ID: 921029719

View in Genome Browser
Species Human (GRCh38)
Location 1:211326802-211326824
Sequence CTCCGCTTCGCCGCCGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 193}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921029706_921029719 6 Left 921029706 1:211326773-211326795 CCGCGCCCCGGCCCCGCCCCAGG 0: 1
1: 6
2: 77
3: 528
4: 2466
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029712_921029719 -6 Left 921029712 1:211326785-211326807 CCCGCCCCAGGCCTCGCCTCCGC 0: 1
1: 0
2: 10
3: 117
4: 1088
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029713_921029719 -7 Left 921029713 1:211326786-211326808 CCGCCCCAGGCCTCGCCTCCGCT 0: 1
1: 0
2: 5
3: 65
4: 857
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029696_921029719 25 Left 921029696 1:211326754-211326776 CCCGCCCGCGCCCCTCCGCCCGC 0: 1
1: 3
2: 25
3: 228
4: 1818
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029702_921029719 14 Left 921029702 1:211326765-211326787 CCCTCCGCCCGCGCCCCGGCCCC 0: 1
1: 0
2: 21
3: 201
4: 1622
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029697_921029719 24 Left 921029697 1:211326755-211326777 CCGCCCGCGCCCCTCCGCCCGCG 0: 1
1: 0
2: 12
3: 141
4: 1095
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029705_921029719 7 Left 921029705 1:211326772-211326794 CCCGCGCCCCGGCCCCGCCCCAG 0: 1
1: 3
2: 23
3: 278
4: 1890
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029698_921029719 21 Left 921029698 1:211326758-211326780 CCCGCGCCCCTCCGCCCGCGCCC 0: 1
1: 0
2: 22
3: 220
4: 1400
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029703_921029719 13 Left 921029703 1:211326766-211326788 CCTCCGCCCGCGCCCCGGCCCCG 0: 1
1: 3
2: 84
3: 670
4: 2832
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029708_921029719 1 Left 921029708 1:211326778-211326800 CCCCGGCCCCGCCCCAGGCCTCG 0: 1
1: 2
2: 17
3: 263
4: 1373
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029714_921029719 -10 Left 921029714 1:211326789-211326811 CCCCAGGCCTCGCCTCCGCTTCG 0: 1
1: 0
2: 2
3: 14
4: 193
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029709_921029719 0 Left 921029709 1:211326779-211326801 CCCGGCCCCGCCCCAGGCCTCGC 0: 1
1: 0
2: 34
3: 257
4: 1646
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029699_921029719 20 Left 921029699 1:211326759-211326781 CCGCGCCCCTCCGCCCGCGCCCC 0: 1
1: 4
2: 40
3: 374
4: 2728
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029711_921029719 -5 Left 921029711 1:211326784-211326806 CCCCGCCCCAGGCCTCGCCTCCG 0: 1
1: 0
2: 7
3: 93
4: 1141
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029704_921029719 10 Left 921029704 1:211326769-211326791 CCGCCCGCGCCCCGGCCCCGCCC 0: 1
1: 6
2: 134
3: 743
4: 3584
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029710_921029719 -1 Left 921029710 1:211326780-211326802 CCGGCCCCGCCCCAGGCCTCGCC 0: 1
1: 2
2: 40
3: 286
4: 1882
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193
921029701_921029719 15 Left 921029701 1:211326764-211326786 CCCCTCCGCCCGCGCCCCGGCCC 0: 1
1: 1
2: 22
3: 270
4: 1634
