ID: 920998690

View in Genome Browser
Species Human (GRCh38)
Location 1:211019854-211019876
Sequence TGGGAAACTTTATGAATACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920998686_920998690 17 Left 920998686 1:211019814-211019836 CCACAGTGGAAGTACACTAGAAA 0: 1
1: 0
2: 43
3: 393
4: 2198
Right 920998690 1:211019854-211019876 TGGGAAACTTTATGAATACTTGG 0: 1
1: 0
2: 3
3: 17
4: 251
920998685_920998690 22 Left 920998685 1:211019809-211019831 CCTGACCACAGTGGAAGTACACT 0: 1
1: 0
2: 1
3: 31
4: 180
Right 920998690 1:211019854-211019876 TGGGAAACTTTATGAATACTTGG 0: 1
1: 0
2: 3
3: 17
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920998690 Original CRISPR TGGGAAACTTTATGAATACT TGG Intronic
901475433 1:9486156-9486178 TGGGAGGCTCTAGGAATACTAGG - Intergenic
902119997 1:14156127-14156149 TTGGAAACTATACGAATACATGG - Intergenic
903810506 1:26032549-26032571 TGGGGTGTTTTATGAATACTTGG + Intronic
906030106 1:42712422-42712444 TGAGAAACTTTATGAATACATGG - Intergenic
907900253 1:58734703-58734725 TGGGAAAGTTTATAATTTCTTGG + Intergenic
909227780 1:73046771-73046793 TGGCCAAATCTATGAATACTTGG + Intergenic
909355856 1:74709031-74709053 TGGGAAGCAGTATAAATACTTGG + Intronic
909437408 1:75658477-75658499 TTGGAAACTTCATAAATACATGG + Intergenic
909565560 1:77049540-77049562 TGGGAAAATTAATGAATGGTGGG + Intronic
909905002 1:81183929-81183951 TGGTAAACTTTATCTGTACTAGG - Intergenic
910021134 1:82591228-82591250 TGGGAACCATTATGAAACCTAGG - Intergenic
910609877 1:89129287-89129309 TGAGAAACTTGATGAACACAGGG + Intronic
910712587 1:90196896-90196918 TGTGAATCTTTTTGATTACTTGG + Intergenic
911818789 1:102389297-102389319 TGGTAAACTTTATTAAGATTAGG + Intergenic
912862912 1:113230757-113230779 TGGGAAAATATATGAATCATAGG - Intergenic
914963880 1:152235333-152235355 TGGGAAACTGTACAAATACATGG - Intergenic
917134055 1:171771501-171771523 TGGACAACTTTGAGAATACTGGG + Intergenic
917573773 1:176297623-176297645 TTGGAAACTATATGAACACATGG - Intergenic
917800057 1:178562075-178562097 TGGAAAACTTTCTGAAAACACGG - Intergenic
917991254 1:180381567-180381589 TTGGAAACTGTATAAATACATGG + Intronic
918580539 1:186121895-186121917 TGGAAAACTTAATGAAGGCTAGG + Intronic
919374227 1:196772271-196772293 TTGGAAACTTTACAAACACTTGG - Intergenic
920998690 1:211019854-211019876 TGGGAAACTTTATGAATACTTGG + Intronic
921767920 1:218994978-218995000 TGGAAAACTCTATGAAGACATGG + Intergenic
1063951768 10:11229888-11229910 TGGGAAGCTGTAAAAATACTAGG - Intronic
1066642360 10:37567934-37567956 TTGGAAAATTCATGAATACATGG - Intergenic
1067983909 10:51120263-51120285 TGGTTAACTATATGAATATTAGG + Intronic
1068343941 10:55746872-55746894 TGGGAATGTTTATGATTAATTGG - Intergenic
1068781605 10:60924841-60924863 TTGGAAACTTTATGAACACATGG + Intronic
1069221142 10:65885213-65885235 TTGGAAACTGTACAAATACTTGG - Intergenic
