ID: 920999277

View in Genome Browser
Species Human (GRCh38)
Location 1:211026352-211026374
Sequence CTATACTCCTTGGAGTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920999277 Original CRISPR CTATACTCCTTGGAGTTTCC AGG (reversed) Intronic
901022534 1:6262376-6262398 CTATACTCCCTGTGGTTTCTCGG + Intergenic
901115187 1:6838071-6838093 CAATAGTCCCTGGAGTGTCCAGG + Intronic
904186877 1:28712396-28712418 CTCCACTCCTTGGAGGTTCGGGG + Intronic
906241120 1:44242813-44242835 CTTCCCTCCTTGAAGTTTCCCGG - Intronic
906679280 1:47714225-47714247 CTCTGCTCCTTGGGTTTTCCTGG - Intergenic
908305212 1:62807359-62807381 CTAAATCCCTTGGAATTTCCTGG + Intronic
909743838 1:79067835-79067857 CTATACTACCTGGATCTTCCAGG - Intergenic
909965257 1:81901805-81901827 CTATATCCCTTGAAGTTTTCAGG + Intronic
910345237 1:86228790-86228812 CAATATTCTTTGGAGTTTTCTGG + Intergenic
911095631 1:94052807-94052829 CTAAAACCCTTGGAATTTCCTGG + Intronic
911259168 1:95666207-95666229 CTAAATCCCTTGGAATTTCCTGG - Intergenic
911349129 1:96730807-96730829 TTATACTCCCTTGAGTGTCCAGG - Intronic
911889192 1:103345250-103345272 CTAAGTTCCTTGGAATTTCCTGG - Intergenic
915947448 1:160163908-160163930 TTAAATGCCTTGGAGTTTCCTGG - Intronic
916925939 1:169521033-169521055 CTGTACTCATTGGTGTTTCCAGG - Intronic
920999277 1:211026352-211026374 CTATACTCCTTGGAGTTTCCAGG - Intronic
922593607 1:226797369-226797391 CAAGACGTCTTGGAGTTTCCAGG + Intergenic
922793513 1:228324076-228324098 CTAAATCCCTTGGAATTTCCTGG + Intronic
923836680 1:237618556-237618578 CTATGCCCATTGGTGTTTCCTGG - Intronic
1063828300 10:9923829-9923851 TTCTGCTCCTTGGAGTTTCCTGG + Intergenic
1064360055 10:14656198-14656220 CTCTACTCCTCAGTGTTTCCTGG - Intronic
1065620693 10:27577957-27577979 CTCTATTCCTCGGAGTTACCAGG - Intergenic
1065746817 10:28849559-28849581 CTACACTCCTTGAAGCTGCCAGG - Intronic
1065925390 10:30430904-30430926 CTAGACTCCTTGCATTTTTCTGG - Intergenic
1066543201 10:36471300-36471322 CTTTCCACCTTGGAGTTTCAGGG - Intergenic
1067780687 10:49204000-49204022 TTATCCTGCTTGGAGTTTTCAGG + Intergenic
1068921748 10:62492388-62492410 CGATACTACTTGGTGATTCCTGG - Intronic
1069090381 10:64193338-64193360 CTACACTCCTGGAACTTTCCAGG - Intergenic
1070310436 10:75269710-75269732 CTATCCACCTTGGAGATTTCTGG + Intergenic
1070495948 10:77022621-77022643 CTATTTACCTTTGAGTTTCCTGG + Intronic
1073928011 10:108539742-108539764 CTCCACTGCTTCGAGTTTCCTGG - Intergenic
1080052076 11:27868420-27868442 CTAAATCCCTTGGAATTTCCTGG - Intergenic
1081905390 11:46666142-46666164 GTAGACTCCTTGAAGTTCCCTGG + Intronic
1082760306 11:57121038-57121060 CTAAATCCCTTGGAATTTCCTGG + Intergenic
1082830553 11:57613859-57613881 CTAGATCCCTTGGAATTTCCTGG - Intronic
1084993826 11:72955656-72955678 CTAAATCCCTTGGAGTTTCCTGG - Intronic
1085214128 11:74812914-74812936 ATATACTCCTTAGAGTTTTGGGG - Intronic
1086378149 11:86222328-86222350 CTAAAACCCTTGGAATTTCCTGG - Intergenic
