ID: 921001329

View in Genome Browser
Species Human (GRCh38)
Location 1:211046693-211046715
Sequence GAGGTACTCAGCCTGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921001329_921001332 19 Left 921001329 1:211046693-211046715 CCAGGTTCCAGGCTGAGTACCTC 0: 1
1: 0
2: 0
3: 13
4: 150
Right 921001332 1:211046735-211046757 ATCCTTATAACAACCATGCAAGG 0: 1
1: 0
2: 12
3: 91
4: 563
921001329_921001334 29 Left 921001329 1:211046693-211046715 CCAGGTTCCAGGCTGAGTACCTC 0: 1
1: 0
2: 0
3: 13
4: 150
Right 921001334 1:211046745-211046767 CAACCATGCAAGGTAAATATTGG 0: 1
1: 0
2: 2
3: 12
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921001329 Original CRISPR GAGGTACTCAGCCTGGAACC TGG (reversed) Intronic
900644055 1:3700995-3701017 GAGGAAGGCAGCCTGGACCCTGG + Intronic
902193517 1:14780699-14780721 GAAGTGCTCAGCATGGCACCTGG + Intronic
902313063 1:15596793-15596815 AAGGGACTAAGCCTGTAACCTGG + Intergenic
902793535 1:18785194-18785216 GAGGAGCTGAGCCTGGAGCCTGG - Intergenic
902899816 1:19507239-19507261 GAATTACTCAGCCCAGAACCTGG + Intergenic
904563468 1:31413595-31413617 GAGAGACTAAGCCTGGAGCCCGG + Intronic
905303358 1:37000549-37000571 AAAGTACTCAGCCTGGTGCCTGG - Intronic
905796474 1:40819089-40819111 GGAGTCCTGAGCCTGGAACCTGG + Intronic
905977006 1:42183160-42183182 CAGCTACTCAGACTTGAACCTGG + Intronic
906297522 1:44658308-44658330 GAGGTGCCCAGCCAGAAACCTGG + Intronic
907098142 1:51800768-51800790 CAGGTACCCAGCATGGAACTAGG + Intronic
913686646 1:121238403-121238425 CAGGTACTCAGCATAGTACCAGG - Intronic
914038499 1:144026043-144026065 CAGGTACTCAGCATAGTACCAGG - Intergenic
914150956 1:145041865-145041887 CAGGTACTCAGCATAGTACCAGG + Intronic
919241219 1:194919027-194919049 GAGGTACTGTGGCTGTAACCAGG - Intergenic
919419727 1:197355447-197355469 GTGGTGCTCATCCTGGAAGCTGG + Intronic
920055254 1:203186446-203186468 GAGGGACTGAGGCTGCAACCAGG - Intronic
920473970 1:206256961-206256983 CAGGTACTCAGCATAGTACCAGG - Intronic
921001329 1:211046693-211046715 GAGGTACTCAGCCTGGAACCTGG - Intronic
922532656 1:226356325-226356347 GTGGTACTCACCCAGGGACCAGG - Intergenic
922638755 1:227205141-227205163 GAGGTACTCAGCCAGCTACTTGG + Intronic
922792559 1:228318193-228318215 GAGCTCCCCACCCTGGAACCTGG - Intronic
922979636 1:229814652-229814674 GAGGTGCTGAGGGTGGAACCAGG - Intergenic
923517858 1:234712702-234712724 TAGGTCCTCATCCTTGAACCAGG + Intergenic
1062782019 10:221345-221367 TAGGTACTCACCCTGCAAACTGG - Exonic
1062921953 10:1286838-1286860 GAGGTGCTTAGCCTGGTACCCGG + Intronic
1063688847 10:8264344-8264366 GAAATACTCAGCTTTGAACCTGG + Intergenic
1064561889 10:16601668-16601690 GGGGTACCTAGCCTGGCACCTGG + Intronic
1065503843 10:26409481-26409503 CAGCTGCTCAGCCTGGTACCAGG + Intergenic
1067808276 10:49408118-49408140 GAGGTACACAGCCTGGAGAGAGG + Intergenic
1073084517 10:100879610-100879632 GGGGTTCCCAACCTGGAACCAGG + Intergenic
1074962173 10:118456579-118456601 GAGGCCCCCAGCCTGGTACCTGG - Intergenic
1075545500 10:123351720-123351742 CAGGAACTGGGCCTGGAACCAGG + Intergenic