1069680212 10:70279021-70279043 TGGTATAATTTATGAATACAAGG + Intronic
1069977611 10:72227041-72227063 TGGGAAACTTCCTTAATACTAGG - Intronic
1070643730 10:78187021-78187043 TGGGAAACTTTTAGTATGCTGGG - Intergenic
1072113902 10:92349906-92349928 TGGGGAACTGTATAAATATTCGG + Intronic
1072146724 10:92647011-92647033 TGGGGAACTTTATAATTAATAGG + Intronic
1072594475 10:96858682-96858704 GGGAAAACTTTATGAATGTTTGG + Intronic
1072863040 10:99026821-99026843 TTGGAAACTGTATAAATACATGG + Intronic
1072924518 10:99604800-99604822 TGGTTAATTTTATGTATACTTGG + Intergenic
1077912276 11:6582850-6582872 TTGGAAACTATATGAACACATGG + Intronic
1078885056 11:15491836-15491858 TGGGAACCTTTACAAGTACTTGG - Intergenic
1080351411 11:31389859-31389881 TTGGAAACTATATAAATACATGG + Intronic
1081021216 11:37949966-37949988 TCTGAAATTTTATAAATACTGGG - Intergenic
1082655366 11:55849176-55849198 TGGGAAATTTTTTGAACACTTGG + Intergenic
1082752956 11:57041278-57041300 TTGGAAACTTTACGAATATGTGG + Intergenic
1088375698 11:109139315-109139337 TTGAAAACTATATGAATACATGG - Intergenic
1090148986 11:124361117-124361139 TGGGAAAATTCAGGAATACGTGG - Intergenic
1090540986 11:127704486-127704508 TGGAAAACTTTATGAAAGATGGG + Intergenic
1091261839 11:134240831-134240853 TGGGCAACATTATGAAACCTTGG - Intronic
1092326476 12:7536147-7536169 TTGGAAACTATATAAATACATGG - Intergenic
1092848002 12:12601922-12601944 TGGAAAACTTTATGAGGGCTAGG + Intergenic
1093215772 12:16359743-16359765 TGGGCAATTTTATAAATACAGGG - Intronic
1094433151 12:30392708-30392730 TGGGAAACTCTATCAATTTTTGG - Intergenic
1094440788 12:30473942-30473964 TTGGAAACTATATAAATACATGG + Intergenic
1094683825 12:32690558-32690580 TGGGAAAGTTGAAGACTACTGGG + Intronic
1094713450 12:32987581-32987603 TGGGGCACTTTTTAAATACTGGG + Intergenic
1095281767 12:40360346-40360368 TGGGAAATTTGATGGATAATGGG - Intronic
1097977558 12:65704075-65704097 TTGGAAACTGTATAAATACATGG - Intergenic
1098708712 12:73725848-73725870 TAGAGAACTTTATGATTACTGGG - Intergenic
1099390859 12:82077526-82077548 TTGGAAACTGTATAAATACATGG - Intergenic
1099532255 12:83798591-83798613 TGGTAAAATTTATGAAAACATGG - Intergenic
1100362771 12:93893557-93893579 CGGGGAATTTTATAAATACTCGG + Intronic
1100810505 12:98332811-98332833 TGGGTTAATTTATGACTACTTGG - Intergenic
1101890079 12:108705562-108705584 TGGAAAATTTTGTGAGTACTTGG - Intronic
1108614439 13:52117700-52117722 TGGTAAACTTAATGAATTTTGGG - Intronic
1108858697 13:54827388-54827410 TTGGAAACTATATGAACACATGG + Intergenic
1109031599 13:57197308-57197330 TTGGAAACTATACTAATACTTGG - Intergenic
1109365050 13:61343280-61343302 TGAGAATCTTTAGGAATCCTGGG - Intergenic
1110144736 13:72176997-72177019 TGGTAAACTTCATGAAGACAAGG - Intergenic
1110398236 13:75057740-75057762 TTGGAAACTATATAAATACACGG + Intergenic
1110457566 13:75707317-75707339 TGGGAAAGTTTATGAAAAATTGG - Intronic