1087931337 11:103981317-103981339 CCCTAGACCTTGGAGTTTCCTGG + Intronic
1087994863 11:104793017-104793039 CTTAACTTCTTGGAATTTCCCGG + Intergenic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1088609044 11:111559825-111559847 CTAGAGTCCCTGGAGTGTCCAGG - Intronic
1089033474 11:115358798-115358820 TTATACTCCTTAGAGTTCACAGG - Intronic
1092606804 12:10129266-10129288 ATATACTTCTTTAAGTTTCCTGG + Intronic
1095723129 12:45422979-45423001 TTATACTCCTGGGGGTGTCCAGG - Exonic
1098416075 12:70237012-70237034 CTAAGCCCCTTGGAATTTCCTGG + Intergenic
1098610360 12:72449901-72449923 CTTTTCTCCTTCTAGTTTCCTGG + Intronic
1101108790 12:101465768-101465790 CTAAACTTCTTTGAGTTTACAGG + Intergenic
1103005460 12:117416974-117416996 CTTTCCTCCTTGGAGTGTCCTGG + Intronic
1103559290 12:121784209-121784231 CTATACTCTATGCAGTTTTCAGG + Intronic
1105554259 13:21430719-21430741 CTGTATTCATTGGTGTTTCCAGG + Intronic
1106247371 13:27961265-27961287 CTATACCTCTTGCTGTTTCCCGG + Intergenic
1106378512 13:29213037-29213059 CTAAATCCCTTGGAATTTCCTGG - Intronic
1106392511 13:29348257-29348279 CTAAATCCCTTGGAATTTCCTGG - Intronic
1106487948 13:30189263-30189285 CTATAATCCTTGGAATTTCTTGG - Intergenic
1108075475 13:46674926-46674948 TTTTTCTCCTTGGAGTTCCCTGG + Intronic
1109970431 13:69761033-69761055 CAATGCTCCTGGGAGTTGCCAGG + Intronic
1110835979 13:80083516-80083538 CTAAACTCCTTTGAGTTTTAAGG + Intergenic
1120745351 14:88146875-88146897 GTACACTCCATGGAGTTCCCTGG + Intergenic
1121157815 14:91703413-91703435 CTAAACTCCTTGGAATTTCCTGG + Intronic
1121915567 14:97834494-97834516 CTATAGCCCATGGGGTTTCCAGG + Intergenic
1122743215 14:103883522-103883544 CTTTCCTCCTGGGAGTCTCCTGG + Intergenic
1124194006 15:27604639-27604661 CTATGCTCATTGGGGTTTCTGGG + Intergenic
1124871769 15:33550544-33550566 CTATGCTCCTTGCACTTTCCAGG - Intronic
1124945819 15:34264888-34264910 CTATACTCTTTAGAATTTTCTGG - Intronic
1126962954 15:54018444-54018466 CTATAAACATTGGAGTTTTCTGG - Intronic
1129068985 15:72935667-72935689 CTCTTCTCCTTGGATTTTACCGG - Intergenic
1129379671 15:75157053-75157075 CGATCCTCCTGGGGGTTTCCCGG - Intergenic
1129459507 15:75693494-75693516 GTCTCCTCCTTGGAGGTTCCTGG + Intronic
1130272480 15:82459189-82459211 GTCTCCTCCTTGGAGGTTCCTGG - Intergenic
1130416340 15:83697975-83697997 CTAAATTCCTTGGAATTTCCTGG - Intronic
1130464833 15:84186542-84186564 GTCTCCTCCTTGGAGGTTCCTGG - Intergenic
1130487856 15:84408262-84408284 GTCTCCTCCTTGGAGGTTCCTGG + Intergenic
1130499433 15:84486995-84487017 GTCTCCTCCTTGGAGGTTCCTGG + Intergenic
1130587123 15:85191156-85191178 GTCTCCTCCTTGGAGGTTCCTGG - Intergenic
1133251300 16:4483437-4483459 CTAAATCCCTTGGAATTTCCTGG - Intronic
1134188601 16:12104016-12104038 CTATACTCGATTCAGTTTCCTGG + Intronic
1135238695 16:20783175-20783197 CTAAATTCCATGGAATTTCCTGG - Intronic
