ID: 921030286

View in Genome Browser
Species Human (GRCh38)
Location 1:211330252-211330274
Sequence AGTAAGTGAGATATCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921030286_921030292 16 Left 921030286 1:211330252-211330274 CCTCCCAGGATATCTCACTTACT 0: 1
1: 0
2: 1
3: 11
4: 142
Right 921030292 1:211330291-211330313 GTCTCATTTCTTGACACCACAGG 0: 1
1: 0
2: 2
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921030286 Original CRISPR AGTAAGTGAGATATCCTGGG AGG (reversed) Intronic
903476249 1:23620859-23620881 AGTGGGTGAGTTGTCCTGGGAGG - Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
903968926 1:27106625-27106647 AGGAAGTGAGAGATCCAGGGAGG + Intronic
904949487 1:34224873-34224895 AGTAAGTCACATATTCTGGAAGG - Intergenic
909415284 1:75399420-75399442 AGAAAGTGAGATATTCTCGAGGG + Intronic
913073046 1:115318335-115318357 AGTCAGTGAGAAAGCCTGGAGGG - Intronic
917581449 1:176382323-176382345 AGCAAATGAAATCTCCTGGGAGG + Intergenic
919143813 1:193607822-193607844 TGTAATTGTGATATCCTGGATGG + Intergenic
920256615 1:204659533-204659555 CGTAAGACAGATGTCCTGGGAGG - Intronic
921030286 1:211330252-211330274 AGTAAGTGAGATATCCTGGGAGG - Intronic
921742548 1:218702478-218702500 AGGCAGTGAGATATACTAGGCGG - Intergenic
923351027 1:233106840-233106862 TGTAAGTTAGATATCCAGAGAGG - Intronic
1064234401 10:13560736-13560758 AGCAAGAGAGACCTCCTGGGTGG + Intergenic
1069833736 10:71296066-71296088 AGACAGTGAGAGATCCAGGGAGG - Intronic
1072782062 10:98257959-98257981 GGTGAGTGAGACAGCCTGGGAGG - Exonic
1074136290 10:110629745-110629767 ATTAAGTGAAATTTCCTGGCAGG + Intergenic
1074471922 10:113735199-113735221 AGCAAGTGAGGCATCCAGGGGGG - Intergenic
1075593116 10:123707044-123707066 ATTAAGTGAGCTATTCTGGAAGG + Intronic
1076173970 10:128351078-128351100 AGTATGTGAGATAACCTGGATGG - Intergenic
1078712464 11:13807645-13807667 ACTAAGTGCCATATACTGGGTGG + Intergenic
1079603670 11:22341345-22341367 AGAATGTGAGAGAGCCTGGGAGG + Intronic
1084248997 11:67881266-67881288 AGGATGTGATAGATCCTGGGAGG - Intergenic
1084823820 11:71714204-71714226 AGGATGTGATAGATCCTGGGAGG + Intergenic
1087307811 11:96505310-96505332 AGTAGGAGTGATATCCTGGAAGG - Intronic
1090455235 11:126843375-126843397 AGTGAGTGAGATTTCATGGGAGG + Intronic
1091128534 11:133123893-133123915 AGGAAGTGGGATATACTGAGCGG + Intronic
1091787034 12:3249302-3249324 AGGAAGTGACACTTCCTGGGAGG - Intronic
1091849397 12:3683096-3683118 ACTAAGTGAGATAAGCAGGGTGG + Intronic
1092419281 12:8316688-8316710 AGGATGTGATAGATCCTGGGAGG - Intergenic
1093102182 12:15040582-15040604 TTTTAGTGAGATATGCTGGGAGG + Intergenic
1093756608 12:22859920-22859942 ACTGAGTGAGATAACTTGGGAGG + Intergenic
1094468698 12:30782041-30782063 AGTATGTGAGTTATACTGAGGGG + Intergenic
1095922589 12:47545655-47545677 TGTAAGTGACATATCTTGGAGGG - Intergenic
1096401063 12:51306803-51306825 AGGAAGTGAGATATCCTTTCTGG - Intronic
