ID: 921000769

View in Genome Browser
Species Human (GRCh38)
Location 1:211040429-211040451
Sequence ATCTGATGATGGGTTTATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921000764_921000769 24 Left 921000764 1:211040382-211040404 CCATTCTTTCCTGAGCTATTCTC 0: 1
1: 2
2: 128
3: 233
4: 764
Right 921000769 1:211040429-211040451 ATCTGATGATGGGTTTATTAGGG 0: 1
1: 0
2: 1
3: 25
4: 259
921000765_921000769 15 Left 921000765 1:211040391-211040413 CCTGAGCTATTCTCGTGATAGTG 0: 2
1: 129
2: 1065
3: 3979
4: 8707
Right 921000769 1:211040429-211040451 ATCTGATGATGGGTTTATTAGGG 0: 1
1: 0
2: 1
3: 25
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921000769 Original CRISPR ATCTGATGATGGGTTTATTA GGG Intronic
900714744 1:4137059-4137081 ATCTGATGAGGGCCTTCTTAAGG - Intergenic
905757155 1:40520385-40520407 ATATGAAGGGGGGTTTATTAAGG - Intergenic
906872724 1:49502331-49502353 ATATGAAGAGGAGTTTATTAAGG - Intronic
907485773 1:54777153-54777175 TTCTGATTATGGGGTCATTAAGG + Intergenic
908225889 1:62055800-62055822 ATCTGAGAAGGGATTTATTAAGG + Intronic
909939768 1:81597742-81597764 ACCTTTTGATGGGTTTATTGGGG - Intronic
911313882 1:96332039-96332061 ATATGATTATGGGTTTGTTGGGG + Intergenic
911630305 1:100175811-100175833 ATCTTATTATGTTTTTATTAAGG - Intronic
913304945 1:117418851-117418873 AGATGATGATGTGTTAATTAGGG + Intronic
916847848 1:168671410-168671432 AGTTGAGAATGGGTTTATTATGG + Intergenic
918220390 1:182431446-182431468 ATCTGTTGAGGGGATTACTAAGG - Intergenic
918895632 1:190340463-190340485 ATCTCTCCATGGGTTTATTATGG + Intronic
919051413 1:192515620-192515642 ATCTCATGATGGGTTGGTGATGG + Intergenic
920252984 1:204634487-204634509 ATCTGATGATGAGGCTGTTATGG + Intronic
920343859 1:205293278-205293300 AAATGTTGATGTGTTTATTAGGG + Intergenic
921000769 1:211040429-211040451 ATCTGATGATGGGTTTATTAGGG + Intronic
922491747 1:226022940-226022962 ATCTGATGATGGGTATATGAAGG - Intergenic
1064980775 10:21164574-21164596 TTATGATGATGTATTTATTATGG - Intronic
1065142569 10:22733453-22733475 ATCTGATGATGGATTGAATGTGG - Intergenic
1065210852 10:23401656-23401678 ATCTGTGGATGGGGTTATGAAGG + Intergenic
1066050681 10:31632433-31632455 ACCTGGTCGTGGGTTTATTAGGG + Intergenic
1066086867 10:31979662-31979684 TTGTTATGATGGCTTTATTAAGG + Intergenic
1067483939 10:46627761-46627783 AGCTGAAAATGGGTTTATCATGG - Intergenic
1067494414 10:46749013-46749035 TTCTGAAGATGGTTTTAGTAGGG + Intergenic
1067600244 10:47591384-47591406 TTCTGAAGATGGTTTTAGTAGGG - Intergenic
1067610820 10:47713883-47713905 AGCTGAAAATGGGTTTATCATGG + Intergenic
1069202169 10:65633913-65633935 ATCTGATGAAAGCTGTATTAGGG - Intergenic
1070230439 10:74560336-74560358 ATCAGATGATGTGTTTCATATGG + Intronic
1070472701 10:76799823-76799845 ATCTCATGATGGTTTTATTTTGG + Intergenic
1071103276 10:82063565-82063587 AAGGGCTGATGGGTTTATTAAGG - Intronic
1071626233 10:87174117-87174139 AGCTGAAAATGGGTTTATCATGG + Intronic
1071651783 10:87399263-87399285 TTCTGAAGATGGTTTTAGTAGGG - Intergenic