Right 921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921029719 Original CRISPR CTCCGCTTCGCCGCCGCCGC CGG Intronic
904941014 1:34164910-34164932 CTCAGCGTCTCGGCCGCCGCGGG - Exonic
905626225 1:39491940-39491962 ATCAGCTCCGCCGCCGCCCCTGG - Exonic
907010708 1:50960166-50960188 CTCGGTTTCCCCGCCCCCGCCGG - Exonic
908534633 1:65066695-65066717 CTCCGGACCGCCGCCGCCGCGGG + Intergenic
913592310 1:120341365-120341387 CCCCGCTCTGCCGCCGCTGCTGG + Intergenic
913651048 1:120913780-120913802 CCCCGCTCTGCCGCCGCTGCTGG - Intergenic
914170065 1:145215287-145215309 CCCCGCTGTGCCGCCGCTGCTGG + Intergenic
914525184 1:148459250-148459272 CCCCGCTCTGCCGCCGCTGCTGG + Intergenic
914598494 1:149176580-149176602 CCCCGCTCTGCCGCCGCTGCTGG - Intergenic
914641220 1:149607884-149607906 CCCCGCTCTGCCGCCGCTGCTGG - Intergenic
920260540 1:204685272-204685294 CTGGGCAGCGCCGCCGCCGCCGG - Intronic
921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG + Intronic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
922526673 1:226309344-226309366 CGCCCCTCCGCCGCCGCCTCCGG + Exonic
1063418203 10:5890184-5890206 CTCCGCCCCGCCGCAGCCCCGGG - Intronic
1063439641 10:6062169-6062191 CTCCGCTTCACTGCCCCGGCTGG - Exonic
1063504150 10:6580564-6580586 CTCCGCCTCGCCGCCCTCCCGGG - Intergenic
1066126351 10:32346688-32346710 TGCTGCTCCGCCGCCGCCGCAGG + Intronic
1067478093 10:46579237-46579259 CTCCGCCCCGCCGCCCCCGCTGG + Intronic
1067616647 10:47762550-47762572 CTCCGCCCCGCCGCCCCCGCTGG - Intergenic
1070768311 10:79068816-79068838 CGCCGCGCCGCCGCCGCTGCCGG - Intergenic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1072638889 10:97196241-97196263 CGCCGCTGCCCCGACGCCGCGGG - Intronic
1076372405 10:129963982-129964004 CTTCGAAGCGCCGCCGCCGCCGG - Intergenic
1077090797 11:777394-777416 CTCACCTTCGGCGGCGCCGCTGG + Exonic
1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG + Exonic
1077898785 11:6473906-6473928 CCCCGCGCCGGCGCCGCCGCCGG + Intronic
1078168524 11:8911135-8911157 CCCAGCTGCGCCGGCGCCGCCGG + Exonic
1078659825 11:13277858-13277880 CTCACCGCCGCCGCCGCCGCGGG + Exonic
1079172096 11:18106011-18106033 CAACCCCTCGCCGCCGCCGCCGG - Exonic
1079630364 11:22666996-22667018 CTCCCCTCCCCCGCCGCCCCGGG - Intronic
1080551265 11:33375944-33375966 CTCCGCTGCGCGGGAGCCGCCGG + Intergenic
1081834451 11:46142781-46142803 ACCCGCTTCACCGCCCCCGCCGG + Intergenic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083272867 11:61580874-61580896 CGCTGCTCCGCCGCCGCCGCTGG + Intronic
1083922314 11:65787506-65787528 CGCAGCCTCGACGCCGCCGCGGG - Intronic
1085205829 11:74731361-74731383 CGCCGCGCCGCCGCCGCTGCTGG - Intronic
1087241758 11:95789290-95789312 CCCCTCTTCGCCGGCGCCTCAGG - Intronic
1087795621 11:102452688-102452710 CTCCTCTGCGCAGCCGGCGCCGG + Exonic
1089694922 11:120211074-120211096 CTCCGCCTCGGGGCCGCCGGGGG + Exonic
1090636697 11:128694312-128694334 CGCCGCTTCGCCTCCCCGGCCGG - Intronic
1092204617 12:6607354-6607376 CTCCTCCTCGCCGCGGCCGAAGG + Exonic
1093435285 12:19129586-19129608 CTCCGCATCCCGGCGGCCGCCGG - Intergenic
1093894821 12:24563339-24563361 CCGCGCGTCCCCGCCGCCGCCGG + Intergenic