1076888534 10:133273347-133273369 CAGGTGCTCAGCCTGGTACACGG + Exonic
1077073208 11:687235-687257 GAGGTGCTCAGTGTGGGACCTGG - Intronic
1077326010 11:1964427-1964449 CAGCTTCTCAGCCTGGAGCCAGG + Intronic
1077817079 11:5696414-5696436 GAGGTTCCCAGGCTGGAATCTGG - Exonic
1079125254 11:17714298-17714320 GAGGCACTCAGGTTGGACCCAGG + Intergenic
1079954777 11:26849292-26849314 GAGGCAGTCAGCCTGCTACCTGG - Intergenic
1080602867 11:33837421-33837443 CAGGCCCTCAGCCTTGAACCCGG + Intergenic
1083426951 11:62593057-62593079 GAGATAGGCAGCCTGGACCCAGG - Intergenic
1083670391 11:64296937-64296959 CAGCCACTCAGCCTGGGACCTGG + Exonic
1084376160 11:68779142-68779164 GAGGTGCTCAGCCTGCAGCTGGG + Intronic
1084538578 11:69773531-69773553 AAGGTACCCAGCCTGAAGCCAGG + Intronic
1084614324 11:70225803-70225825 CCTGTACACAGCCTGGAACCAGG + Intergenic
1089384904 11:118060982-118061004 GAGTTCCTCAACCTGCAACCAGG - Intergenic
1089526773 11:119102125-119102147 GAGGCATTCATCTTGGAACCGGG - Exonic
1090395334 11:126414835-126414857 CAGGCACCCAGCCTGGCACCCGG + Intronic
1090936572 11:131348364-131348386 GAGCTTCTCCTCCTGGAACCAGG + Intergenic
1202808990 11_KI270721v1_random:19606-19628 CAGCTTCTCAGCCTGGAGCCAGG + Intergenic
1091472089 12:737789-737811 CAGGTAAACAGCGTGGAACCAGG - Intergenic
1094008339 12:25780039-25780061 TAGGTACTGAGCCAGGAACTAGG - Intergenic
1096411320 12:51379003-51379025 AAGGAACTCAGCCTGGCACCAGG - Intronic
1096555806 12:52402987-52403009 GGGGCACTCAGCCCGGGACCTGG + Intronic
1099220014 12:79902652-79902674 GAGGTAAACAGCATGGAAACAGG - Intronic
1102655724 12:114480887-114480909 GAGGTGCTCTCGCTGGAACCCGG - Intergenic
1108532196 13:51337933-51337955 TGTGTACTCAGCCTTGAACCTGG - Intronic
1110914367 13:81002952-81002974 CAGGTTCTCACCCTGGCACCAGG - Intergenic
1113612226 13:111655227-111655249 GAGGTACTCAGCATGGTGCCTGG - Intronic
1117528125 14:56632020-56632042 CAGGTACCCAGTCTGGAACCTGG + Intronic
1121438479 14:93934100-93934122 GAGGTCCTCAGCCTTGCTCCTGG - Intergenic
1121787758 14:96675305-96675327 GTGGTTCTCAACCAGGAACCAGG - Intergenic
1123459466 15:20456163-20456185 CAGGAACTCAGCCTGGGCCCAGG - Intergenic
1123658595 15:22544258-22544280 CAGGAACTCAGCCTGGGCCCAGG + Intergenic
1124265696 15:28231989-28232011 CAGGAACTCAGCCTGGGCCCAGG - Intronic
1124312460 15:28638751-28638773 CAGGAACTCAGCCTGGGCCCAGG + Intergenic
1125761274 15:42097214-42097236 GAGGCAGTCAGCCTGGAACAGGG + Intergenic
1125874785 15:43134061-43134083 GAGGTCCCCAGCCTGGAGCGTGG - Intronic
1128880514 15:71237976-71237998 GATGAACTGGGCCTGGAACCTGG + Intronic
1130059540 15:80559631-80559653 GAGGGAGCCAGCCAGGAACCGGG + Intronic
1132121378 15:99179002-99179024 GAGATACACAGCCTGGACCAGGG - Intronic
1133377954 16:5305166-5305188 GTGGTACTCAGCTTGGTCCCAGG - Intergenic
1134560524 16:15205420-15205442 AAAGTACTCAGCCCGGAACTTGG - Intergenic
1134669097 16:16041463-16041485 GAGATCCTCAGCGTGGAGCCAGG + Intronic
1134841160 16:17403053-17403075 GAGGTCCTCACTCTGGAAGCTGG - Intronic
1134921062 16:18117035-18117057 AAAGTACTCAGCCCGGAACTTGG - Intergenic