1110946185 13:81421606-81421628 TGAGAGAATTTATTAATACTAGG - Intergenic
1112785024 13:102942206-102942228 GGGGAAACATTATACATACTTGG - Intergenic
1112873426 13:104004146-104004168 TGTGAAACTTTGTGAATATGTGG + Intergenic
1113041573 13:106108771-106108793 TGGCCATCTTTATGTATACTAGG + Intergenic
1113520716 13:110938633-110938655 TGGGATACTTTGTGAATTTTTGG - Intergenic
1115542969 14:34439964-34439986 TGGGAAAAATTATGAATGCCAGG - Intronic
1116058198 14:39889392-39889414 TTGGAAACTATATGAATACAAGG + Intergenic
1116406858 14:44577324-44577346 TGGGAAAATTAATGATAACTTGG + Intergenic
1117255751 14:53975765-53975787 TGGGAAGCTTTATGAAAAAGAGG - Intergenic
1117982241 14:61353110-61353132 TTTGAAACTTTTTGAATATTGGG + Intronic
1119832974 14:77719875-77719897 TGGGAAACTTAATTATGACTTGG - Intronic
1130201395 15:81830823-81830845 TGGGACACTTAATGAATGTTGGG - Intergenic
1131852612 15:96559007-96559029 TGGGAAATTTTCTGAAAAGTTGG - Intergenic
1132264188 15:100452326-100452348 TTGAAAACTGTATGAATACATGG + Intronic
1132264189 15:100452359-100452381 TTGAAAACTGTATGAATACATGG + Intronic
1133017809 16:2952674-2952696 TGGGAATGTTTATGAATACGGGG - Intergenic
1135147021 16:19971525-19971547 TGTGAAACTTTATGTATAGTAGG + Intergenic
1137317834 16:47346285-47346307 TGGAAAACTATATAAATACATGG + Intronic
1138018393 16:53453591-53453613 TAGGAAACTTTATGAAAAAAAGG + Exonic
1138065802 16:53940108-53940130 TGGGAAACTTTGTGCGTTCTTGG - Intronic
1138853165 16:60654975-60654997 TGGGAAACCTTCTGAACACCTGG + Intergenic
1139304775 16:65975709-65975731 GGGGGCACTGTATGAATACTTGG - Intergenic
1140862575 16:79031115-79031137 TAGGAAACTATATAAACACTAGG + Intronic
1141856812 16:86687123-86687145 TGGAAAAGTTTATGTAAACTTGG - Intergenic
1145069563 17:19791934-19791956 TTGGAAACTATATAAATACGTGG + Intronic
1146569076 17:33937711-33937733 TTGGAAACTTCATGAATACCTGG - Intronic
1155470597 18:26188137-26188159 TTGGAAACTATACGAATACATGG + Intronic
1155597615 18:27506028-27506050 TTTGAAACTATATGAATACATGG + Intergenic
1155685837 18:28549066-28549088 TGGGAAAGTCTATGAATATGTGG + Intergenic
1156094578 18:33513827-33513849 TTGGAAACTATATAAATACATGG + Intergenic
1159850715 18:73524130-73524152 GGGAAAAATTTATGAAAACTAGG - Intergenic
1159974563 18:74694500-74694522 TAGGAGACTCTATGAATCCTTGG - Intronic
1160068477 18:75601924-75601946 TTGGAAACTTTACAAATACATGG + Intergenic
1166992432 19:46700686-46700708 TGGGAAAATTTATAAATATGAGG + Intronic
925322044 2:2979288-2979310 TTGGAAACTATATAAATACATGG + Intergenic
925771432 2:7286252-7286274 TGGGAAGCTTTAGAAATCCTCGG - Intergenic
926478222 2:13355172-13355194 TTGGAAAATTTATGAATATTTGG - Intergenic
928349655 2:30537931-30537953 TTGGAAACTGTACCAATACTTGG + Intronic
930373482 2:50534424-50534446 TGGGAAACTTTTTGTCTAATTGG - Intronic
930527768 2:52551748-52551770 TTGGAAACTATACAAATACTTGG + Intergenic
