ID: 921029926

View in Genome Browser
Species Human (GRCh38)
Location 1:211327628-211327650
Sequence TCGGGGCCACGCTCTTGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921029921_921029926 12 Left 921029921 1:211327593-211327615 CCTGTTCTGCAGGGTCTTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 196
Right 921029926 1:211327628-211327650 TCGGGGCCACGCTCTTGCTGCGG 0: 1
1: 0
2: 0
3: 9
4: 86
921029917_921029926 22 Left 921029917 1:211327583-211327605 CCACTTTGTTCCTGTTCTGCAGG 0: 1
1: 0
2: 1
3: 17
4: 282
Right 921029926 1:211327628-211327650 TCGGGGCCACGCTCTTGCTGCGG 0: 1
1: 0
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921029926 Original CRISPR TCGGGGCCACGCTCTTGCTG CGG Intronic
902511508 1:16969344-16969366 TCGGGCCCAGGGTCTGGCTGGGG + Intronic
906194952 1:43924238-43924260 TCGGGGCCACGGTGATGGTGAGG - Intronic
916485633 1:165256021-165256043 TCATGCCCACGCTCATGCTGCGG - Intronic
919748276 1:201021941-201021963 GCGGGGCCAGGCTGCTGCTGGGG - Intronic
921029926 1:211327628-211327650 TCGGGGCCACGCTCTTGCTGCGG + Intronic
921593789 1:217033117-217033139 TCTGGGCAAAGCCCTTGCTGAGG - Intronic
922773900 1:228206333-228206355 TCAGGGCCAAGCTCCTGGTGGGG + Intronic
1063170837 10:3508612-3508634 TCAGGGCCACCTTCTTTCTGGGG - Intergenic
1072691888 10:97577644-97577666 CAGGGGCCCTGCTCTTGCTGGGG + Intronic
1074299966 10:112225081-112225103 CTGGGGCCACTTTCTTGCTGGGG - Intergenic
1074503245 10:114044473-114044495 TCGGGGCCACCATCGTGGTGTGG + Exonic
1076076411 10:127537280-127537302 GTGGGGTCACGCTCTGGCTGGGG + Intergenic
1077233301 11:1468298-1468320 GTGGGGCCACCCTCTGGCTGAGG - Intergenic
1077491602 11:2863243-2863265 CCTGGGCCAGGCTCCTGCTGGGG - Intergenic
1084351490 11:68603179-68603201 TCTGGGCCACATTCTTGATGGGG - Intronic
1091545560 12:1499345-1499367 TCAGGGCCACACTGTGGCTGGGG + Intergenic
1091935040 12:4428259-4428281 TCCGTGCCACGTTCCTGCTGTGG - Intronic
1092218927 12:6700195-6700217 TGGGGGCCACGCTGGGGCTGGGG - Exonic
1096496832 12:52043549-52043571 CCAGGGTCACGCTCATGCTGGGG + Intronic
1096781390 12:53994295-53994317 TCCGGGCCACACTCGTGCTGCGG - Intronic
1100432485 12:94543055-94543077 TGGGGGCCACCTTCTTGCTGTGG - Intergenic
1105538952 13:21298071-21298093 TGGGAGCGACGCTCTTGCTCTGG + Intergenic
1109411259 13:61972412-61972434 TCGGGGCCACTTCCATGCTGTGG - Intergenic
1113117223 13:106886328-106886350 GCAGGGCCACACTCCTGCTGAGG + Intergenic
1117954389 14:61111388-61111410 CCGGGGCCTCGCTCCTGCCGCGG + Intergenic
1120809992 14:88793053-88793075 GCGGGGCCACGGTCTAGTTGCGG + Intergenic
1121340031 14:93099697-93099719 TCGGGGCCTCCCTGTGGCTGTGG - Intronic
1121441444 14:93952276-93952298 CCAGGGCCAAGCTCTGGCTGTGG + Intronic
1122821354 14:104346997-104347019 TCGGGGCCACACTCCTTATGGGG + Intergenic
1126921237 15:53527403-53527425 CAGTGGCCACTCTCTTGCTGGGG - Intronic
1130949415 15:88573693-88573715 TTGGGGCCATGCTGCTGCTGAGG - Intergenic
1131157628 15:90084802-90084824 CCCAGGCCACGCACTTGCTGAGG + Exonic
1132844557 16:1993828-1993850 TCTGGGCCTCTCTCCTGCTGAGG - Exonic
1136508659 16:30722630-30722652 TCGGGGCCACGGCCTGGATGAGG - Exonic
1137581485 16:49636190-49636212 CCGTGTCCAGGCTCTTGCTGTGG + Exonic
1138560510 16:57798193-57798215 TGGGAGCCACGCCCTCGCTGCGG - Exonic
1142112193 16:88338868-88338890 GCAGGGCCACGCTCCTCCTGAGG - Intergenic
1142122711 16:88394958-88394980 TGGGGGCAACGCTGTTGTTGGGG - Intergenic
1143562884 17:7705636-7705658 TCGGGGCCCTGCTGCTGCTGGGG + Exonic
1144327299 17:14194206-14194228 TAGGGCCCAGGTTCTTGCTGAGG + Intronic
1144476185 17:15591069-15591091 TAGGGCCCAGGTTCTTGCTGAGG + Intronic
1147141710 17:38464227-38464249 TCTGGGCCACGCTCTCTGTGTGG - Intronic
1151487698 17:74411763-74411785 TCTGGGCCTCACTCTAGCTGTGG - Intergenic
