ID: 921032541

View in Genome Browser
Species Human (GRCh38)
Location 1:211345964-211345986
Sequence GAGCTAAGCAGAGCAAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921032539_921032541 -7 Left 921032539 1:211345948-211345970 CCTACCTCATGCTGCAGAGCTAA 0: 1
1: 0
2: 0
3: 18
4: 179
Right 921032541 1:211345964-211345986 GAGCTAAGCAGAGCAAGAGTAGG 0: 1
1: 0
2: 1
3: 15
4: 204
921032537_921032541 25 Left 921032537 1:211345916-211345938 CCTGGAAAACAGTTTGCGGCATC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 921032541 1:211345964-211345986 GAGCTAAGCAGAGCAAGAGTAGG 0: 1
1: 0
2: 1
3: 15
4: 204
921032538_921032541 -6 Left 921032538 1:211345947-211345969 CCCTACCTCATGCTGCAGAGCTA 0: 1
1: 0
2: 0
3: 9
4: 179
Right 921032541 1:211345964-211345986 GAGCTAAGCAGAGCAAGAGTAGG 0: 1
1: 0
2: 1
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921032541 Original CRISPR GAGCTAAGCAGAGCAAGAGT AGG Intronic
900938163 1:5780209-5780231 CAGGAAAGCAGAGCCAGAGTTGG + Intergenic
901445641 1:9306316-9306338 GAGCACAGCAGAGCTGGAGTGGG + Intronic
901689380 1:10962684-10962706 GAACTAAGCAGAGAGAGATTAGG - Intronic
902821290 1:18944913-18944935 GAGCCAAGAAGAGCATGAGGAGG + Intronic
903010761 1:20328515-20328537 GATCTAAGAAGAGGAAGAGAGGG + Intronic
903682238 1:25104721-25104743 GAGCCAAGGAGAGCCAGAGCAGG + Intergenic
904537183 1:31207599-31207621 GGGCAAAGAAGAACAAGAGTGGG - Intronic
905381800 1:37567323-37567345 GAGCTGTTCAGAGCTAGAGTGGG - Intronic
906110150 1:43317276-43317298 GAGCTACCCAGTGCTAGAGTGGG + Exonic
906246907 1:44282752-44282774 GAGGTAAGCTGAGCAAGTCTGGG - Intronic
911350837 1:96752987-96753009 GAGCTGAAGAGACCAAGAGTGGG + Intronic
912271156 1:108210082-108210104 GAGATAGGCAGAGCAAGAGATGG - Intergenic
915593236 1:156882334-156882356 GAGCTAAGAAGAGTAACAGAGGG - Intergenic
917425203 1:174905989-174906011 GAGCTAAGCAGAACAAGGAAGGG + Intronic
921032541 1:211345964-211345986 GAGCTAAGCAGAGCAAGAGTAGG + Intronic
1068851839 10:61751171-61751193 GAGCGAAGCAAAGCAAGGGGTGG - Intronic
1069909289 10:71749883-71749905 CAGCTCAGCAGAGCCAGTGTAGG + Exonic
1071018753 10:81028134-81028156 AATCTATGCAGAGGAAGAGTGGG - Intergenic
1072415188 10:95241412-95241434 GAGGTAAGCATGGCAAGAGAGGG - Intronic
1073155779 10:101345367-101345389 GAGCTAAGGAGATCAAGACCAGG - Intergenic
1074560860 10:114534169-114534191 GAGGTAAGCAGAGCCAGGGATGG + Intronic
1075861647 10:125682305-125682327 GACATCAGAAGAGCAAGAGTTGG + Intronic
1078460002 11:11507468-11507490 GATTAAAGCAGAGGAAGAGTAGG - Intronic
1081416049 11:42817489-42817511 GAGTTTAGAAGAGGAAGAGTTGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082772003 11:57214985-57215007 GATCTAGGCAGAGGAAGAGGAGG - Intergenic