930588045 2:53293418-53293440 TTGGAAACTATATGAACACATGG + Intergenic
930641166 2:53855813-53855835 GGGGAAAAATTATAAATACTGGG - Intronic
933318816 2:80746500-80746522 AGGGAAACATTCTGAATCCTGGG + Intergenic
933852179 2:86377303-86377325 TGGGACAATTGAAGAATACTTGG - Intergenic
935751730 2:106241351-106241373 TTGGAAACTGTATGAATACATGG + Intergenic
935912149 2:107908900-107908922 TTGGAAACTGTATGAATACATGG + Intergenic
935978562 2:108604119-108604141 TTGGAAACTATATAAATACATGG - Intronic
936388354 2:112050787-112050809 ATGGAAAATTTATGATTACTTGG - Intergenic
936818733 2:116492237-116492259 TGGAAAACTTTTGGAATATTTGG - Intergenic
938822433 2:134972922-134972944 TTGGAAACTGTATAAATACATGG - Intronic
939153418 2:138498481-138498503 TGCAATACTTTATGAATCCTCGG - Intergenic
939756093 2:146113836-146113858 AGGGAAACTTTATGCATTATTGG + Intergenic
939821179 2:146958852-146958874 TGGGAAACCTGAACAATACTGGG + Intergenic
940225248 2:151394287-151394309 TGGGAAACTTTCAGTATTCTGGG - Intergenic
940405517 2:153296894-153296916 TGGGAAACATCATGACTGCTTGG - Intergenic
940747649 2:157587121-157587143 TGGGAAACTATAAGAATGGTAGG - Intronic
941780124 2:169434692-169434714 TGGGAAACTATACAAATACATGG + Intergenic
943873089 2:193026781-193026803 TTGGAAACTATATGAACACATGG + Intergenic
944143175 2:196478887-196478909 CGGCAAACTTGATGATTACTGGG + Intronic
945052646 2:205839076-205839098 TTGGAAAATTTAAGAATATTTGG + Intergenic
946395291 2:219441253-219441275 TGGCCAACTTTGTGAATAATGGG + Intronic
946995691 2:225388708-225388730 AAAGAAACTTTCTGAATACTTGG + Intergenic
948713790 2:239845298-239845320 TTGGAAACTTTATAAATACATGG - Intergenic
1168916912 20:1496835-1496857 TAGGAAACTATACAAATACTTGG - Intergenic
1171515114 20:25724652-25724674 TTGGAAACTATATAAATACATGG - Intergenic
1172823819 20:37762817-37762839 TGTGAAACTTTATGTTTAGTTGG - Intronic
1173408841 20:42791786-42791808 AAGGAAACTTTTTGAATGCTTGG - Intronic
1174831481 20:53816918-53816940 TGGGAAACTATACAAATACATGG - Intergenic
1179774358 21:43651141-43651163 TGGGAAACTATGTGAACCCTTGG - Intronic
1181323847 22:22029767-22029789 TGGGAAACTATAAAAAGACTAGG + Intergenic
1182048000 22:27291202-27291224 GGGGAAAATTTTTTAATACTAGG + Intergenic
1182860776 22:33557530-33557552 GAGGGAACTTTATCAATACTGGG + Intronic
1184242240 22:43217332-43217354 AGGGAAACTTGATGAAGAGTGGG - Intronic
949786046 3:7743183-7743205 TGGGTAACATTATCAATACCAGG + Intergenic
951270077 3:20614158-20614180 TGGGAAACTTTAAGAAGAATTGG - Intergenic
952066172 3:29573853-29573875 TTGGAAACTATATGAACACAAGG - Intronic
952598475 3:35048529-35048551 TGGGATTTTTGATGAATACTGGG - Intergenic
955031120 3:55219972-55219994 TTGGAAACTATATGAACACATGG - Intergenic
956223374 3:66928025-66928047 TGGAATAGCTTATGAATACTTGG - Intergenic
957238698 3:77629037-77629059 GGGAAAACTTCATGAATAATTGG + Intronic
958084787 3:88793058-88793080 TTGGAAACTATATGAATACTTGG - Intergenic
