG + Exonic
1141677817 16:85526738-85526760 TTTATCCATCATCAGAAGTGAGG - Intergenic
1143704653 17:8687888-8687910 TTCATCCATCCTTGTGATTCTGG + Intergenic
1146382815 17:32343881-32343903 TTCTACCATCCTCATGACTGTGG - Intronic
1153010418 18:533793-533815 TAAATGCATGCTCATGAGTGGGG - Intergenic
1153137918 18:1939154-1939176 TTCATCTATGCTTGTGAGTGAGG - Intergenic
1157392607 18:47315454-47315476 TTCATCCATACTCTTGTGTGTGG + Intergenic
1158733519 18:60053530-60053552 TTCATACTTCCTGATGAGTTTGG + Intergenic
1159091026 18:63849484-63849506 TAAATCCATCTTCATGGGTGAGG + Intergenic
1162235410 19:9305202-9305224 AACATCCAGGCTCATGAGTGTGG - Intronic
1162732981 19:12730090-12730112 TTCATCCATCCTCCTCACTTAGG + Intergenic
1163137834 19:15325544-15325566 TTCATACATCATCATTTGTGGGG + Intronic
1164576943 19:29410720-29410742 GTTATCCATCATCATCAGTGTGG - Intergenic
1166148275 19:40851926-40851948 TCCATAAATCCTCTTGAGTGAGG + Intronic
1166171298 19:41029235-41029257 TCCATAAATCCTCTTGAGTGAGG + Intergenic
1166177763 19:41086934-41086956 TCCATAAATCCTCTTGAGTGAGG - Intergenic
1168244688 19:55106242-55106264 TTGATCCATCCTCTTTGGTGTGG + Intronic
926720097 2:15953632-15953654 TTCAGCCATCTTCCTGAGAGAGG + Intergenic
927408497 2:22798941-22798963 TTTATCCATCTTCATAAATGTGG - Intergenic
927669159 2:25054211-25054233 CTCATACATCCTCATGAGTGGGG - Intronic
929417341 2:41756805-41756827 TTCCTCCACCCTCTTCAGTGAGG - Intergenic
931409973 2:62019853-62019875 ATCTTCCCTCCTCTTGAGTGCGG - Intronic
937412918 2:121692011-121692033 TTTTACCATCCTCATGAGTATGG + Intergenic
941613636 2:167693468-167693490 TTCATCCAACCTCATGAGAGTGG + Intergenic
941714471 2:168749287-168749309 TTCATCCATGGTTATGAGTGTGG - Intronic
943669060 2:190641402-190641424 TCCATCCACCCTCATGATGGAGG + Intergenic
944267555 2:197745777-197745799 GTCATCCTTTCTCATGACTGAGG - Intronic
945232304 2:207605249-207605271 TATAGCCATCCTCATGGGTGTGG + Intronic
947994243 2:234513549-234513571 TCCCTGCAGCCTCATGAGTGAGG - Intergenic
948502665 2:238406683-238406705 TTCGTCCGTCCTCAGGGGTGGGG - Intergenic
948675918 2:239596637-239596659 TTCCTCCTTCCTCATGAGGTAGG - Intergenic
1168761481 20:353089-353111 TTGATCCATCCTCAGGAGATGGG - Intronic
1173361926 20:42352324-42352346 TCCATCCAGCTTCCTGAGTGAGG - Intronic
1174409607 20:50325869-50325891 TTCACCCATGCTGTTGAGTGTGG + Intergenic
1182050396 22:27308717-27308739 TTCATCCCACCTGAGGAGTGAGG - Intergenic
949321888 3:2820544-2820566 TTCTCCCATCCCCAAGAGTGGGG + Intronic
951786106 3:26420990-26421012 TTATTCCCTCCTCTTGAGTGTGG + Intergenic
954845933 3:53556090-53556112 TTCATCCATGTTTAGGAGTGTGG + Intronic
958065267 3:88536686-88536708 TTAGTCCATCCTCAATAGTGTGG - Intergenic
959646252 3:108705695-108705717 TTGATCCATCCTCATTTCTGAGG - Intergenic
960898052 3:122526940-122526962 TGCATCCCTCCTCCTGAGGGTGG - Intergenic
966254777 3:177905310-177905332 TTTTTCCAACCTCATGACTGAGG - Intergenic
972643353 4:40945212-40945234 TCCATCCATACTGATGTGTGTGG + Intronic
973253827 4:48088504-48088526 TTCATCCATGGTCCTGGGTGGGG - Intronic
975527612 4:75367971-75367993 TTCTTGCATCCTGATGTGTGGGG - Intergenic
977327505 4:95594552-95594574 TTCTTCCATCATCCTGATTGTGG + Intergenic
977335473 4:95693202-95693224 AGCATTCATCCACATGAGTGAGG + Intergenic
978540104 4:109807291-109807313 TGCATCTATATTCATGAGTGAGG - Intergenic
981436506 4:144729610-144729632 TTCTTTCATTCTCATGAGTTAGG - Intronic
981665231 4:147217080-147217102 TTCAGCCATCCTAATGACTTTGG + Intergenic
984288638 4:177764841-177764863 GTAATCCTTCCTCATGAGAGTGG - Intronic
988935588 5:36079407-36079429 TTCTGCCATCCTCATCAGGGAGG - Intergenic
990267203 5:54090259-54090281 TTCATCCATACTCATCTCTGAGG - Intronic
998197036 5:140082882-140082904 TTCATCCATCCCCCTAAATGAGG - Intergenic
998437046 5:142119435-142119457 TTCCTCCACCCACTTGAGTGAGG + Intronic