1082948662 11:58787943-58787965 GATCTATGCACAGAAAGAGTTGG - Intergenic
1082966127 11:58967691-58967713 AAGCTATGAAGAGCAAGAGGTGG - Intronic
1086025873 11:82290462-82290484 GAGCTTAGAAGGGCAGGAGTAGG - Intergenic
1086048497 11:82561190-82561212 GAGCATAGCTAAGCAAGAGTGGG - Intergenic
1086746319 11:90432031-90432053 GAGATAATCAGAGAAAGAGAAGG - Intergenic
1087800613 11:102499322-102499344 GAGACAAGCAGAGCAAGCTTGGG + Intergenic
1089014993 11:115158261-115158283 GAGGGAAGCAGTGCAAGAGTGGG + Intergenic
1090178237 11:124671000-124671022 GAGCTAAGTAGAGAGAGGGTGGG + Intronic
1091036955 11:132243440-132243462 GAATTATTCAGAGCAAGAGTAGG - Intronic
1092357691 12:7810227-7810249 GAGAAAAGCAGGGAAAGAGTAGG - Intergenic
1092886022 12:12925051-12925073 GAAGTGAGCAGATCAAGAGTTGG - Intergenic
1097770838 12:63582867-63582889 GAGCTAGGGAGAGCAGGAGGTGG + Intronic
1098188246 12:67921318-67921340 GGGCTAGGAAGAGCAAGAGATGG + Intergenic
1098488010 12:71044368-71044390 GAATTAAGCAGAGAAGGAGTGGG - Intergenic
1099320171 12:81136926-81136948 GTGCTTATCAGAGCAAGAGATGG + Intronic
1100170286 12:91968104-91968126 GGGCTAAGCAGAGAAATAGTTGG + Intergenic
1101877971 12:108607980-108608002 GAGGTAAACAGAGCAGGGGTGGG + Intergenic
1101959026 12:109234168-109234190 GAGGCGAGCAGAGCTAGAGTGGG - Intronic
1103296863 12:119895071-119895093 GAGTTAACCAGGGAAAGAGTGGG + Intergenic
1103637812 12:122322563-122322585 GAGCAAATCAGAGCAAGAACTGG - Intronic
1105686582 13:22789179-22789201 GAGCTAAGGAGATCAAGACTTGG - Intergenic
1108108716 13:47043815-47043837 GACCTGAGAAGGGCAAGAGTAGG - Intergenic
1108744817 13:53382065-53382087 CAGCTAGGAAGAGAAAGAGTTGG - Intergenic
1112051585 13:95648608-95648630 GTGCTAAGCAGCGAAGGAGTTGG - Intergenic
1113114427 13:106859887-106859909 GAGCAAAGCAGTGGAAGAGATGG - Intergenic
1117580682 14:57148675-57148697 GCGCTAAGAAAAGCAAAAGTTGG + Intergenic
1121304714 14:92898860-92898882 GAGCGAAGCTGAGCAACAGAGGG - Intergenic
1122828270 14:104382862-104382884 GAGCTGAGCAGAGCAGGTGCCGG + Intergenic
1123084302 14:105710519-105710541 GACCTAAGCTGAGCCAGACTGGG - Intergenic
1123725921 15:23101399-23101421 GAGGAGAGCAGAGCAGGAGTTGG + Intergenic
1127209582 15:56759367-56759389 TAGCTAAGCAGAGCAAAGGAAGG - Intronic
1127960808 15:63888913-63888935 GATGTATGCAGAGCCAGAGTGGG + Intergenic
1129682139 15:77663924-77663946 GGGCTAAGCAGGGCAAGCCTGGG + Intronic
1130030955 15:80313165-80313187 GAGGGAAGCAGGGCAAGAGATGG + Intergenic
1132594032 16:740231-740253 GAGCTGAGCAGGGCGAGAGGCGG - Intronic
1133739143 16:8638689-8638711 CAGCTATTGAGAGCAAGAGTTGG - Intronic