1140637732 16:76936058-76936080 CAGGTATGCAGCCTGGAAACAGG - Intergenic
1141623355 16:85248807-85248829 CAGGACCTCAGCCTGGACCCTGG - Intergenic
1142973519 17:3629277-3629299 GATGTCCTCAGCCAGGCACCAGG + Intronic
1143846851 17:9778749-9778771 GAGGTACCCAGCATGGGAGCTGG + Intronic
1150224613 17:63517211-63517233 GAAGTCCTAAGCCTGGAATCAGG - Intronic
1151202022 17:72475692-72475714 CAGGTACCCAGCCTGGATCCAGG + Intergenic
1151697238 17:75723871-75723893 GAGATGCTCAGCCTGAAGCCTGG - Intronic
1152387728 17:79985139-79985161 GAGGTGCTCGTCCTGGATCCTGG + Intronic
1156898425 18:42273094-42273116 CAGGAACCCAGCCTGCAACCAGG + Intergenic
1156960103 18:43017652-43017674 GAAGTGCTTAGCCTAGAACCTGG - Intronic
1160181176 18:76638073-76638095 GACGTCCTCAGCATGGAACCAGG + Intergenic
1160450878 18:78965324-78965346 GAGGAGCTGAGCCTGGAGCCAGG - Intergenic
1160523758 18:79523705-79523727 GAGGCTCTCAGCCTGCAGCCAGG + Intronic
1160956024 19:1692058-1692080 GAGGTCCCCAGCCTGGCGCCCGG + Intergenic
1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG + Intronic
1164418902 19:28070230-28070252 GAGGAAACCAGCCTGGCACCTGG + Intergenic
1165872295 19:38981408-38981430 GAAGCACTCAGCCGGGAGCCTGG + Intergenic
1166003167 19:39890202-39890224 GGGGGACTCAGCGTGGGACCTGG + Intronic
1167505197 19:49867521-49867543 GAGGTGCCCCGCCTGCAACCCGG + Exonic
1168155247 19:54470634-54470656 GAGGCACTCAGGCTGGTGCCTGG - Intronic
926268864 2:11349858-11349880 GAAATCCTCAGCCTGGAATCTGG + Intergenic
929556909 2:42931357-42931379 GAGGGTCTCTGCCTGGAACAGGG + Intergenic
930295067 2:49544393-49544415 GGGGTGCTCAGCCAGGTACCTGG - Intergenic
930788193 2:55293679-55293701 TAAGGACTCAGCCTGGCACCTGG - Intronic
932212974 2:69947255-69947277 GAGATAATCAGGATGGAACCTGG + Intergenic
932542729 2:72673270-72673292 GAATTACTGAGGCTGGAACCTGG - Intronic
932691757 2:73919452-73919474 GAAGTACTCAGTCTGGATCGGGG + Exonic
933888539 2:86743094-86743116 GAGATGCTCAGCCAGGCACCAGG - Intronic
937220703 2:120341740-120341762 GACGGCCTCAGCCTGGAGCCAGG - Intergenic
948395520 2:237642455-237642477 GAAACCCTCAGCCTGGAACCTGG - Intronic
948720693 2:239898325-239898347 GAGGTGCTCAGCCTGCGCCCGGG + Intronic
948783767 2:240340456-240340478 GTGGCATACAGCCTGGAACCAGG + Intergenic
948960815 2:241335027-241335049 GAGGTACTTAGCCCAGTACCAGG + Intronic
1171188447 20:23140963-23140985 GAGGTATTCAGCTTATAACCAGG + Intergenic
1173143580 20:40506029-40506051 GATGTGCTCAGGCTGGTACCTGG + Intergenic
1175141586 20:56864792-56864814 GGGGTCCTCAGCCTGGTACCTGG + Intergenic
1175370313 20:58483849-58483871 CAGCTCCTCAGCCTGGAACATGG + Intronic
1175874218 20:62221793-62221815 GAGGGACTCTGCCTGGACCAGGG + Intergenic
1178755567 21:35346010-35346032 GAGGTACCCAGACTCAAACCAGG - Intronic
1181851456 22:25752832-25752854 GAGGGACGCAGGCGGGAACCGGG + Intronic
1182444434 22:30381886-30381908 AAGGCACTCAGCCTGGAGCTTGG - Intronic
1183418017 22:37693761-37693783 GAGGTTCCCAGCCTGGAGCTGGG + Intronic
1183549656 22:38474438-38474460 GAGGTGCACAGCCTGGAGCTGGG - Intronic
1184180545 22:42821111-42821133 GAGGTTCTGAGCCTGGATCTTGG - Intronic
