ID: 921016707

View in Genome Browser
Species Human (GRCh38)
Location 1:211198411-211198433
Sequence TAGGGTCCAAAAAGGGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921016707_921016714 29 Left 921016707 1:211198411-211198433 CCTTCCGCCCTTTTTGGACCCTA No data
Right 921016714 1:211198463-211198485 ACCCATAAGCATCATTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921016707 Original CRISPR TAGGGTCCAAAAAGGGCGGA AGG (reversed) Intergenic
No off target data available for this crispr