ID: 921013746

View in Genome Browser
Species Human (GRCh38)
Location 1:211168545-211168567
Sequence TGGGGGTATAGGCATTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921013738_921013746 18 Left 921013738 1:211168504-211168526 CCTACAAAATCAAAAACAAGTTA No data
Right 921013746 1:211168545-211168567 TGGGGGTATAGGCATTGGGTAGG No data
921013737_921013746 29 Left 921013737 1:211168493-211168515 CCACATATGAGCCTACAAAATCA No data
Right 921013746 1:211168545-211168567 TGGGGGTATAGGCATTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921013746 Original CRISPR TGGGGGTATAGGCATTGGGT AGG Intergenic
No off target data available for this crispr