1095773734 12:45990505-45990527 CCCTGCTTCGCCGCCGCCTCCGG - Exonic
1096073569 12:48788937-48788959 CCCCGCCCCGCCGCCCCCGCGGG + Intronic
1097107702 12:56635039-56635061 CTCCTCCCCTCCGCCGCCGCCGG - Intronic
1097166497 12:57089049-57089071 CTCCGCGCCTCCGCCCCCGCAGG - Exonic
1097250886 12:57631885-57631907 CTGCGCTGCGCCGCCGCGGTCGG + Intronic
1097854909 12:64452155-64452177 CTCCGCCGCGCCACCGCCGGCGG - Exonic
1098550373 12:71755140-71755162 CGCCCCGCCGCCGCCGCCGCCGG - Exonic
1099989540 12:89708523-89708545 CTCCGCCTGGCCTCCCCCGCAGG + Intronic
1100444816 12:94650580-94650602 CCCTGCGCCGCCGCCGCCGCGGG + Intergenic
1101146771 12:101848076-101848098 CTCCGCTTCAACCCCTCCGCCGG - Intergenic
1103443273 12:120978914-120978936 CTCCCCTCGACCGCCGCCGCAGG - Exonic
1103595358 12:122021826-122021848 AGCCGCGCCGCCGCCGCCGCCGG - Exonic
1106304097 13:28495049-28495071 CTCCGAGCCGCCGCCGCTGCCGG + Exonic
1107951355 13:45465064-45465086 TCCCGCTCCGCCGCCGCCTCAGG - Exonic
1112505081 13:99970583-99970605 CCCGGCGCCGCCGCCGCCGCCGG - Exonic
1114659403 14:24334986-24335008 CTCCGCTGCGCCAGCGCCGCGGG - Exonic
1115592244 14:34875093-34875115 CTCCACTTCCCCGCCGGCGCCGG + Intronic
1118186543 14:63543135-63543157 CACGTCGTCGCCGCCGCCGCCGG - Exonic
1119410386 14:74426369-74426391 CCTCGCTTCGCCGCCTCCTCCGG - Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121342954 14:93115907-93115929 CGCCGCTTCCTCGCCGCCGCGGG - Intronic
1121758677 14:96424267-96424289 CCCCGTGTCGCCGCTGCCGCCGG - Intronic
1122689125 14:103523191-103523213 CGGCCCCTCGCCGCCGCCGCGGG - Intergenic
1127103239 15:55588215-55588237 TTCTTCTTCGCCGCCGCCTCAGG + Intronic
1132028530 15:98422057-98422079 CCCCGGTGCGCCGCCGCCGATGG + Intergenic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1136913909 16:34163607-34163629 CCGCGGTTCGCCGCCGCCCCTGG + Intergenic
1137261113 16:46830945-46830967 CCCCGGATCCCCGCCGCCGCCGG + Intronic
1137454839 16:48610180-48610202 CGCCCCTTTGCCGCCGCCGCGGG + Exonic
1138478286 16:57284710-57284732 CCCGGCTCCGCCCCCGCCGCCGG + Intergenic
1138961734 16:62036329-62036351 CCAAGCTCCGCCGCCGCCGCCGG - Exonic
1139974793 16:70800977-70800999 CTCCGCTCTGCCCCCGGCGCCGG + Exonic
1141615379 16:85206922-85206944 CTCCTCTTGGCCACCGGCGCTGG - Intergenic
1142638220 17:1270691-1270713 CTCCGCCTCGCCCCGGCTGCAGG - Exonic
1142711160 17:1724802-1724824 GTCCGCCTCTTCGCCGCCGCCGG + Intronic
1142810383 17:2393190-2393212 CTCCGCGTCTCCGCGGCTGCCGG + Intronic
1143198660 17:5097226-5097248 CTCCGCAGCGCTGACGCCGCTGG - Intergenic
1143237938 17:5419372-5419394 GGGCTCTTCGCCGCCGCCGCTGG + Exonic
1144269144 17:13600938-13600960 CCCCGCCTCCTCGCCGCCGCCGG + Exonic
1144724844 17:17496610-17496632 CTCCGCTTTTCCACTGCCGCGGG + Intergenic
1146183065 17:30709441-30709463 CTCCGCCTCGCCCCAGCCCCCGG + Intergenic
1146398725 17:32487518-32487540 CTCCTCTCCGGGGCCGCCGCAGG + Exonic
1146773134 17:35587407-35587429 CTCGCCTTCGCCTCCGCCTCCGG + Exonic
1148356384 17:46978549-46978571 CTGCGCTCTGCCGCCGCCTCCGG - Exonic
1148556598 17:48582232-48582254 CTCCTCCGCGCCGCCGCCGCCGG - Intronic
1148826458 17:50397615-50397637 CTGCACGTCGCCGCCGCCGGAGG + Intergenic