1071944827 10:90632676-90632698 ATATGAAGAGGAGTTTATTAAGG + Intergenic
1072441580 10:95460843-95460865 AGATGATGATGGTTTTATTAGGG - Intronic
1074982544 10:118631386-118631408 CTCTGATGATGGGTGTGTGATGG - Intergenic
1077752851 11:4991670-4991692 ATCTGACAATGTGTTTATTATGG - Intronic
1077756085 11:5029173-5029195 ATCTGGTCCTGGGTTTTTTAGGG - Intergenic
1078433130 11:11302885-11302907 ATCTGATGATGGTCTTCTCAAGG - Intronic
1079778026 11:24558864-24558886 ATCTGATGATGGCTTGATCTTGG + Intronic
1079913664 11:26341611-26341633 ATATGAAAAGGGGTTTATTAAGG + Intronic
1080067550 11:28036429-28036451 AAATGATGATGGTTTCATTAAGG + Exonic
1080359606 11:31497108-31497130 ACCTTATAATGGGTTTATCAGGG + Intronic
1080801723 11:35616633-35616655 ATCTGATAATGAGATTACTATGG - Intergenic
1081324669 11:41729430-41729452 ACCTCCTGATGGTTTTATTAAGG + Intergenic
1085522934 11:77148748-77148770 ATCTTATAATAGATTTATTATGG - Intronic
1086056207 11:82650114-82650136 ATATGAAGAGGAGTTTATTAAGG + Intergenic
1086313878 11:85568538-85568560 ATCTGGTGCTGGGTTTTTTGTGG + Intronic
1087946082 11:104162625-104162647 ATCTGATGATGAGTAGACTATGG - Intronic
1088066170 11:105722227-105722249 ACTTTATGATGGGTTTATCAGGG + Intronic
1092047955 12:5445979-5446001 ATCTGCTGAAGGGTGTATTGAGG + Intronic
1092396339 12:8130309-8130331 ATGTGATGATGATTTTTTTATGG + Intronic
1093521967 12:20061420-20061442 ATCTGATCATGGGCTTTTTTTGG + Intergenic
1094404725 12:30105220-30105242 ATCTGGTGATGGGTGTTATAAGG - Intergenic
1094633206 12:32198290-32198312 ATCTTATGAGGGGATGATTATGG + Intronic
1094770715 12:33655347-33655369 ATCTGCTAATGGGTGTACTATGG + Intergenic
1095563205 12:43589946-43589968 ATGGGATGAGGGATTTATTATGG + Intergenic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1098365799 12:69701830-69701852 ATCTGATGTTATGTTTATAAAGG + Intergenic
1099509227 12:83512751-83512773 ATATGAAGAGGAGTTTATTAAGG - Intergenic
1102793833 12:115671614-115671636 ATGGGATTATGGGTTTATTTGGG - Intergenic
1104651911 12:130540887-130540909 ATTTGATGATGGGTTTCATGTGG + Intronic
1106096916 13:26654485-26654507 TTCTCATGAAGGGTGTATTATGG - Intronic
1107059520 13:36142689-36142711 ATCTTATTATGGCTTTATTCTGG - Intergenic
1107198541 13:37684054-37684076 ATCATATAATGGTTTTATTAAGG - Intronic
1107473294 13:40711327-40711349 ATCTGACGATGTGTGTCTTAGGG + Intergenic
1108705587 13:52982572-52982594 AGGTGATCATGGTTTTATTAGGG - Intergenic
1108945192 13:56014444-56014466 ATCTAATTATGTGTTTTTTATGG - Intergenic
1109145066 13:58769216-58769238 ATCTGATGATATGGTTATTATGG - Intergenic
1109333275 13:60958671-60958693 ATGTGAAGAGGAGTTTATTAAGG - Intergenic
1109611714 13:64773982-64774004 ATCTGGTTCTGGGTTTTTTATGG - Intergenic
1109657617 13:65414536-65414558 ATCTGATTATGGATTTATTTTGG - Intergenic
1110093087 13:71479227-71479249 AGCTGAAGATGGATTTTTTAAGG - Exonic
1111247741 13:85562989-85563011 ATCTGATGATAGGTTGAATGTGG + Intergenic
1111343245 13:86914904-86914926 ATCTCATGATGGTTTTGTAAAGG + Intergenic