1135375822 16:21946421-21946443 CAATACTCATTGCAGTCTCCAGG + Intergenic
1137409707 16:48217721-48217743 CTAAACTCCTTCCAGTTTCCAGG + Intronic
1137496796 16:48975796-48975818 GAATATTCCCTGGAGTTTCCAGG + Intergenic
1139143113 16:64292106-64292128 CTAAAATCCTTGGACTTTCAAGG - Intergenic
1139632661 16:68239867-68239889 CTAGACGCCCTGGAGGTTCCAGG - Intergenic
1141494617 16:84399029-84399051 TTATAATCCGTGGAGTTGCCAGG + Intronic
1141827617 16:86492196-86492218 CTTCCCTCCTTGGAGTTCCCGGG + Intergenic
1144405458 17:14948767-14948789 CTAAAACCCTTGGAATTTCCTGG + Intergenic
1144737767 17:17564458-17564480 CTCTCCTGCTTGTAGTTTCCTGG - Intronic
1146287603 17:31584732-31584754 ATATCCTCCTTAGAGTTTCGGGG - Intergenic
1148996794 17:51717250-51717272 CTAAATCCCTTGGAATTTCCTGG + Intronic
1155151557 18:23127404-23127426 CTAAACTCCCTGTAATTTCCTGG + Intergenic
1156695817 18:39765253-39765275 ATAAATTCCTTGGAATTTCCTGG - Intergenic
1158483364 18:57842706-57842728 CTGTCATCCTTGGGGTTTCCTGG + Intergenic
1159204144 18:65228327-65228349 CTGTACTCCTGGTAGTTTCCAGG - Intergenic
1165263972 19:34645348-34645370 CTGTCCTCCCTGGAGTGTCCTGG - Intronic
926160274 2:10482877-10482899 CTAAATCCCTTGGAATTTCCTGG - Intergenic
927223424 2:20737100-20737122 CTCTACTCTTTGGTGTTTCTGGG + Intronic
927384927 2:22521884-22521906 CTAAAGTCCTTGGAATCTCCAGG - Intergenic
927708413 2:25311062-25311084 CCATACTTCCTGGAGTCTCCAGG - Intronic
927765357 2:25802577-25802599 CTATGTCCCTTGGAATTTCCTGG + Intronic
928330879 2:30356954-30356976 CTAAATCCCTTGGAATTTCCTGG - Intergenic
929825574 2:45306958-45306980 CTAAATCCCTTGGAATTTCCTGG - Intergenic
929954588 2:46446635-46446657 CTAAATCCCTTGGAATTTCCTGG + Intronic
930765772 2:55083935-55083957 CTTAATTCCTTGGAGTTTCTTGG + Intronic
931079830 2:58756164-58756186 CTATACTCAAAGGATTTTCCTGG - Intergenic
932438321 2:71716260-71716282 CTACACTCCCTGGAGGTCCCAGG - Intergenic
932881044 2:75502417-75502439 CTATACTCCTTCTACTTCCCAGG + Intronic
935149479 2:100420863-100420885 TTAAATCCCTTGGAGTTTCCTGG + Intergenic
936975058 2:118210669-118210691 CTGTGCCTCTTGGAGTTTCCAGG - Intergenic
938553079 2:132398636-132398658 CTAAAACCCATGGAGTTTCCTGG + Intergenic
939608593 2:144282697-144282719 CTAAATCCCTTGGAATTTCCTGG + Intronic
941698695 2:168580444-168580466 CTAAACACCTTGGATTTTCTAGG - Intronic
942221218 2:173770697-173770719 CTAAATCCCTTGGAATTTCCTGG - Intergenic
942403840 2:175631813-175631835 CTATAATCCTTAGAGGTACCTGG + Intergenic
942701166 2:178712396-178712418 CTGTGCTACTTGGAATTTCCAGG + Exonic
943679114 2:190749176-190749198 CTAAACCCCTTGGAATTTCCTGG - Intergenic
946082180 2:217130526-217130548 CTAAATCCCTTGGAATTTCCTGG - Intergenic
946861578 2:224004536-224004558 CGACAATCCCTGGAGTTTCCTGG + Intronic
946887718 2:224240506-224240528 CTATACATCTTGGACTTTTCAGG - Intergenic
1168902916 20:1380213-1380235 CTATATCCTTGGGAGTTTCCAGG + Intronic