1148936392 17:51166972-51166994 CTCCCCTTCCCCGCTGCAGCCGG + Intronic
1149597896 17:57874855-57874877 CTTCCCCTCGCCCCCGCCGCCGG - Intronic
1149858098 17:60102717-60102739 TTCCCCTTTGCCGCCGCCGCCGG - Intergenic
1151478544 17:74356879-74356901 CGCCGCGTCGCCGCCGCTGCTGG + Exonic
1152245589 17:79183158-79183180 CTCTGCGCCGCCGCCGCCACCGG - Intronic
1152433118 17:80260541-80260563 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433131 17:80260571-80260593 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433144 17:80260601-80260623 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433157 17:80260631-80260653 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433170 17:80260661-80260683 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433183 17:80260691-80260713 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433196 17:80260721-80260743 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433209 17:80260751-80260773 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433222 17:80260781-80260803 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433235 17:80260811-80260833 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG + Intergenic
1155284261 18:24272049-24272071 CTCCCCTTCCCCAGCGCCGCTGG + Intronic
1155297305 18:24397456-24397478 CTCGGCTTCCCGGCGGCCGCTGG - Intronic
1156350369 18:36297485-36297507 CCCCGCCCCGCCTCCGCCGCCGG + Intergenic
1160024206 18:75205130-75205152 CGCGGCTTCGCCCCCGCGGCTGG + Intronic
1160453619 18:78980725-78980747 GTCGCCTTCCCCGCCGCCGCCGG - Intronic
1160717461 19:582771-582793 CTCCACGTCTGCGCCGCCGCCGG + Exonic
1160957587 19:1700546-1700568 CTCCTCCTGGCCCCCGCCGCCGG + Intergenic
1161051067 19:2164301-2164323 CTCCCCTCCTCCGCCGCCCCTGG + Intronic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161703244 19:5805936-5805958 CTGCTCGCCGCCGCCGCCGCCGG + Intergenic
1161963061 19:7533527-7533549 CTCCTCTGCGCCTGCGCCGCCGG - Exonic
1162975730 19:14206327-14206349 CTCCGCCTCGCCCCAGCCCCCGG - Intergenic
1163123537 19:15232256-15232278 CACCGCTTCGCCGCTGCTGCAGG - Exonic
1163631400 19:18419625-18419647 CTGCTCCACGCCGCCGCCGCCGG - Exonic
1163635074 19:18433842-18433864 CTCCGGCCCGACGCCGCCGCGGG - Intronic
1165405599 19:35629098-35629120 CTCTGCTTAGCCGCCGCCGCTGG - Exonic
1166361326 19:42254039-42254061 CTCCCCTCCCCCGCCGCCCCCGG - Intronic
1167696632 19:51019093-51019115 CTCCACCTCTCCGCCGCCTCTGG - Exonic
1168336499 19:55600293-55600315 CCCCGCCTCGCCGCCGCCGAGGG + Intronic
1168343808 19:55641051-55641073 CCCCGCGTCCCCGGCGCCGCCGG + Intronic
931021187 2:58046800-58046822 CTCCGCCTCGTCGCAGCGGCAGG + Intronic
932496407 2:72147864-72147886 CTCCCCTCCCCCGCCGCGGCCGG - Exonic
932566891 2:72916356-72916378 TTCCGCTTCCTCGCCGCTGCCGG - Intronic
934761090 2:96857658-96857680 TTCCGCTTCCCCGCCGCCCGCGG + Intronic
942455664 2:176136729-176136751 GTCCGCATCGCCGCCACCTCCGG + Intergenic
943587702 2:189760320-189760342 CTCCGCCTGGCCGCCACCTCTGG - Intronic
944563352 2:200963543-200963565 CCCCGCTGAGTCGCCGCCGCAGG + Exonic
946329160 2:219000123-219000145 CTCCGCTGCTCCGCTGCCACAGG - Intergenic