1096751454 12:53761433-53761455 AATAACTGAGATAGCCAGGGAGG + Intergenic
1099480307 12:83157519-83157541 AGTAAGTGAATTATCTTGAGTGG + Intergenic
1099670911 12:85690861-85690883 AGAAAGTGATGTTTCCTGGGAGG + Intergenic
1099693728 12:85993172-85993194 AGTAATTGAGCTCTCCTGGAAGG + Intronic
1103746981 12:123131630-123131652 AGTAAGGGTGATGTCCTGGAGGG - Intronic
1104238816 12:126966695-126966717 AGTAACTGTAATATCCTGTGCGG + Intergenic
1104989073 12:132614921-132614943 ATTATGGGAGGTATCCTGGGTGG + Intergenic
1106651933 13:31700632-31700654 AGTGAGTTAGATCTCATGGGAGG - Intergenic
1107412322 13:40169319-40169341 AGAAAGTGAGAGACCCAGGGAGG - Intergenic
1108271035 13:48759863-48759885 AGTGAGTGAGTTCTCCTGAGAGG - Intergenic
1108624030 13:52210303-52210325 AGTAAGTGGCGTTTCCTGGGAGG - Intergenic
1108662028 13:52596121-52596143 AGTAAGTGGCGTTTCCTGGGAGG + Intergenic
1109258136 13:60109265-60109287 TGTAAGTGAGAAATCCTGGTCGG - Intronic
1109492251 13:63117139-63117161 AATAAATGGGATTTCCTGGGAGG + Intergenic
1111866749 13:93778348-93778370 TATAAGAGAGATTTCCTGGGTGG + Intronic
1112080908 13:95969181-95969203 AGTAAGTGAGCTTCCCTGGTAGG + Intronic
1117388847 14:55243833-55243855 ATTAGGTGAGATCTCTTGGGAGG - Intergenic
1119292707 14:73508382-73508404 AGGAAGTGAGATATCAGGTGGGG - Intronic
1119622709 14:76144770-76144792 GGTAAGTGAGAGAGCATGGGAGG + Intergenic
1120190259 14:81434323-81434345 AGTAAGAGAGATGTGTTGGGCGG - Intronic
1121698778 14:95935546-95935568 AGTATGGGAGAAATCCTTGGTGG - Intergenic
1126916695 15:53474000-53474022 AGTAAGTGACAGAGGCTGGGAGG - Intergenic
1128498153 15:68209996-68210018 AGTGAGTGAGGTGCCCTGGGCGG - Intronic
1130577460 15:85105246-85105268 AGAAAGTGAGCTTTCTTGGGAGG + Intronic
1133358796 16:5157160-5157182 AGGATGTGATAGATCCTGGGAGG - Intergenic
1134252234 16:12582471-12582493 AGTGAGTCAGGTGTCCTGGGGGG - Intergenic
1135205472 16:20480352-20480374 AGTAGCTGAGAGACCCTGGGTGG + Intronic
1135213435 16:20543461-20543483 AGTAGCTGAGACACCCTGGGTGG - Intronic
1135842241 16:25887334-25887356 AGTAAGACAGCTATCCTGGTGGG + Intronic
1143146259 17:4778136-4778158 AGTAAGTGACCTAACCAGGGAGG + Intronic
1143601262 17:7947735-7947757 AGAAAGTGAGCTAGTCTGGGTGG - Intronic
1146759708 17:35466514-35466536 ATTAAGTGACATCTCCTTGGAGG - Intronic
1148744773 17:49912108-49912130 GGTGAGGGAGCTATCCTGGGTGG - Intergenic
1150180171 17:63111014-63111036 ATTAAGTAAGATATCATGGCCGG + Intronic
1155851926 18:30784753-30784775 ACTCTGTGAGATTTCCTGGGAGG - Intergenic
1156718175 18:40037587-40037609 GATAAGTGGGATATCCAGGGAGG - Intergenic
1157324328 18:46657850-46657872 AGTTAGTGAGTTCACCTGGGAGG - Intergenic
1157415012 18:47495012-47495034 AGTAACTGAGATATCATTTGAGG - Intergenic
1163054228 19:14706301-14706323 AGTCAGTGAGTTTTTCTGGGAGG - Intronic
1166541895 19:43611157-43611179 GATAAGGGAGATACCCTGGGGGG - Intronic