1168958390 20:1850488-1850510 CTAGGCTACTTGGAGCTTCCTGG + Intergenic
1169830074 20:9815373-9815395 GTGTAGTCCTTGGAGTTTCTTGG + Intronic
1170120231 20:12903432-12903454 CTATGTTCCATGGAGTATCCAGG - Intergenic
1171804508 20:29662694-29662716 GTATGCTCCCTGGAGTTTGCAGG - Intergenic
1172597782 20:36162082-36162104 CTATACACCTTGGAGGTGCAGGG + Intronic
1172836760 20:37878115-37878137 CTGCACTCCTGGGGGTTTCCTGG - Intergenic
1173538331 20:43832564-43832586 CTAATCTGCTTGGAGTTTCACGG + Intergenic
1175087281 20:56470548-56470570 CTAAATTCCTTGTAATTTCCTGG + Intronic
1177295303 21:19166137-19166159 CTACATCCCTTGGAATTTCCTGG + Intergenic
1177314319 21:19436717-19436739 TTAAATTCCTTGGAGTTTCCTGG - Intergenic
1181681302 22:24497573-24497595 CTTTACTCCTTGAAGTTTGAAGG + Intronic
951305368 3:21053922-21053944 ATACACTCCTTAGAGTTTCGGGG + Intergenic
954042678 3:47901268-47901290 CTATACTCTTCAGAGATTCCAGG - Intronic
955007860 3:54986611-54986633 CCACACTCCTGGGAGTTTTCAGG - Intronic
957726764 3:84076051-84076073 CTTTACCCATTTGAGTTTCCAGG - Intergenic
960250641 3:115448517-115448539 CCAGACTCCATGGACTTTCCAGG + Intergenic
964903678 3:161692398-161692420 CTAAATCCCTTGGAATTTCCTGG + Intergenic
966732956 3:183165531-183165553 CTAAATCCCTTGGAATTTCCAGG - Intergenic
969381803 4:6804950-6804972 CTCTCCTTCTTGGAGGTTCCGGG + Intronic
974378640 4:61109291-61109313 CTTTACTCCTGGGTGTGTCCTGG + Intergenic
975266229 4:72371067-72371089 CTGTAATCCTTGGTGTTTCTTGG - Intronic
975852372 4:78585398-78585420 CTTTACTCTTTTGAGTTGCCTGG - Intronic
977360504 4:95998574-95998596 ATAAACACCTTGGTGTTTCCTGG - Intergenic
977459972 4:97312715-97312737 CTAAATTTCTTGGAATTTCCTGG - Intronic
978605075 4:110471117-110471139 CTCTATTCCTTGTTGTTTCCAGG - Intronic
981148232 4:141350433-141350455 CTAAATCCCTTGGAATTTCCTGG - Intergenic
983418196 4:167484519-167484541 TTATATTCTTTGGAATTTCCTGG - Intergenic
984584841 4:181551589-181551611 CTATTCTCCATGAAGTTTTCTGG - Intergenic
989126146 5:38054263-38054285 CTATATTCCTTGGGATTTTCTGG + Intergenic
991697650 5:69288187-69288209 CTAAATCCCTTGGAATTTCCTGG + Intronic
992556186 5:77905971-77905993 CTACATCCCTTGGAATTTCCTGG + Intergenic
996923082 5:128791177-128791199 CTGCACTCATTGGTGTTTCCAGG + Intronic
999105987 5:149071705-149071727 CTAAATCCCTTGGAATTTCCTGG + Intergenic
1001723871 5:173880269-173880291 CTTTTCTCCTTGGTGTTCCCTGG - Intergenic
1003507701 6:6753185-6753207 CTAAATCCCTTGGAATTTCCTGG + Intergenic
1004801900 6:19157694-19157716 CTACATTCCTTGGAATTTCCTGG - Intergenic
1007134271 6:39506677-39506699 CTAAATCCCTTGGAATTTCCTGG + Intronic
1007302146 6:40875622-40875644 CTTTTCTCCTTGGGGATTCCTGG + Intergenic
1007958800 6:45940539-45940561 CTATTCTCCTTGGAGCTTCTGGG + Intronic
1008341383 6:50368732-50368754 CTAAATCCCTTGGAATTTCCTGG + Intergenic
1008451870 6:51661062-51661084 CTAAATCCCTTGGAATTTCCTGG - Intronic