1111931620 13:94518528-94518550 ATTTGATGATGGATTCATCAAGG - Intergenic
1112430052 13:99343150-99343172 ATCTGATGATGGGTTTCTGTCGG + Intronic
1112653532 13:101424166-101424188 TTCTGTTGATGGGTATACTAAGG - Intergenic
1115326675 14:32147013-32147035 ATCTGGTGATGGATTTATACAGG - Intronic
1115432505 14:33336247-33336269 ATCTGATTATAGGTTAACTAGGG + Intronic
1117001722 14:51377207-51377229 ATATGAACAGGGGTTTATTAAGG - Intergenic
1118811043 14:69273963-69273985 TTCTGATGATGGCTTTGTTCAGG + Intronic
1119116995 14:72032990-72033012 AACTGATGATGGGTTTTATCAGG - Intronic
1119532832 14:75374962-75374984 ATATGAGGAGGGATTTATTAAGG - Intergenic
1121907846 14:97763836-97763858 AACTGCTGATGGGTCTATGATGG - Intronic
1122670489 14:103367988-103368010 ATCTGATGAGGGTCTTCTTATGG - Intergenic
1123901569 15:24882506-24882528 AATTTATGATGGGTTTATTGGGG - Intronic
1125080451 15:35666705-35666727 ATCTGATGTTGGTTAAATTATGG + Intergenic
1126945957 15:53820417-53820439 ATTTACTGATGGGTTTGTTATGG - Intergenic
1127152492 15:56091842-56091864 ATGTGCTGAAGGGTTTAATAAGG - Exonic
1127206775 15:56728988-56729010 AACTAATGACGGGTTTATCAAGG + Intronic
1127507078 15:59607874-59607896 TTCTGTTGAGGGGTTTACTAGGG + Intronic
1127922914 15:63507169-63507191 ATCTGATTATGTTCTTATTAAGG + Intronic
1129783899 15:78294991-78295013 ATCTGACCATGGGTTTAATGTGG - Intronic
1130539223 15:84810019-84810041 ATCTAATGATTGCTTTATTTTGG + Intergenic
1130941179 15:88510649-88510671 ATCTGATGACGGGTTTACCTGGG - Intergenic
1135714768 16:24753264-24753286 TTCTGATGATGGTTCTAGTAAGG - Intronic
1135934057 16:26764288-26764310 ATATGAAGAGGAGTTTATTAAGG + Intergenic
1137909812 16:52365725-52365747 AACTTATAATGGGTTTATCAGGG - Intergenic
1138946141 16:61852483-61852505 ATCTGAGCAAGAGTTTATTATGG + Intronic
1140955074 16:79856032-79856054 ATCTGATGATGTGTGTCTTGGGG + Intergenic
1141366316 16:83446783-83446805 ATTCCATGATGGCTTTATTAAGG + Intronic
1146029320 17:29351250-29351272 CTTTGCTGATGGATTTATTAGGG - Intergenic
1146360005 17:32166691-32166713 AACAGATGAAGAGTTTATTATGG - Intronic
1148519232 17:48253811-48253833 TTCTGATGAGGGGTTTGCTATGG - Intronic
1149007063 17:51817167-51817189 AACAGATGAAGGGTTTTTTATGG + Intronic
1151356696 17:73562884-73562906 ATTTGATGATGGGTAAATTGAGG + Intronic
1151436525 17:74100924-74100946 AACTGAGGATGGGTTTAGTGAGG - Intergenic
1152292900 17:79450553-79450575 ATATTATGATGGGCTTATCAGGG + Intronic
1153081647 18:1233361-1233383 ATCTGGTCATGGGCTTATTTTGG + Intergenic
1153370716 18:4312428-4312450 ATTTTATGATGAGTTTATCAGGG + Intronic
1154957171 18:21270278-21270300 ATGGGCTGATGGGTTTTTTAGGG + Intronic
1156240025 18:35244326-35244348 ATCTGATGATGTGTTTAGGTTGG + Intronic
1156527313 18:37778912-37778934 AAATGATGATGGGGTTGTTAGGG - Intergenic
1157781777 18:50445939-50445961 ATCTCATGGTGGGTTTACTGAGG - Intergenic
1158353271 18:56587273-56587295 ATTTGATGATGGGCTTATGGGGG + Intergenic
1159449122 18:68577074-68577096 AGGTGATGATGGACTTATTAGGG + Intergenic