958164795 3:89866767-89866789 TGGGGAAATTTATTAACACTAGG - Intergenic
958981011 3:100719585-100719607 TGGGAAACTTTTTTATTTCTTGG + Intronic
959473356 3:106780313-106780335 TGGTAAAGTTTATCAAAACTAGG - Intergenic
959797857 3:110454035-110454057 TTGGAAACTGTATAAATACATGG - Intergenic
960095054 3:113681448-113681470 TTGGAAACTATGTGAATACAGGG - Intronic
961993151 3:131213761-131213783 TGGGGAACTTGATGAACTCTGGG - Intronic
962497967 3:135961840-135961862 GAGGAAACTTTTTGAATGCTTGG + Intergenic
962668133 3:137677142-137677164 TTGGAAACTATATGAACACATGG + Intergenic
963610762 3:147465238-147465260 TGAAAAACTTTAAGAATGCTTGG - Intronic
963879175 3:150508692-150508714 TTCAAAACTTTATGAATACATGG + Intergenic
964266928 3:154908385-154908407 TCGGAAACTATATGAACACATGG + Intergenic
964987176 3:162758051-162758073 TGGGAAACTATTTTAATAATTGG - Intergenic
965665488 3:171089336-171089358 TGTGCTACTTTATGTATACTGGG + Intronic
967537003 3:190616848-190616870 TCGGAAACTTGCTCAATACTTGG - Intronic
971664800 4:29468828-29468850 AGGGAAACTTAATGAATAAATGG + Intergenic
972996832 4:44890487-44890509 TTGGAAACTATATAAACACTTGG - Intergenic
973858852 4:55041013-55041035 TGGGAAAAATAATGAATATTGGG + Intergenic
974407308 4:61490776-61490798 GGAGAAACTCTATGAATAATGGG + Intronic
974469932 4:62305613-62305635 TTGGAAACTATATAAACACTTGG + Intergenic
975737413 4:77394666-77394688 TGGGAAACTGGAGGAACACTTGG - Intronic
977280956 4:95039473-95039495 TGGAAAACTTTCAGAACACTGGG - Intronic
978686658 4:111453277-111453299 TGGGATACTTCTTGAAGACTTGG - Intergenic
978853231 4:113363475-113363497 TGGGGAACTATATGCATATTGGG + Intronic
979033028 4:115676890-115676912 TGGGAAACAACATGAATACGGGG + Intergenic
980203420 4:129685620-129685642 TGGGAAACTTGACGAGTAGTGGG - Intergenic
980573952 4:134661509-134661531 TGGGAAATTTTAGAAATGCTGGG + Intergenic
980764216 4:137278382-137278404 AGAGAAACTTGATGAATAATAGG + Intergenic
981443239 4:144806780-144806802 TGGGAAAATGGATGAATCCTTGG - Intergenic
981636402 4:146885667-146885689 TGGCAAATTTTATGATTGCTAGG + Intronic
983323042 4:166218419-166218441 TGGAAAACTATATGAAAAATTGG - Intergenic
984172109 4:176371758-176371780 TTGGAAACTATATAAATACATGG - Intergenic
984941918 4:184940127-184940149 TGGGAAACTTTAGAACTGCTGGG - Intergenic
986810655 5:11354946-11354968 TTGGAAACTTTACAAATACATGG + Intronic
986940780 5:12946714-12946736 TGAGAAACTTTTAGAATATTTGG + Intergenic
987981417 5:25090001-25090023 TGGGCAACTCTCTGCATACTTGG + Intergenic
989372678 5:40725650-40725672 TGGGAAAGGTAATGAATACCAGG - Intronic
989809106 5:45650859-45650881 TGGGAAACCTTAAGAAGAGTGGG - Intronic
992270207 5:75055299-75055321 TTGGAAACTTTATGATGAATAGG - Intergenic
993028388 5:82673111-82673133 TGGTAAAATGTATGAGTACTTGG + Intergenic
993241608 5:85395513-85395535 TGGGAAACTATACAAATACATGG - Intergenic
