ID: 920999407

View in Genome Browser
Species Human (GRCh38)
Location 1:211027356-211027378
Sequence AACATTTTGGAGGCCAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2777
Summary {0: 1, 1: 1, 2: 53, 3: 471, 4: 2251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920999403_920999407 7 Left 920999403 1:211027326-211027348 CCAGGCTCAGTGGCTCATGTCTC 0: 3
1: 43
2: 1568
3: 20401
4: 69477
Right 920999407 1:211027356-211027378 AACATTTTGGAGGCCAATGTAGG 0: 1
1: 1
2: 53
3: 471
4: 2251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920999407 Original CRISPR AACATTTTGGAGGCCAATGT AGG Intronic
Too many off-targets to display for this crispr