999928241 5:156403163-156403185 TCCATCCATCCTCCCCAGTGAGG + Intronic
1000814423 5:165903223-165903245 TTCATTGTTCCTCATGAGAGGGG - Intergenic
1001277414 5:170360731-170360753 GTCATCCATTCTCATGAGAATGG + Intronic
1003719338 6:8682955-8682977 TTCATCCAGCAGCATGGGTGTGG + Intergenic
1004917948 6:20349451-20349473 TTCACTCATCCTTATCAGTGTGG + Intergenic
1005849419 6:29809995-29810017 TTCAGCCATTCTCATCACTGTGG - Intergenic
1006471772 6:34233528-34233550 TTCATCCATGCTATTGTGTGTGG - Intergenic
1008779230 6:55082229-55082251 TGCACCCAGCCCCATGAGTGTGG + Intergenic
1011004742 6:82631676-82631698 TTCAACCATGCTCCTGTGTGGGG + Intergenic
1012042403 6:94224961-94224983 TTCTTCCTTCCTCATGAGCATGG - Intergenic
1013168439 6:107615152-107615174 TTCATGCAGCCACATTAGTGAGG + Intronic
1014557824 6:122854979-122855001 TTCAACCATCCTGAGGGGTGAGG - Intergenic
1015556856 6:134471621-134471643 TTTTTCCATACTCATGTGTGAGG + Intergenic
1016418428 6:143857952-143857974 TTCATTTCTCCTCATGACTGAGG - Exonic
1016657030 6:146531044-146531066 TTCTTCATTCCTCTTGAGTGAGG + Intergenic
1018619672 6:165717803-165717825 CACAGCCATCCTCATGGGTGGGG + Intronic
1020012039 7:4810811-4810833 TTCAACCATTCTCATGTGTTCGG + Intronic
1021577874 7:22120892-22120914 CTCATTCATCCTCATTACTGAGG - Exonic
1021883158 7:25113221-25113243 TTCTGCCATCCTCAGGTGTGTGG + Intergenic
1022047827 7:26637212-26637234 TTTGTGCATTCTCATGAGTGGGG - Intergenic
1022147724 7:27562991-27563013 TTCAACCACCATCATCAGTGAGG + Intronic
1023893042 7:44407232-44407254 TTCTCCCATTCTCTTGAGTGTGG - Intronic
1025149927 7:56539932-56539954 CTAATCCAGCCTCATGTGTGTGG - Intergenic
1026383515 7:69822704-69822726 TTCTTCCATCATCTTGGGTGGGG - Intronic
1027925074 7:84449974-84449996 TTCATCCATCCACATACGTTTGG + Intronic
1030522209 7:110611835-110611857 TTCCTCCATCCTTTTGAGTTAGG - Intergenic
1030855394 7:114549480-114549502 TTCCTCCATCCTCCAGAATGGGG - Intronic
1030994025 7:116335937-116335959 TGCATCCATCCTCATGTGGCAGG - Intronic
1031239711 7:119221145-119221167 TTCCTCCAGCCTCATTAGGGAGG + Intergenic
1032416020 7:131736337-131736359 TTCACCCAGCCTCCTGTGTGTGG + Intergenic
1034401928 7:150867863-150867885 TTCACACATTCTAATGAGTGAGG - Intergenic
1037605020 8:20430941-20430963 TTCATCCATCACCATGATTAAGG - Intergenic
1039798917 8:40937768-40937790 TCCATCCATCCCCCTGAGTGTGG + Intergenic
1041981357 8:63864796-63864818 TTGTTACAGCCTCATGAGTGTGG + Intergenic
1043121944 8:76337636-76337658 TTCTTCCATCCTCTTCAGTGAGG - Intergenic
1045309826 8:100991469-100991491 TTCATGCTTCCTCATAAGTGTGG - Intergenic
1051129283 9:13841423-13841445 TTCCTCCAACCTCAGGAGTCTGG - Intergenic
1051390023 9:16554011-16554033 GTCATCTAACCTCATGAGTCAGG + Intronic
1053419985 9:37971213-37971235 TACATCCATCTGCATGTGTGTGG - Intronic
1055700241 9:78936994-78937016 TTCATCCATCCTTTTCAGTTCGG + Intergenic
1056146470 9:83735901-83735923 TTCATACAACCTCATGGGAGAGG + Intergenic
1061781712 9:133000023-133000045 TACACCCCTCCTCATGACTGGGG + Intergenic
1185690163 X:2148283-2148305 TTTATCCCTTCCCATGAGTGAGG + Intergenic
1187804359 X:23102066-23102088 TACATCCATATTCATGAGTGAGG + Intergenic
1188294911 X:28435606-28435628 TTCATCTATGCTCCTGAGTCTGG + Intergenic
1188456477 X:30372422-30372444 TTCATCTCTCCTCATCAGCGGGG - Intergenic
1190749010 X:53344946-53344968 TTAATCCCTCCCCTTGAGTGTGG + Intergenic
1190775435 X:53548922-53548944 TTCTTCCATCCCCAGGAGTTGGG + Intronic
1195099196 X:101538154-101538176 TTCAATTATCTTCATGAGTGAGG - Intergenic
1195394633 X:104397680-104397702 TGCATCCTTCCCCATGACTGGGG - Intergenic
1196768615 X:119272050-119272072 CCCATCCATCCTGATGTGTGTGG + Intergenic
1198269336 X:135040107-135040129 TTAATCCATCGTCATCAGTTTGG + Intergenic
1198723965 X:139656491-139656513 TTCATCCTTTCTCTTTAGTGTGG - Intronic