1166990910 19:46692207-46692229 AGTAAATGAGATGTGCTGAGTGG + Intronic
1167217063 19:48171729-48171751 AGTAGATGAGATACCCCGGGTGG + Intronic
928911341 2:36424784-36424806 TGTAAGTGAGATATCCATTGAGG - Intronic
929860616 2:45674226-45674248 AGGAAGTGAGGAATCCTGGCTGG - Intronic
934085546 2:88506194-88506216 AGGAAGTAAGATATCCTGATTGG + Intergenic
934653922 2:96107694-96107716 AGTGGGTGAGATACTCTGGGAGG - Intergenic
935045905 2:99482200-99482222 AGTAAGTGAGGTTTCCTGGCTGG + Intronic
936750733 2:115638614-115638636 AGTCACTGAAATATCCTGGTAGG + Intronic
937042353 2:118832524-118832546 AGTATGTGAGTTTCCCTGGGGGG - Intergenic
938042162 2:128084728-128084750 AGTAAGTGAGATTTTCTGGGAGG + Intergenic
940930756 2:159427288-159427310 AGGAAATGAGATCTCCTTGGTGG + Intronic
945909834 2:215635790-215635812 AGTAAGTGAGAGCCCCTTGGGGG - Intergenic
946999600 2:225438973-225438995 GGTAAGTGAGATGTGCTGGAGGG + Intronic
1170352499 20:15457461-15457483 AGTAACTGAAATATCCCAGGTGG + Intronic
1175672878 20:60921093-60921115 AGGAACTGAGAGCTCCTGGGGGG + Intergenic
1184243503 22:43223650-43223672 AGCAAGTGAGAAATTCTGGAGGG - Intronic
949619771 3:5797594-5797616 AGAAAGAGAGACATCCTGGGAGG + Intergenic
952694514 3:36249992-36250014 AAAAAGTGTGATTTCCTGGGTGG - Intergenic
953951484 3:47193864-47193886 AGTAATTAAGATACCCTGAGAGG + Intergenic
955480207 3:59382332-59382354 AGGAAGTGATAGAACCTGGGTGG - Intergenic
956551452 3:70464542-70464564 AGCAACTTAGATAGCCTGGGCGG - Intergenic
957494240 3:80969806-80969828 AGTAAGTGAGAGATCCCAAGTGG - Intergenic
959623439 3:108423263-108423285 AGTAAGTGAGACAGCCAGGTGGG - Intronic
960201454 3:114841854-114841876 AGAAAATGAGATTGCCTGGGAGG + Intronic
961290134 3:125840140-125840162 AGGATGTGATAGATCCTGGGAGG + Intergenic
961896965 3:130175887-130175909 AGGATGTGATAGATCCTGGGAGG - Intergenic
962638726 3:137361044-137361066 AGTAAGTGATAAATCCTGCCAGG + Intergenic
964863629 3:161229808-161229830 GGTGAGTGTGATGTCCTGGGAGG + Intronic
965550621 3:169961474-169961496 AGTCTGTGAGACATCCTGGAGGG + Intergenic
967119970 3:186374091-186374113 AGTCAGTGAGATTTCTTGGTAGG + Intergenic
969007148 4:4029442-4029464 AGGATGTGATAGATCCTGGGAGG - Intergenic
969746467 4:9076620-9076642 AGGATGTGATAGATCCTGGGAGG + Intergenic
969805816 4:9608014-9608036 AGGATGTGATAGATCCTGGGAGG + Intergenic
975975317 4:80088993-80089015 AGCAAGTGAGATATCCTAGTTGG + Intronic
979443561 4:120781961-120781983 AGAAAGTGAAATACCCAGGGTGG - Intronic
979947876 4:126857069-126857091 ATTAAGTGCCACATCCTGGGAGG - Intergenic
980991407 4:139741404-139741426 AGTCACTGAGAAATCCTGAGAGG + Intronic
982716145 4:158810594-158810616 AGTAAGTGATGTATCCTCAGAGG - Intronic
983831175 4:172329850-172329872 AGTAAGTGGGACCTCCTGGCTGG - Intronic
984081107 4:175251159-175251181 AGGCAGTGGGAAATCCTGGGTGG - Intergenic
984300505 4:177911701-177911723 AGTAAGTGAGACACCCTTGTTGG - Intronic