1161185773 19:2919193-2919215 ATCTGTAGATGGTTTTGTTACGG + Intergenic
1164894161 19:31855468-31855490 ACTTTATGATGGGTTTATCAGGG + Intergenic
1165602634 19:37069446-37069468 AACTTGTGATGGGTTTATTAGGG - Intronic
1166631847 19:44413605-44413627 ACTTTATGATGGGTTTATTGGGG - Intergenic
925507110 2:4579484-4579506 ATCTGATGAGGGTAGTATTATGG + Intergenic
927797758 2:26066138-26066160 ATGTGATGATGGTTTTTCTATGG + Intronic
928299533 2:30113098-30113120 ATATGAGGAAGAGTTTATTAAGG - Intergenic
928475018 2:31617004-31617026 ATCGGATGATGGTTTTATAAGGG + Intergenic
929065197 2:37965972-37965994 ATCTGCTGATGATTTTATTGAGG + Intronic
930118749 2:47742512-47742534 TTCTGTTGAGGGGATTATTAGGG - Intronic
930451692 2:51547123-51547145 ATCTGAGGTTGGGTTTGTTTCGG - Intergenic
930549741 2:52818022-52818044 GTCTAATGATGAGTTTATTTTGG - Intergenic
930744051 2:54862792-54862814 ATCTGCTGATGGTTTTATAGAGG - Intronic
932412952 2:71558162-71558184 ACCTGATGATGGGGTGAATATGG + Intronic
932970174 2:76531583-76531605 ATATGAAGAAGAGTTTATTAAGG - Intergenic
939254700 2:139727977-139727999 GTCTCATAATGTGTTTATTAGGG + Intergenic
939365049 2:141219911-141219933 AGCTGCTGATGGGGTTTTTATGG - Intronic
939459104 2:142476309-142476331 ACCTTATGAGGGGTTTATTATGG + Intergenic
939805824 2:146775139-146775161 ATATGAAGAGGAGTTTATTAAGG - Intergenic
939806587 2:146781290-146781312 ATATGAAGAGGAGTTTATTAAGG - Intergenic
940986887 2:160059822-160059844 AACCTCTGATGGGTTTATTAAGG - Intronic
941036372 2:160573228-160573250 ATATGAAGAGGAGTTTATTAAGG - Intergenic
941970851 2:171349559-171349581 ATCTGATGATGGGCATTTTAGGG + Intronic
942719593 2:178936244-178936266 AACTCAAGATGGGTTGATTAAGG - Intronic
942893712 2:181023135-181023157 ATGTTAGGATGGGTTTATTGGGG - Intronic
943006138 2:182390110-182390132 ATATGATGAGGAGTTTATTAAGG - Intronic
943668235 2:190632872-190632894 ATCTGTGGATGGGATTATGAAGG - Intergenic
945409510 2:209491815-209491837 ATCTGATCCTGGGTTTTTTTTGG - Intronic
945487923 2:210420486-210420508 ATCTGCTGATAGTTTTATGAAGG + Intergenic
947007048 2:225524068-225524090 ATATGATGGGGAGTTTATTAAGG + Intronic
947839215 2:233196961-233196983 ATTTGCTGATGGGATTATCATGG - Intronic
947884845 2:233560176-233560198 ATCAGTTGAGTGGTTTATTAAGG - Intronic
948297324 2:236871348-236871370 ATCTGGAGATGGTTTTATAATGG + Intergenic
948744538 2:240078322-240078344 ATCTTATGTTGGCTTTGTTAAGG - Intergenic
1168961094 20:1870521-1870543 ATCTGATGACCGATTTATTCAGG - Intergenic
1169758236 20:9065955-9065977 ATCTAATAATATGTTTATTAAGG - Intergenic
1170160480 20:13305095-13305117 ATCTGAAGATGGTTTTGCTATGG + Intergenic
1170659523 20:18323311-18323333 ATCTGAAAATGGCTTTATTAAGG + Intergenic
1173259505 20:41421112-41421134 ATCTGATGACAGGTTTCTTTTGG + Exonic
1178011448 21:28291152-28291174 ATATGAAGAGGAGTTTATTAGGG + Intergenic
949261923 3:2112860-2112882 ATCTGATTATGGCCTTGTTATGG + Intronic
949412028 3:3776317-3776339 ATGAGATGTTGGGTTTATTAGGG + Intronic
949531056 3:4955660-4955682 ATATGGTGATGGCTTAATTAAGG - Intergenic