1136507146 16:30711953-30711975 GAGCCAAGCAGATGAAGAGGAGG + Exonic
1137402094 16:48162233-48162255 GAGGAAACCAGAGCCAGAGTGGG + Intergenic
1137651860 16:50127395-50127417 GAGGTACGCAAAGCAAGTGTTGG - Intergenic
1137718740 16:50614691-50614713 GAGCTAAGGAGAGACTGAGTTGG - Intronic
1138911114 16:61400011-61400033 GAGCTTGGCAGATCAATAGTTGG - Intergenic
1139063327 16:63282370-63282392 GAGCGAAGCAGAGGATGTGTGGG - Intergenic
1143410310 17:6704533-6704555 GGGCTAAGCAGAGTAGGGGTAGG + Intronic
1144049773 17:11488619-11488641 GAACAAAGCAGAACAAGAGATGG - Intronic
1146032112 17:29374998-29375020 GAGCCCAGTAGAGCAAGAGATGG - Intergenic
1147135294 17:38430500-38430522 GAGCAGAGCAGTGCAGGAGTGGG + Intronic
1150885987 17:69086291-69086313 GAGCTGAGCAGCGCCAGATTAGG - Intronic
1153716413 18:7853932-7853954 GAGCTAATGAGAGCAGGTGTTGG + Intronic
1154406551 18:14096983-14097005 TATATAAGCAGAGAAAGAGTTGG - Intronic
1155419459 18:25639154-25639176 GAGCGTAGCAGAACAATAGTGGG - Intergenic
1156447505 18:37248520-37248542 GAAGTCAGCAGAGCAAGAGTGGG - Intronic
1156929062 18:42618821-42618843 GAGGTAAGCACAACAATAGTAGG + Intergenic
1157940336 18:51921669-51921691 GATCTATGCAGAGGAAGGGTGGG - Intergenic
1158919009 18:62168417-62168439 GAGCAAAGCAGAGAAAGAGTGGG - Intronic
1161115192 19:2492908-2492930 GAGCTAAGAAGAGAAATAGAGGG + Intergenic
1162304967 19:9866801-9866823 GAGCTCAGCAAAGAGAGAGTGGG - Intronic
1163944231 19:20521124-20521146 GAGTTAAGGAGAGCTAGTGTGGG + Intergenic
1164544096 19:29144798-29144820 GGGCTCAGCAGAGCCAGAGAAGG - Intergenic
1165154333 19:33778080-33778102 GAGCTGTGCAGCGCAGGAGTTGG + Intergenic
1165218106 19:34291566-34291588 GAGCTCAAGAGAGCAAGAGATGG + Intronic
1166189290 19:41165098-41165120 AAGCTAAACAGAGCAACTGTGGG + Intergenic
1167326101 19:48826813-48826835 GAACTCAGGGGAGCAAGAGTAGG - Intronic
1168121388 19:54254228-54254250 GAGCTGGGCAGAGCCAGAGGAGG - Intronic
1168124899 19:54277753-54277775 GAGCTGGGCAGAGCCAGAGGAGG - Intronic
1168510033 19:56966811-56966833 GGGCTCAGCAGGGCAAGGGTGGG + Intergenic
926710454 2:15875419-15875441 GAGCCCAGAAGAGCAAGAGCCGG + Intergenic
928393312 2:30925780-30925802 GTTCTAAGCAGGGCAAGAGGTGG + Intronic
937368172 2:121280225-121280247 GAGCTAGGAAGTGCCAGAGTTGG + Intronic
939878475 2:147603828-147603850 AAGAAAAGCAGAGCAAGAATTGG - Intergenic
940849992 2:158678938-158678960 GAGCTTAACAGAAAAAGAGTGGG - Intronic
941515153 2:166464377-166464399 CAGCTAAGCAAAGCAACAGGAGG + Intronic
943565035 2:189507122-189507144 GAGCTCAGCAGCCCAGGAGTAGG - Intergenic
946093964 2:217256060-217256082 GAGTTTAGCAGAGGCAGAGTGGG - Intergenic
947930203 2:233958695-233958717 GAGCTCAGCAGGGGAAGAGGGGG - Intronic