1152812403 17:82388270-82388292 ACGGGGCCACCCTCTGGCCGCGG + Intergenic
1154196639 18:12271854-12271876 GCGGGGCCGCGCTCTTCCTGAGG - Intronic
1162020131 19:7864539-7864561 TGGGGGCCTGGCTCTGGCTGAGG - Intronic
1165323343 19:35099698-35099720 TCGGTGCCCCACGCTTGCTGCGG + Intergenic
937617458 2:123943367-123943389 TCTGGACCACACTGTTGCTGAGG - Intergenic
947490706 2:230592157-230592179 TTTGGGCCACTCTCTTGCTTAGG - Intergenic
947632840 2:231665167-231665189 GCAGGGCCACTCTCTTGGTGGGG - Intergenic
949046069 2:241873260-241873282 TCGGGGCGTCACACTTGCTGCGG - Exonic
1174558353 20:51412567-51412589 GCGGGGCCTCCCTCCTGCTGTGG - Intronic
1176149326 20:63581317-63581339 GAGGGGCCACACTCCTGCTGGGG + Intergenic
1178419864 21:32434778-32434800 TCAGGGCCACGCTCCATCTGAGG - Intronic
1182858025 22:33535217-33535239 CCGGAGCCACGCTGATGCTGTGG + Intronic
1183056198 22:35307643-35307665 ACTGGGCCTCGCTCCTGCTGGGG + Intronic
1183272624 22:36871646-36871668 GTGGGGACACGCTCTTGCTGTGG - Exonic
1183477967 22:38046408-38046430 TGGGGGCCACCTTCCTGCTGGGG - Intergenic
1184188047 22:42877668-42877690 TCTGGGCCAAGCTCTGCCTGAGG + Intronic
1185030246 22:48439164-48439186 TCTGGGCCATTCTGTTGCTGGGG - Intergenic
949893814 3:8753998-8754020 TCGCTGCCACGCCTTTGCTGGGG - Intronic
952740491 3:36729347-36729369 TCTGGGCCATGTTCTTGCTGGGG + Intronic
963117019 3:141738666-141738688 GCGGAGCCACGCTCCTGCTGCGG + Intronic
968431431 4:561335-561357 TGGGGGCCCCTCTCTTCCTGGGG - Intergenic
968488623 4:877512-877534 CCGGGGACAGGCGCTTGCTGAGG - Intronic
968489716 4:883507-883529 TCGTGGCCAGGCTGCTGCTGCGG + Intronic
971740563 4:30515209-30515231 TCTGGGGCAGGCTCTTGCTGTGG - Intergenic
978770338 4:112449918-112449940 TCTGGGGCACGCTCGTGCAGAGG + Intergenic
989668697 5:43888454-43888476 TCTGGGCCACCCTCTTGTTGTGG + Intergenic
992874846 5:81043760-81043782 TTGGGGCAACACTCTAGCTGTGG + Intronic
1007621092 6:43215120-43215142 CCTGGGCCACACTGTTGCTGGGG + Exonic
1010220078 6:73441346-73441368 TCTGTGCCAGGCTGTTGCTGTGG - Intronic
1017444714 6:154497058-154497080 TAAGGGCCAGGCTCTTGCTAAGG - Intronic
1023999447 7:45181053-45181075 TCTGTGCCAGGCACTTGCTGGGG + Intronic
1026748054 7:73027899-73027921 TGGGGGCTCCGCTCTTCCTGGGG + Intergenic
1026751702 7:73056044-73056066 TGGGGGCTCCGCTCTTCCTGGGG + Intergenic
1026755351 7:73084171-73084193 TGGGGGCTCCGCTCTTCCTGGGG + Intergenic
1026759001 7:73112185-73112207 TGGGGGCTCCGCTCTTCCTGGGG + Intergenic
1027088406 7:75281288-75281310 TGGGGGCTCCGCTCTTCCTGGGG - Intergenic
1027092049 7:75309216-75309238 TGGGGGCTCCGCTCTTCCTGGGG - Intergenic
1027095692 7:75337183-75337205 TGGGGGCTCCGCTCTTCCTGGGG - Intergenic
1027323649 7:77030503-77030525 TGGGGGCTCCGCTCTTCCTGGGG + Intergenic
1033302436 7:140198515-140198537 TCAGGGCCTCTCACTTGCTGGGG - Intergenic
1033613011 7:142984184-142984206 TCGGGGCCAGGCACTGGCAGGGG + Intergenic
1033736574 7:144228315-144228337 TCTGAGCCACTCTCTTGCAGAGG - Intergenic
1033746479 7:144322632-144322654 TCTGAGCCACTCTCTTGCAGAGG + Intergenic
1033899445 7:146116902-146116924 GCGGGGCAGCGCTCCTGCTGTGG + Exonic
1044535738 8:93354650-93354672 GCAGGGCCAGGTTCTTGCTGGGG + Intergenic
1047985262 8:130226597-130226619 CTGGGGCCAGACTCTTGCTGAGG - Intronic
1049799231 8:144510099-144510121 ACAGGGCCACGCTCTTTCTGGGG + Intronic
1050307290 9:4318140-4318162 TGGGAGCCAGGGTCTTGCTGCGG + Intronic
1052276593 9:26683459-26683481 TCTGGCTCACGCTCCTGCTGTGG - Intergenic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1061218562 9:129235860-129235882 AGGGGGCCACGCGCCTGCTGGGG + Intergenic
1185461326 X:333888-333910 ACGGAGCCACGCTGTGGCTGAGG + Intergenic
1195377755 X:104244239-104244261 TGGGGACCAAGCTGTTGCTGTGG - Intergenic