949599148 3:5579592-5579614 ATATGAAGAGGGATTTATTAGGG - Intergenic
949690107 3:6627015-6627037 ACTTTATGATGGGTTTATCAGGG - Intergenic
950318497 3:12027099-12027121 CTCTGATGATGAGTTTAGAATGG - Intronic
950995485 3:17491972-17491994 AACTTATTATGGGTTTATTAAGG + Intronic
951284514 3:20792684-20792706 ATATTATCATGTGTTTATTATGG + Intergenic
952251089 3:31655361-31655383 ATCTGATGATAATTTTATTAAGG - Intergenic
952480582 3:33757012-33757034 ATCTGAAGAAGGGTTTACAAAGG + Intergenic
952500329 3:33955820-33955842 ATTAGATGATGGGGTTATTGGGG + Intergenic
952861156 3:37813261-37813283 ACTTTATGATGGGTTTATTGGGG - Intronic
953016458 3:39081575-39081597 TTCTGCTGATGAGTTTCTTAGGG - Intronic
953291392 3:41667405-41667427 ATCAAATGATAGGTTTATAATGG + Intronic
953583046 3:44174077-44174099 AGCAGATGATAGTTTTATTAGGG - Intergenic
953859764 3:46533455-46533477 AACTTATGATGGGCTTATTGAGG - Intronic
954996830 3:54889460-54889482 ACTTGATGATGGGTTTGTTGTGG + Intronic
955811780 3:62798560-62798582 ATCTGAAGGGGAGTTTATTAAGG - Intronic
956925883 3:73987949-73987971 ATATGATGATGGATTTAAAAAGG - Intergenic
957761745 3:84567905-84567927 ATATGAAAAGGGGTTTATTAAGG + Intergenic
958262494 3:91397898-91397920 ATCTGATGATGGTTTTGTAGGGG + Intergenic
959126112 3:102291957-102291979 ATCTCATCATGTTTTTATTATGG + Intronic
960094515 3:113676467-113676489 ATGAGATGATGGTTTTATAAGGG - Intronic
961663241 3:128481445-128481467 ATCTGGTGATGGGACTATGAAGG - Intronic
962264874 3:133937682-133937704 AACTGAGGATGTGTTAATTAAGG - Intronic
963025907 3:140918379-140918401 GTTTGATGGTGAGTTTATTATGG + Intergenic
963197881 3:142553827-142553849 CTCTGAAGATGGATTTATAAAGG - Exonic
963369414 3:144379353-144379375 ATATGAAGAGGAGTTTATTAAGG + Intergenic
964175490 3:153822802-153822824 ATATGAAGATGAGTTTATTAAGG + Intergenic
964392589 3:156213093-156213115 ATCTGGTGATGGGCTGAGTATGG + Intronic
964910921 3:161778501-161778523 TTCAGATGATGGGTTTCCTAGGG + Intergenic
966324089 3:178734953-178734975 ATCTGATAATGGGCTAATTGTGG - Intronic
967404960 3:189105118-189105140 CTCTGATGTTGGTGTTATTAAGG + Intronic
967466333 3:189810415-189810437 ATGAGATGATGGGCATATTAGGG + Intronic
970344829 4:15143420-15143442 ATGTGAGGATGGGTTGATGAGGG - Intergenic
973173458 4:47174632-47174654 ACTTGATGATAGGTTTATTGGGG + Intronic
974010979 4:56607002-56607024 ATTTGATGATGGGTTATATATGG + Intergenic
974294214 4:59974450-59974472 ATCTGTTGATGATTTTATTGTGG + Intergenic
975471251 4:74771076-74771098 AGCTGATGGTGGGTATATCAAGG + Intronic
975510257 4:75186706-75186728 ATCTTTTGATTTGTTTATTATGG - Intergenic
976723309 4:88191702-88191724 ATCAGTTGATGGGTATATTCAGG - Intronic
977448618 4:97164699-97164721 ATATAATGAGGAGTTTATTAAGG + Intergenic
977919189 4:102624943-102624965 ACTTTATGATGGGTTTATCAAGG - Intergenic
977971837 4:103222035-103222057 ATCTGGTCCTGGGTTTTTTATGG - Intergenic
978998799 4:115190875-115190897 ATTTGATGAGGTGTCTATTAAGG + Intergenic
983415214 4:167443585-167443607 ATATGAAGGAGGGTTTATTAAGG - Intergenic