947938511 2:234027660-234027682 AGGCTAAGCAGAGAAAGAGAGGG - Intergenic
948929671 2:241123970-241123992 GAGCTCAGCAGCGGTAGAGTGGG + Exonic
1168856501 20:1012893-1012915 GAGGGAAGCAGGGCAGGAGTGGG + Intergenic
1173629548 20:44501110-44501132 AAGCCAAGCAGAGCATGAGGTGG + Exonic
1174861128 20:54092325-54092347 CAGCTCATCAGAGTAAGAGTTGG + Intergenic
1175622608 20:60462340-60462362 AAGCAAAGCATAGCAAGTGTTGG + Intergenic
1176108306 20:63399718-63399740 GAGATGAGCAGAGGAAGATTTGG + Intergenic
1176387963 21:6148673-6148695 GAGCTCAGCAGAGCAAGAAGAGG - Intergenic
1177100877 21:16896022-16896044 GAGTTAGGGAGAGCTAGAGTGGG - Intergenic
1177471828 21:21569816-21569838 GACCTAAGCCTAGCAAGAGAGGG + Intergenic
1179011184 21:37557534-37557556 CAGCTAAGCACAGCAAGTTTCGG + Intergenic
1179095746 21:38313217-38313239 CAGCAAAGCAAAGCAAGTGTGGG - Intergenic
1179735509 21:43389575-43389597 GAGCTCAGCAGAGCAAGAAGAGG + Intergenic
1180745941 22:18089057-18089079 GAGCGTAACAGAGCAAGACTTGG - Exonic
1181099629 22:20530686-20530708 GAGCAGAGCAGAGCGGGAGTTGG + Intronic
1181481741 22:23204247-23204269 GGGCAACGCAGAGCAAGAGGAGG - Intronic
1181804413 22:25366352-25366374 GAGCTAAAAACAGCAGGAGTGGG - Intronic
1182838211 22:33361763-33361785 GAGCCTAACAGAGCAAGAGGAGG - Intronic
1183687034 22:39367110-39367132 GAACGAAGCAGGGCAAGAGGAGG - Intronic
1184606319 22:45576698-45576720 GAGCTAATCAGAGGAAGGGCTGG - Intronic
949806109 3:7957719-7957741 CAGCTCAGCAGAGGAAGAGGGGG - Intergenic
950531973 3:13557506-13557528 GAGAACAGCAGAGCAAGAGATGG - Intronic
953016482 3:39081775-39081797 CAGTTAACCAGACCAAGAGTGGG - Intronic
954283651 3:49602392-49602414 GAGCAAGGCAGAGCAAGGATTGG - Intronic
954596676 3:51830908-51830930 TAGAGAAGCAGAGAAAGAGTGGG - Intergenic
954625939 3:52021921-52021943 GAGCCAAGCAGAGCTAGAGAGGG - Intergenic
956029015 3:65016474-65016496 AATCTAAGCAGAGAAAGAGAGGG - Intergenic
956593950 3:70946295-70946317 CAGCTAAGCAGAGCGAGCGGGGG - Intergenic
956778839 3:72588543-72588565 GAGCTAAGCCGAGCTAGTCTCGG - Intergenic
958677496 3:97285380-97285402 GAGCAAAGGATAGGAAGAGTGGG - Intronic
959568035 3:107852782-107852804 TAGGTAAGCAAAGCTAGAGTAGG + Intergenic
960581125 3:119279642-119279664 GTGCGAAACAGAGCAAGAGGGGG + Intergenic
960589893 3:119355175-119355197 GAGCTAGGAAGTGCCAGAGTTGG - Intronic
961032726 3:123620491-123620513 GTGCTGAGCAGAGCAAGGTTGGG - Intronic
961074956 3:123973599-123973621 GGGCTAAGCAGAGGGAGGGTTGG + Intronic
961177419 3:124847240-124847262 GAGATGAGGAAAGCAAGAGTTGG + Intronic
961308728 3:125978888-125978910 GGGCTAAGCAGAGGGAGGGTTGG - Intronic
972995044 4:44869693-44869715 GAGCTTAACAGAGTCAGAGTAGG + Intergenic