993623612 5:90196241-90196263 TTGGAAACTGTATAAATACATGG + Intergenic
996162552 5:120183308-120183330 TTGGAAACTATACAAATACTTGG + Intergenic
996684061 5:126260492-126260514 TGGGAAACTGTATAAACACATGG + Intergenic
996931390 5:128893161-128893183 TTGGAAACTATACAAATACTTGG - Intronic
997226843 5:132215321-132215343 TGGAAAACCTTATGATTACCTGG - Intronic
998538423 5:142955877-142955899 TGTGAAGCTTTATGCTTACTTGG + Intronic
999707703 5:154289130-154289152 AGGGAAAGTTTATGAAAACACGG - Intronic
999849319 5:155521400-155521422 TGGGAAACTATAAAAATACATGG - Intergenic
1000246854 5:159455511-159455533 TGGGAAAGTTCATGAGTTCTTGG + Intergenic
1006242179 6:32692410-32692432 TGGGAAACTATAAAAATACATGG + Intergenic
1007815327 6:44519934-44519956 TTGGAAACTATATAAATACATGG - Intergenic
1008439096 6:51511811-51511833 TAGGAGAGTTAATGAATACTGGG + Intergenic
1008475447 6:51931288-51931310 TGGGAAACTGAGTGAATGCTGGG + Intronic
1009915972 6:69997099-69997121 TGGGAAACTTAATGCATATGTGG + Intronic
1011225849 6:85105796-85105818 TTGGAAACTATATAAATACATGG - Intergenic
1011616400 6:89201852-89201874 TGGGAAGCTTTAAAAATACCAGG - Intronic
1011696143 6:89914831-89914853 TTGGAAACTATATAAATACATGG - Intergenic
1012223605 6:96680086-96680108 CGGGGAAATTTGTGAATACTTGG + Intergenic
1015030592 6:128589892-128589914 TGGGAAACTATACTAATACAAGG + Intergenic
1015966361 6:138698603-138698625 AGGAAACCTTTATGAATCCTTGG + Intergenic
1016135355 6:140533884-140533906 TTGGAAACTTTAAAAATACATGG + Intergenic
1016586682 6:145696127-145696149 TGGGAAAATTTACAAATACGTGG + Intronic
1016612253 6:146003796-146003818 TTGGAAACTGTACGAATACATGG + Intergenic
1017293033 6:152763303-152763325 TTGAAAACTTAATGAAAACTAGG + Intergenic
1018861121 6:167711549-167711571 TGGAAAGCTTTATAAATAGTGGG - Intergenic
1020018015 7:4842817-4842839 TGGGGAACTTTACCACTACTGGG + Intronic
1021547749 7:21834206-21834228 TTGGAAACTATACAAATACTTGG + Intronic
1021844121 7:24747543-24747565 ATGGAAACTTTTTGAACACTTGG - Intronic
1023232298 7:38047443-38047465 TTGGAAACTTTACAAATACATGG - Intergenic
1027520373 7:79199203-79199225 TTGGAATCATTATGCATACTTGG - Intronic
1027607957 7:80323600-80323622 TGGGCAAAATTATGAATACAAGG - Intergenic
1027824179 7:83089601-83089623 TGGGAAGTTTGATAAATACTGGG - Intronic
1028112564 7:86959993-86960015 TGGGAAAGTTGATAAATACATGG - Intronic
1028519248 7:91711210-91711232 TTGGAAACTATATAAATACACGG + Intronic
1028900732 7:96097734-96097756 TGGGACACATTTAGAATACTTGG - Exonic
1028901567 7:96106703-96106725 TGGAAAACTTTCCAAATACTTGG - Intronic
1030370192 7:108691058-108691080 TTGGAAACTGTATAAATACATGG - Intergenic
1031223455 7:119003148-119003170 TGGGAAAATTTGTGAATAATTGG + Intergenic
1033733133 7:144197403-144197425 TGGGAAACTATAGGAAAAATTGG + Intergenic
1033743986 7:144295969-144295991 TGGGAAACTATAGGAAAAATTGG + Intergenic