983740461 4:171125045-171125067 AACTTATGATGGGTTTATCGGGG + Intergenic
984125854 4:175809319-175809341 AGATGATGCTAGGTTTATTATGG + Intronic
987721482 5:21638877-21638899 TTCTCATGATGGGTTTATCAGGG - Intergenic
989011012 5:36873015-36873037 AACTGATGAAGGGTTAATTAAGG - Intergenic
989757341 5:44971287-44971309 ATATGAAGAGGAGTTTATTAAGG - Intergenic
990166153 5:52995474-52995496 ATTTGATGATTGATTTACTATGG + Intronic
992853069 5:80831040-80831062 GACTTATGATGGGTTTATCAGGG - Intronic
993835890 5:92819527-92819549 TTCTGAGGATGTGTTTGTTAGGG - Intergenic
994269433 5:97759760-97759782 ATATGAAAATGAGTTTATTAAGG + Intergenic
994696920 5:103083861-103083883 ATCTGGTGATAGTTTTATGAAGG + Intergenic
995281175 5:110337411-110337433 ATTCCTTGATGGGTTTATTAAGG - Intronic
995363238 5:111323296-111323318 ACTTTATGATGGGTTTATCAGGG + Intronic
995704756 5:114976676-114976698 ACTTTATGATGAGTTTATTAGGG - Intergenic
995871265 5:116745831-116745853 ATCTGGTGATGGGGATTTTATGG + Intergenic
1004186189 6:13423248-13423270 ATGTTAAGATGGGTTTATTGGGG + Intronic
1006013720 6:31063889-31063911 ATCTGAGTATGAGTATATTATGG - Intergenic
1007266513 6:40600310-40600332 ATGTGAGGATGGGTTTGTGAGGG - Intergenic
1008465466 6:51825461-51825483 CTCTCCTCATGGGTTTATTATGG - Intronic
1008696344 6:54042778-54042800 AACTGATGTTAGCTTTATTAAGG - Intronic
1008992924 6:57624979-57625001 ATCTGATGATGGTTTTGTAGGGG - Intronic
1009181539 6:60524084-60524106 ATCTGATGATGGTTTTGTAGGGG - Intergenic
1009698950 6:67149431-67149453 ACTTTATGATGGGTTTATCAAGG + Intergenic
1010676233 6:78747278-78747300 ACCTTATGATACGTTTATTAAGG + Intergenic
1011719331 6:90139123-90139145 ATCTGGTGATGGATTCATAAAGG - Intronic
1013379562 6:109554317-109554339 ATCTGATCCTGGGCTTTTTATGG + Intronic
1014281897 6:119450749-119450771 ATCAGATGTTTGGTTTAATATGG + Intergenic
1015359748 6:132325540-132325562 ATCTGATGAGGGCCTTCTTACGG - Intronic
1016285985 6:142473859-142473881 ATCTGCTGATGGGTTATATAAGG + Intergenic
1019410149 7:903247-903269 ATCTGACCCTGGGTTTGTTAGGG - Intronic
1020535681 7:9393837-9393859 ATCTGATGTTGTGATTACTATGG + Intergenic
1022578758 7:31526293-31526315 AACTTATGATGGGTTTATTGGGG + Intronic
1026335633 7:69392227-69392249 AACTTATGATGGGTGTATTGGGG - Intergenic
1027728699 7:81841496-81841518 ATCTGATGGTGGTTTCATAAGGG + Intergenic
1031206655 7:118767523-118767545 TTCTCATGATGGTTTTATAAGGG - Intergenic
1031239587 7:119220122-119220144 ATATGAAGAAGAGTTTATTAAGG + Intergenic
1031690365 7:124780888-124780910 ATATGAAGAGGAGTTTATTAAGG + Intronic
1032502641 7:132411397-132411419 AGCTGATGAAGGGTATGTTACGG + Intronic
1034042621 7:147895359-147895381 TTATGGTGAAGGGTTTATTATGG - Intronic
1036438353 8:8757270-8757292 ATCTGATGAATGGTTTATCCAGG - Intergenic
1037776912 8:21841556-21841578 ATCTGATGATGAGATTCCTAGGG - Intergenic
1038130865 8:24729882-24729904 ACCTGATAATGTGTTTATTGAGG + Intergenic
1038255479 8:25947249-25947271 ATCTCATGATGGTTTTGTAAAGG + Intronic