973808168 4:54545406-54545428 GAGGTAGGCAGAGCAAGTCTTGG + Intergenic
976571466 4:86616664-86616686 GAGCAAGGGAGAGAAAGAGTGGG - Intronic
976897236 4:90127501-90127523 GAGAAGAGCAGAGCAAGAGGAGG - Intergenic
981116653 4:140998609-140998631 GAGATAAGCTGAGCTAAAGTGGG + Intronic
984408347 4:179363923-179363945 GAGTTAAGCACAGCTAGAGCTGG - Intergenic
984814796 4:183826097-183826119 TAGCTCAGCAGACCAGGAGTGGG + Intergenic
985917756 5:2937548-2937570 GAGCTCAGGAGATCAAGACTAGG + Intergenic
986680860 5:10231632-10231654 GAGCAAAGCAAAGCAAGGGCGGG - Intronic
989236727 5:39156437-39156459 GAGGGAAGCAGGGCAAGAGATGG + Intronic
991997718 5:72404526-72404548 GAGAACAACAGAGCAAGAGTGGG - Intergenic
992484461 5:77181215-77181237 GAGCAAAGCAAAGGAAGAGCTGG + Intergenic
992733446 5:79694995-79695017 GAGTTAAACTCAGCAAGAGTTGG + Intronic
994753049 5:103763118-103763140 GAGCTAATCAGAGCATTTGTAGG + Intergenic
994820260 5:104640811-104640833 TAGCTAAGCAGAGCAATTCTAGG + Intergenic
999136472 5:149323304-149323326 GTGCTAGGCAGAGCTAGGGTGGG - Intronic
1001080658 5:168664966-168664988 GAGCAAGGCAGAACAAGAGCAGG + Intronic
1001980877 5:176036279-176036301 TAGCTTAGCAGATCAAGAGAAGG - Intergenic
1002236585 5:177807786-177807808 CAGCTCAGCAGATCAAGAGAAGG + Intergenic
1002391095 5:178912386-178912408 GAGGTAAGGACAGGAAGAGTAGG - Intronic
1003117859 6:3295287-3295309 GAGCTGGGCAAGGCAAGAGTGGG + Intronic
1003268844 6:4589886-4589908 GAGATAAGAAGAGTAAGAGTGGG - Intergenic
1003975609 6:11340940-11340962 GAGCTAAGGACAGAGAGAGTAGG - Intronic
1006587296 6:35124220-35124242 TAACTAACTAGAGCAAGAGTAGG + Intronic
1006887974 6:37398081-37398103 GGGGTCAGCAGAGTAAGAGTGGG + Intergenic
1007346579 6:41235965-41235987 GAGCTAGGCAGGCCAGGAGTGGG + Intronic
1007501630 6:42302759-42302781 GAGCTAAGCATGGCACGGGTGGG + Intronic
1009892980 6:69711316-69711338 GAGCTCAGGGGAGCAAGAGAGGG + Intronic
1012226526 6:96710040-96710062 GTGCTAAGCAGACCAAAATTGGG + Intergenic
1012586960 6:100935044-100935066 GGGCTGAGCAGAGGAAGAGAAGG - Intergenic
1013286462 6:108686289-108686311 GAGGAAAGCAGAGCTGGAGTGGG - Intergenic
1015028040 6:128560976-128560998 GGGGTAAGCAGAGCAAGAACAGG - Intergenic
1015269420 6:131324236-131324258 GAGACAAGGAGAGAAAGAGTTGG - Intergenic
1016972845 6:149780511-149780533 GACCTGAGCAGAGCAGGGGTTGG - Intronic
1021351824 7:19602953-19602975 GATCTATGCACAGGAAGAGTGGG + Intergenic
1021702723 7:23335805-23335827 TAGTGAAGCAGAGCAAGAGCTGG - Intronic
1022033959 7:26516757-26516779 GAGGTAACAAGAGCAGGAGTCGG - Intergenic
1022930320 7:35105098-35105120 GAGCTAGGGAGAGCAGGAGGTGG + Intergenic
1023199667 7:37682605-37682627 GAGCGGAGCAGTGCACGAGTGGG + Intergenic