984881717 4:184415353-184415375 AGTAAGTGAGAGATCCCGTTAGG - Intronic
985133993 4:186767027-186767049 ATTAAGTGAGATGACCTGCGTGG - Intergenic
985667802 5:1191295-1191317 AGTAGGGGAGATGTCATGGGGGG + Intergenic
985667813 5:1191332-1191354 AGTAGGGGAGATGTCATGGGGGG + Intergenic
985667824 5:1191369-1191391 AGTAGGGGAGATGTCATGGGGGG + Intergenic
985668172 5:1192640-1192662 AGTGGGTGAGATGTCATGGGGGG + Intergenic
985668270 5:1192999-1193021 AGTGGGTGAGATGTCGTGGGGGG + Intergenic
987875918 5:23681010-23681032 AGCTAGTGAGAAGTCCTGGGAGG - Intergenic
1000030979 5:157401305-157401327 GGTAAGTAAGAGACCCTGGGTGG + Intronic
1000543127 5:162565962-162565984 AGGAAGTCAGGTATCCTGGAAGG + Intergenic
1000842760 5:166242315-166242337 AGTAGGAGACATATCCTGGGAGG + Intergenic
1003512249 6:6791248-6791270 AGCAAGTGAGTCTTCCTGGGCGG + Intergenic
1007308098 6:40922933-40922955 AGAATGTGAGATCACCTGGGTGG - Intergenic
1009880003 6:69554953-69554975 TGTAAGCCAGAGATCCTGGGAGG - Intergenic
1012766974 6:103379670-103379692 AGCAAGTGAGAGATACTGGAGGG + Intergenic
1013699078 6:112741308-112741330 AGTAAGTAAGAAAACCTGTGTGG + Intergenic
1019071097 6:169345862-169345884 AGTAAGTAAGAAGTCCTCGGTGG + Intergenic
1023036950 7:36139638-36139660 AGTAAGTGAGATAATCTTGTTGG - Intergenic
1028474066 7:91234616-91234638 AGAAAATGAGATGCCCTGGGGGG - Intergenic
1029375416 7:100174368-100174390 AGTCATTGAGGGATCCTGGGGGG + Intronic
1031235460 7:119169457-119169479 AGTAAGTGAGAGACCCTCAGTGG - Intergenic
1033545388 7:142394813-142394835 AGGACGTGTGATATCCTGGGGGG - Intergenic
1033784159 7:144710151-144710173 AGTAAGTAAAATATGCTGGGAGG - Intronic
1036275637 8:7349132-7349154 TGGAAGTGAGATTTCCTGGAAGG + Intergenic
1036368967 8:8146538-8146560 AGGATGTGATAGATCCTGGGAGG + Intergenic
1036881925 8:12519104-12519126 AGGATGTGATAGATCCTGGGAGG - Intergenic
1038758106 8:30360665-30360687 AGTCAATGAGATACCCTGGTCGG + Intergenic
1048543934 8:135368460-135368482 AGGAATTGAGAAGTCCTGGGAGG - Intergenic
1053542173 9:38985528-38985550 AATAAGTGAAATAGCTTGGGAGG + Intergenic
1053806630 9:41809046-41809068 AATAAGTGAAATAGCTTGGGAGG + Intergenic
1054623967 9:67378383-67378405 AATAAGTGAAATAGCTTGGGAGG - Intergenic
1055610786 9:78021923-78021945 AGGAAGGGCGATATCCTGGGAGG - Intronic
1058910227 9:109514121-109514143 AGGATGTGAGAAATACTGGGGGG - Intergenic
1061433867 9:130548258-130548280 AGTGAGTGACATTACCTGGGAGG + Intergenic
1186716977 X:12262729-12262751 AGGAAGTGAGTTATTCTGGCCGG + Intronic
1189648207 X:43157810-43157832 AGTGTGAGAGATGTCCTGGGGGG + Intergenic
1192849865 X:74943091-74943113 AGTGAGTGAGATACCCCTGGGGG - Intergenic
1193969897 X:88038700-88038722 AGTAAGTGAGAGATCCCCAGAGG + Intergenic
1196198448 X:112859273-112859295 ACTAAGTGAGACAAACTGGGTGG + Intergenic
1200230688 X:154442465-154442487 AGTCAGACAGGTATCCTGGGCGG - Intronic