1039763457 8:40602706-40602728 TTTTGATGATGGGATTATTTGGG + Intronic
1039952605 8:42183586-42183608 ATCTGATGATGGGCTTGGGAAGG + Intronic
1040775716 8:51040977-51040999 ATTTTATGATGGGTATATTTGGG - Intergenic
1040831120 8:51678410-51678432 ATCTGATAATGATTTTATTGCGG + Intronic
1041814779 8:61957911-61957933 CTCTGATAATGCGTTTATTTTGG - Intergenic
1042239278 8:66646383-66646405 ACTTTATGATGGGTTTATCAGGG - Intronic
1042827561 8:72993952-72993974 ATATGAAGGGGGGTTTATTAAGG - Intergenic
1044574611 8:93754640-93754662 AACTTACGATGGGTTTATTGCGG + Intergenic
1044838862 8:96321130-96321152 AACCGATGATGGGTTCATGAGGG - Intronic
1045518588 8:102883097-102883119 ACTTTATGATGGGCTTATTAGGG + Intronic
1045989714 8:108291612-108291634 CTCTGATGATGTGTCTGTTAAGG + Intronic
1046243051 8:111524306-111524328 ATCTTATGATGAGTTTATCCAGG - Intergenic
1047245431 8:123139254-123139276 ATTTTATGATGGGTCTATCAGGG - Intronic
1047578442 8:126184673-126184695 ATTTGCTGATTTGTTTATTAAGG + Intergenic
1048634218 8:136278473-136278495 ATGTGGTGATGGGGTTAGTAAGG + Intergenic
1051280646 9:15439923-15439945 ACTTTATGATGGGTTTATTGGGG + Intronic
1051967257 9:22844354-22844376 GTCTCATGATGGTTTTATAAAGG - Intergenic
1052176649 9:25471557-25471579 ACCTTATGATGGGTTTTTTGTGG + Intergenic
1052561221 9:30087171-30087193 ATATGAAGATGAGTTTATTAAGG + Intergenic
1054710183 9:68503233-68503255 AACTTATGATGGGTTTATTGGGG - Intronic
1054958557 9:70941534-70941556 ATATGAAGAGGGGTTTATTAAGG - Intronic
1055533916 9:77216697-77216719 ATTTAAAGATGAGTTTATTAAGG + Intronic
1057263435 9:93598838-93598860 ATGTGGTGATGGGCTTCTTAGGG - Intronic
1057694855 9:97315953-97315975 ACTTTATGATGGGTTTATGAAGG - Intronic
1057866425 9:98685410-98685432 ATATGAAGGGGGGTTTATTAAGG - Intronic
1060472249 9:123957773-123957795 TTCTGATGATTGCTTTATGAAGG + Intergenic
1062485738 9:136774481-136774503 ACCTGAGGCTGGGTTAATTAGGG - Intergenic
1186072765 X:5840582-5840604 ATCTGATCAAGCGTTTATTAAGG + Intergenic
1188280274 X:28259598-28259620 ATCTCATCATGGGTTTGTAAGGG - Intergenic
1188839313 X:34995780-34995802 CTCTGATGAGGTGTTTGTTAAGG + Intergenic
1192288499 X:69764705-69764727 ATCTGATAAAGGTTTTATTTGGG - Intronic
1193043331 X:77026399-77026421 AGATGATGATGGCTTTTTTAGGG + Intergenic
1193979224 X:88160243-88160265 ATATGAAGAGGAGTTTATTAAGG - Intergenic
1194174283 X:90627954-90627976 ATTTTATGATGGGTTTATCAGGG + Intergenic
1194495993 X:94617130-94617152 ACCTGATGATTGGTTCATGAGGG - Intergenic
1197400973 X:125990641-125990663 ATTTGATGATGGATTAAGTACGG - Intergenic
1197481722 X:126995014-126995036 ATATGAAGAGGAGTTTATTAAGG - Intergenic
1197781766 X:130166858-130166880 ACTTTATGATGGGTTTATCAGGG + Intergenic
1199001167 X:142638304-142638326 ATATGATGAATGTTTTATTATGG + Intergenic
1199302313 X:146227513-146227535 AACTGCTGATGGATTTATTTTGG + Intergenic
1199504887 X:148550681-148550703 AACTTATGATGGGTTTATCGAGG + Intronic
1200520501 Y:4205647-4205669 ATTTTATGATGGGTTTATCAGGG + Intergenic