947418480 2:229921700-229921722 TTCCGCGGCCCCGCCGCCGCCGG + Intronic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
948824652 2:240568410-240568432 CTCCGCTCGGCCGCCGCCGGGGG - Intronic
1168802631 20:653181-653203 CCCATCGTCGCCGCCGCCGCGGG + Exonic
1170756810 20:19212495-19212517 CCCCGCCGCGCCGCCGCCCCAGG + Intergenic
1171011499 20:21511856-21511878 CTCCTCGCCGCCACCGCCGCCGG + Exonic
1171908819 20:30922178-30922200 CCCCGGTTCGTCGCCGCCCCTGG + Intergenic
1173251603 20:41366696-41366718 CGCCGCGCCGCCCCCGCCGCTGG + Exonic
1175399664 20:58693130-58693152 CGCCGCACCCCCGCCGCCGCCGG + Intronic
1176555774 21:8253457-8253479 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
1176574711 21:8436491-8436513 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
1176611325 21:8987784-8987806 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
1178513836 21:33229904-33229926 CGCCGCGCCGCCGCCGGCGCGGG - Intronic
1179054087 21:37915772-37915794 CCCAGCTCCGCCGTCGCCGCAGG - Intronic
1179911952 21:44455408-44455430 CGCCCCTTCCCCGCCCCCGCGGG + Intergenic
1180231993 21:46432165-46432187 CTCCACTGCTCCGCAGCCGCTGG - Exonic
1180559300 22:16602248-16602270 CTCCGGCCCGGCGCCGCCGCTGG - Intergenic
1180603535 22:17037564-17037586 CAGCGCTTCACCGCCGCCTCTGG - Intergenic
1182475602 22:30574808-30574830 CAACGCTGCGCCCCCGCCGCCGG + Intergenic
1183683768 22:39350208-39350230 CGCCGCCGCGCCGCCGCCGGGGG - Intronic
1184568937 22:45310122-45310144 CACCTCTTCGCCTCCGCAGCCGG - Exonic
1203252759 22_KI270733v1_random:125542-125564 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
1203260815 22_KI270733v1_random:170628-170650 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
950773759 3:15332564-15332586 CTCTGCTCCGCCGCGGCCGGAGG - Exonic
954110113 3:48429013-48429035 CCCCTCCTCGCCGTCGCCGCCGG - Intronic
954384712 3:50238006-50238028 ATCCGCTTCGCTGCTGCCTCAGG + Intronic
954840985 3:53511344-53511366 CTCTTTTTCGCCGCCGCTGCTGG - Intronic
956813552 3:72888067-72888089 TTCGCCGTCGCCGCCGCCGCCGG + Exonic
961008908 3:123423315-123423337 CTCCGCTTCCCCTTCTCCGCAGG - Intronic
968025974 3:195442853-195442875 CTCCGCCTCGCAGGCGGCGCTGG + Exonic
968285234 3:197504732-197504754 CTCCCCTTCCCCGCCTCCTCTGG - Intergenic
972586044 4:40437880-40437902 CTCAGCCGCGCCGCCGCCCCTGG + Exonic
989983307 5:50667514-50667536 CCCCGCTCTGCCGCCGCTGCTGG - Intronic
990041571 5:51383470-51383492 CTCCGCTCCGCCAACTCCGCCGG + Exonic
994043490 5:95284228-95284250 CTCGGCTCTGCCGGCGCCGCCGG + Exonic
995342258 5:111073034-111073056 CTCCGGGACGCCGCCGCCGGGGG + Intronic
997736531 5:136216450-136216472 CTCTGTTTCGCCTCCCCCGCAGG + Intronic
999140461 5:149358108-149358130 CTCCTCGCCGCCGCCGCTGCTGG + Exonic
1002021442 5:176366364-176366386 CTCCGCTTCCCCGCAGCCCGAGG + Exonic
1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG + Exonic
1002926812 6:1609824-1609846 CTCCCATTGGCTGCCGCCGCTGG + Intergenic
1002929185 6:1621524-1621546 GTCCGCTTGGCCGCGGGCGCTGG - Intergenic
1003995799 6:11538167-11538189 CTCCTCCAGGCCGCCGCCGCTGG - Intergenic