1033749915 7:144353585-144353607 TGGGAAACTATAGGAAAAATTGG - Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1037676306 8:21053789-21053811 TGGGAAAGTCTAGGAAAACTGGG - Intergenic
1038365492 8:26927827-26927849 TGGGAAACTTTATGATTAATGGG + Intergenic
1039009872 8:33081768-33081790 TGGGGAAATTTATGAATATGTGG - Intergenic
1039230071 8:35436040-35436062 TGGCAATATTTATGAATATTTGG + Intronic
1039934347 8:42028038-42028060 TTGGAAACTATATAAATACAAGG - Intronic
1040690585 8:49933219-49933241 TCGGAAACTTCATGAATTGTTGG - Intronic
1041609158 8:59823673-59823695 TGGAAAAGTTTATGAAAAATTGG + Intergenic
1042645812 8:70984985-70985007 TAGCAATCATTATGAATACTTGG - Intergenic
1042688498 8:71468923-71468945 TTTGAAAGTTTATGAATATTTGG - Intronic
1042695488 8:71549772-71549794 TCTCAAACTTTAAGAATACTAGG - Intronic
1045800960 8:106100293-106100315 TTGGAAACTATAAGAATACATGG + Intergenic
1047326472 8:123842247-123842269 TCAGAAACTTTATGAATATGAGG - Intergenic
1048669846 8:136706139-136706161 TCTGAAACTTTATAAGTACTAGG - Intergenic
1050009530 9:1171886-1171908 TGGCAAACCTGATGGATACTGGG - Intergenic
1050553720 9:6771235-6771257 TGTGAATCTTTAGGAATAATTGG + Intronic
1051405776 9:16736398-16736420 TTTGAAACTTTAAGTATACTGGG - Intronic
1052565963 9:30152131-30152153 TGGGAAACTATATAAATACATGG - Intergenic
1058319970 9:103616571-103616593 TGGGAATATTTGGGAATACTTGG - Intergenic
1058420022 9:104824619-104824641 TGGGAAACCCTCAGAATACTGGG - Intronic
1058889010 9:109345011-109345033 TGGGAAGCTTTGGAAATACTGGG - Intergenic
1059402687 9:114080468-114080490 TGAGAAACTTTGTGAACACAAGG - Intergenic
1059798244 9:117723297-117723319 TGGGAAATATTATAAATACATGG - Intergenic
1061357186 9:130115189-130115211 TGGAAAACTTTATGTAGACATGG - Intronic
1186244111 X:7602453-7602475 AGGGAAACCTGATGAATACAAGG - Intergenic
1186494867 X:10004805-10004827 TTTTAAACTTTATGAATACATGG + Intergenic
1187355541 X:18567021-18567043 TGAAAAAGTTTATGAATAATTGG - Intronic
1189054165 X:37681429-37681451 AGGAAGACTTTATCAATACTAGG - Intronic
1189815388 X:44819393-44819415 TGGAAAAATTTAAGAATATTTGG + Intergenic
1191897255 X:66006163-66006185 TGGGAAAGTTTGTGTATGCTGGG + Intergenic
1192060456 X:67819873-67819895 TTGGAAACTATAAGAATACATGG + Intergenic
1193022831 X:76810147-76810169 TTGGAAACTATATGAATACATGG + Intergenic
1194141458 X:90215499-90215521 AGGGAAACTTTATGTATTGTTGG + Intergenic
1195429240 X:104769778-104769800 TGGGAAAGATTATGCAAACTAGG - Intronic
1195824713 X:108986621-108986643 TTGAAAACTATATGAATACATGG - Intergenic
1196620119 X:117812249-117812271 TTGGAAACTTTACCAACACTTGG + Intergenic
1196779903 X:119374588-119374610 TGGGAAACTGAGTGAATAGTGGG + Intergenic
1198396137 X:136221110-136221132 TGGGAAACTCTGTGACTGCTGGG - Intronic
1199418520 X:147615553-147615575 TGGAAAAGCTTTTGAATACTGGG + Intergenic
1200320133 X:155179643-155179665 AGGGAAACTTTATGACTCCTTGG - Intergenic