1184370558 22:44079311-44079333 CAGGTTCTCAGGCTGGAGCCCGG - Intronic
1184399004 22:44262740-44262762 GAGGAGCTGAGCCTGGAACCAGG + Intronic
949836206 3:8273025-8273047 AATGTACTCAGCATGGCACCTGG - Intergenic
950954600 3:17038318-17038340 GAGTTACTCAGGCTGGCAGCAGG + Intronic
952275557 3:31872326-31872348 GTGGTGCTAAGACTGGAACCTGG - Intronic
957679737 3:83418350-83418372 GAGGTTCTCACAGTGGAACCTGG - Intergenic
958432910 3:94063145-94063167 GAGGTACCCAGCCGGGCCCCAGG - Exonic
961003099 3:123387086-123387108 TAGGGACGCAGCCTTGAACCCGG - Intronic
962446795 3:135473162-135473184 CAGGTACTCAGCCAGGCTCCAGG + Intergenic
965528441 3:169746550-169746572 GAGGGACACAGCCAGGATCCAGG + Intergenic
968912375 4:3482872-3482894 AAGGTGCTCAGCCTGGCAGCCGG + Intronic
968956620 4:3722752-3722774 GGGGTGCTGAGCCTGGAACCAGG - Intergenic
971857846 4:32065073-32065095 GAGCTACTGTGCCTGGAAACAGG + Intergenic
972737887 4:41863647-41863669 TGGGTACTCAGCATGGGACCCGG - Intergenic
980347308 4:131637104-131637126 GAGCTACACAACCTGGAACTAGG - Intergenic
980774992 4:137425973-137425995 CAGCTACTCAGCCTGTTACCAGG - Intergenic
986637519 5:9837559-9837581 CAGGTCCTGAGCCTGGAAACAGG - Intergenic
988923216 5:35963344-35963366 TAGGCCCTCAGCCTGAAACCTGG + Intronic
995917293 5:117263173-117263195 GAGGTACTCAGAAAGGAATCTGG - Intergenic
996483158 5:123998515-123998537 GAGGGACTCAGACAGGGACCTGG + Intergenic
999670271 5:153953614-153953636 GAGGGACTCAGCCAGGCATCCGG - Intergenic
1010210972 6:73362824-73362846 CAGGAACTCAGAGTGGAACCAGG - Exonic
1019045209 6:169140139-169140161 GAGGAAATCAGAATGGAACCTGG - Intergenic
1021106532 7:16645380-16645402 AAGGTTTGCAGCCTGGAACCGGG - Intronic
1024809339 7:53189323-53189345 GGGGTTCTCAGCCTGTAAACTGG - Intergenic
1024914454 7:54483917-54483939 GAGGTAGTCATACTGGAACAAGG + Intergenic
1025606277 7:63042056-63042078 GAGTTACTCAGCTGGGGACCTGG + Intergenic
1025744636 7:64232178-64232200 GAGGTTCTCAGTCTCAAACCTGG - Intronic
1029068059 7:97872236-97872258 GCGGTCTTCAGCCTGGCACCCGG - Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1032127476 7:129205438-129205460 GGGGCCCTCAGCCTGGAACGTGG + Intronic
1035141716 7:156769177-156769199 GAGCTACTGAGCCTGGCATCAGG - Intronic
1035584927 8:765137-765159 GAGAAACTCATCCTGAAACCTGG - Intergenic
1038302357 8:26364488-26364510 GAAGTACACAGCCTGGAACAGGG + Intronic
1046442350 8:114273881-114273903 GATGTCCTCAGCATGGAATCTGG - Intergenic
1047940313 8:129822848-129822870 CAGGTCCTCTGCCTGGATCCTGG + Intergenic
1048877834 8:138850869-138850891 GAAGTTCTCAGCATGAAACCTGG + Intronic
1189465644 X:41276085-41276107 GGGGGACTCAGCAGGGAACCTGG - Intergenic
1190513792 X:51202140-51202162 TAGGTACTAAGCCTTGTACCTGG + Intergenic
1197657904 X:129137458-129137480 CAAGTACTCAGCCTGGCACATGG + Intergenic
1198567201 X:137916647-137916669 GAGATGCGCAGCCTGGAACTGGG + Intergenic
1199924593 X:152449599-152449621 CAGCAACTCAGCCTGGAGCCGGG - Intronic
1200115358 X:153767585-153767607 GCGGTACTCAGCCTGGGCCCGGG - Exonic
1202131923 Y:21620717-21620739 GAGGTAGTCACCCTGTATCCTGG - Intergenic