1006639347 6:35481167-35481189 CTCCTCCTCGCAGCCTCCGCAGG + Intronic
1010083100 6:71886717-71886739 CTCCGCCTGCCCGCCCCCGCCGG + Intronic
1011434478 6:87322494-87322516 CGCCGCTGCGCCGCAGCCTCCGG + Intronic
1013117469 6:107114442-107114464 CTCCCGGCCGCCGCCGCCGCGGG + Intronic
1013227939 6:108134024-108134046 CACCGCCTCGCCGCCGCAGGAGG - Intronic
1014098242 6:117482795-117482817 CGCCAGTGCGCCGCCGCCGCGGG - Exonic
1018156687 6:160991814-160991836 CTCCGCCTCTACCCCGCCGCAGG - Exonic
1019472875 7:1230424-1230446 CTCGGCTGCGGCGGCGCCGCGGG - Intergenic
1021027299 7:15685915-15685937 CTTCGCTTCTCCGCCTCCGCAGG + Exonic
1023955700 7:44885259-44885281 CTCTTGCTCGCCGCCGCCGCGGG + Exonic
1025959270 7:66205734-66205756 CTCGGCTTCGCCCCGGCCGCCGG + Intronic
1029640339 7:101816192-101816214 CCCCTCCTCCCCGCCGCCGCGGG - Intronic
1030088925 7:105840351-105840373 CTCCTCTTCGCCACAGCAGCAGG - Intronic
1034617945 7:152435571-152435593 CTCCGGCCCGGCGCCGCCGCTGG + Intronic
1035431762 7:158828615-158828637 CTCCGCTTCCCCGCCCGCCCAGG - Intronic
1036304861 8:7592892-7592914 CTCTGCTGCGCAGCCTCCGCAGG - Intergenic
1036355712 8:8040884-8040906 CTCTGCTGCGCAGCCTCCGCAGG - Intergenic
1036723732 8:11201071-11201093 CGCCGCAGCGCCGCCGCCGACGG - Exonic
1036801395 8:11795037-11795059 CTCCCCCGCGCCGCCGCCGTGGG + Intergenic
1036910541 8:12754583-12754605 CTCTGCTTCCCCGGGGCCGCTGG - Intronic
1041919832 8:63168976-63168998 CTCCCCGTCGCCGCCGCTGCCGG + Intronic
1042262152 8:66870775-66870797 CTCCGCTCCGCCTACGCTGCAGG + Exonic
1044569479 8:93700835-93700857 CTCCTCTTCGCCGCCGGCGGTGG - Intronic
1044973746 8:97644239-97644261 CGCCGCTTAGCGGCCGCCACTGG + Exonic
1045098946 8:98825892-98825914 CTTCTCTGGGCCGCCGCCGCAGG - Intronic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049932429 9:470118-470140 CTGCCCTTCGCCGCCGCCCCCGG - Intergenic
1051936463 9:22447583-22447605 CTCGGCTCTGCCGCCGCCCCCGG - Exonic
1052778422 9:32755896-32755918 CTCCGCCTCGTCCCCGCCGTTGG + Intergenic
1054820447 9:69516206-69516228 CCCCGCCTCGCCGCCGCCCGCGG + Exonic
1054820595 9:69516890-69516912 CTCCGCATCGTAGCCGTCGCGGG + Exonic
1058937189 9:109780222-109780244 CTCCCGGTCGCCGCCGCCGCCGG - Intronic
1059314194 9:113410314-113410336 CTCCCCTTCGCCTCCGCTTCAGG + Exonic
1059483635 9:114611310-114611332 CTCCGCTCCGCCGCGGGCCCGGG + Exonic
1060555277 9:124504736-124504758 CTCGGCCGCGCCGCCGCCGCCGG + Intronic
1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG + Exonic
1061726957 9:132587281-132587303 CCCGGCCTCGCAGCCGCCGCCGG - Intronic
1203469162 Un_GL000220v1:108693-108715 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
1203476983 Un_GL000220v1:152665-152687 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
1203360450 Un_KI270442v1:216733-216755 CCGCGGTTCGCCGCCGCCCCTGG - Intergenic
1185893319 X:3838548-3838570 TTCCGCTTTGCCCCAGCCGCGGG + Intronic
1185898433 X:3876972-3876994 TTCCGCTTTGCCCCAGCCGCGGG + Intergenic
1185903548 X:3915401-3915423 TTCCGCTTTGCCCCAGCCGCGGG + Intergenic
1188003526 X:25002647-25002669 CGCCACGCCGCCGCCGCCGCCGG - Intergenic
1193655071 X:84188294-84188316 CGCCGCTGTGCCGCCGCCGTGGG - Intergenic