1009721714 6:67480424-67480446 ATATACTCCTGGGATTGTCCTGG - Intergenic
1010132974 6:72517113-72517135 CCAGACCCATTGGAGTTTCCAGG + Intergenic
1010589800 6:77699653-77699675 CTCTGCTTTTTGGAGTTTCCAGG + Intronic
1018103819 6:160464847-160464869 CTAAATCCCTTGGAGTTTCCTGG + Intergenic
1018112106 6:160546063-160546085 CTAAATCCCTTGGAGTTTCCTGG + Intronic
1019747215 7:2707668-2707690 GGATTCTCCCTGGAGTTTCCTGG - Intronic
1022369913 7:29760805-29760827 TTACACTCCTAGGAGTTACCTGG - Intergenic
1027878103 7:83797716-83797738 CTTTCCTCCTTGGAGGTTGCAGG + Intergenic
1029582890 7:101449107-101449129 CTATCCTTGTTGGAGGTTCCAGG + Intronic
1029697176 7:102221115-102221137 GTATAGTCATTGGAATTTCCTGG + Intronic
1029791253 7:102845273-102845295 CCTAATTCCTTGGAGTTTCCTGG - Intronic
1030520532 7:110592454-110592476 CTTTTCTCCTTGAAATTTCCAGG - Intergenic
1031397246 7:121287986-121288008 GTATATTCCTTGGATTTTCAGGG + Intronic
1031415285 7:121488805-121488827 CTATATTGCGGGGAGTTTCCTGG + Intergenic
1032157756 7:129483065-129483087 CTTGACTTCCTGGAGTTTCCTGG + Intronic
1032843538 7:135733807-135733829 CTTTTCTCCTTGTAGTTTCCTGG - Exonic
1038996641 8:32930369-32930391 TGATGCTCCTTGGAGTTTCCAGG + Intergenic
1041001447 8:53458877-53458899 CTAAAACCCTTGGAATTTCCAGG + Intergenic
1042279782 8:67043395-67043417 CTAAACTCATTGGAGTTACATGG - Intronic
1042897931 8:73691842-73691864 TTAAATTCCTTGGAATTTCCTGG + Intronic
1043970408 8:86522485-86522507 CTATGCTCCTCAGAGTTCCCAGG - Intronic
1044835287 8:96289391-96289413 CCTAATTCCTTGGAGTTTCCTGG - Intronic
1045939849 8:107727001-107727023 CTAAATCCCTTGGAATTTCCTGG + Intergenic
1048153852 8:131922093-131922115 CTGTAGTCCTTGGAGTTCCTTGG + Intronic
1049504970 8:142991296-142991318 ATCTGCTCTTTGGAGTTTCCTGG - Intergenic
1050444784 9:5708737-5708759 TTATCCTACTTGGAGTTTCTTGG + Intronic
1050876554 9:10645519-10645541 CTTTAGTCCCTGGGGTTTCCAGG - Intergenic
1052750369 9:32483821-32483843 CTATACTCTTTCTAGTCTCCTGG + Intronic
1054961868 9:70978143-70978165 CTAAAACCCTTGGAATTTCCTGG - Intronic
1056950644 9:91038190-91038212 TTCCTCTCCTTGGAGTTTCCAGG - Intergenic
1058116969 9:101095374-101095396 TACTACTCCTTGGAGGTTCCTGG + Intronic
1186837304 X:13450501-13450523 CTAAATCCCTTGGAATTTCCTGG - Intergenic
1187935445 X:24331525-24331547 CTAAATCCCTTGGAATTTCCTGG + Intergenic
1189354013 X:40298078-40298100 CTATCCTCATTGAAGTTTTCTGG - Intergenic
1190162437 X:48042710-48042732 CTAAATCCCTTGGAATTTCCTGG - Intronic
1190384241 X:49868872-49868894 CTATGCTCATTGGTGTTTCCAGG + Intergenic
1191077922 X:56475598-56475620 CTATACTTATTGGTGTTTTCAGG + Intergenic
1193573329 X:83172252-83172274 CTGTGCTCCATGGAGTTGCCAGG + Intergenic
1195742787 X:108082099-108082121 CTAAACCCCTTGGGATTTCCTGG - Intergenic
1199982125 X:152926929-152926951 CTGCAATCCTTGGTGTTTCCTGG + Intronic
1201951833 Y:19573774-19573796 CTAAATCCCTTGGAATTTCCTGG + Intergenic