1024709085 7:51995493-51995515 GAGCTTGGCAGAGTCAGAGTAGG + Intergenic
1025009449 7:55384174-55384196 AAGGGAAGCAGAGGAAGAGTGGG + Intronic
1026583865 7:71639995-71640017 GTGCAAAACAAAGCAAGAGTGGG + Intronic
1026635152 7:72075658-72075680 GAGCTGAGCAGGGCCAGGGTTGG - Intronic
1027396867 7:77765791-77765813 GAGGGAAGGAGAGCAAGAGATGG + Intronic
1028185872 7:87784970-87784992 GAGCTTGGCAGAGTCAGAGTAGG + Intronic
1028551107 7:92067279-92067301 CATCTAAGCAGAGACAGAGTAGG - Intronic
1030278462 7:107744398-107744420 GAGCTCAGCAGAACCAGAGTAGG - Intronic
1032490067 7:132317911-132317933 GAGCCAGGCAGAGCAAGGGTCGG + Intronic
1032785033 7:135194014-135194036 GTGCTGGGCAGACCAAGAGTGGG - Intronic
1034408238 7:150920791-150920813 GAGTAAAGCAGAGCCAAAGTTGG + Intergenic
1035610940 8:963662-963684 CACCGAGGCAGAGCAAGAGTAGG - Intergenic
1038171622 8:25139845-25139867 GAGCAAAGCAGAGCTTGAGAGGG + Intergenic
1038426997 8:27470105-27470127 GAGCTGAGCACAGCATGAGCAGG + Intronic
1040001381 8:42579373-42579395 GAGCAAAACAGAGCAAGAGCTGG - Intergenic
1043664321 8:82789094-82789116 GAGTTAAGCAGACCCGGAGTAGG + Intergenic
1044488548 8:92783692-92783714 GTGCCAAGCAGCCCAAGAGTTGG + Intergenic
1047051005 8:121113471-121113493 TAGCTTAGCAAAGTAAGAGTTGG + Intergenic
1047054699 8:121151109-121151131 GAGCTATGCAGAGCTAGGGCAGG - Intergenic
1047138000 8:122103336-122103358 GAGCAAAGCAAGGAAAGAGTGGG - Intergenic
1047262020 8:123272568-123272590 GAGCGAAGGTGAGCAGGAGTTGG - Intronic
1048351590 8:133620932-133620954 GAGCTGAGCAAGGCCAGAGTGGG + Intergenic
1048817754 8:138349775-138349797 GAGCAAAGCAGAGCCAGAAATGG + Intronic
1048859642 8:138714562-138714584 GGACTAGGAAGAGCAAGAGTGGG - Intronic
1049084861 8:140470737-140470759 GAGCTAGGCAGAGCTGGAGCAGG - Intergenic
1051161672 9:14215138-14215160 GTGCTTAGCAGAGCAAGAAATGG + Intronic
1052752068 9:32502019-32502041 GGGCTAAGGAGAGGGAGAGTAGG - Intronic
1056252675 9:84766251-84766273 GATCTAGACAGAGGAAGAGTGGG + Intronic
1058727188 9:107815384-107815406 GAGCTAATCAAAGGAGGAGTGGG - Intergenic
1060418333 9:123449080-123449102 GAGCCTAGCAGAGCCAGAATTGG - Intronic
1060945984 9:127569404-127569426 TACCTAAGCAGAGAAAGAGACGG + Intronic
1061204123 9:129153188-129153210 GAGCCAAGCAGAGGAGCAGTGGG + Intergenic
1061683688 9:132258077-132258099 GAGCTTAACAGAAAAAGAGTGGG + Intergenic
1187886199 X:23891125-23891147 GAGCTATGCAGAGGAAGAGAAGG - Intronic
1189301496 X:39955770-39955792 GCACCAAGCAGAGCAAGAGAAGG - Intergenic
1190291217 X:48993576-48993598 GAGCTGAACAGAGGAAGAGAAGG + Exonic
1192175591 X:68883105-68883127 CAGCTAAGCAGAGGTAGAGATGG + Intergenic
1194293779 X:92104762-92104784 CAGAAAAGCAGAGAAAGAGTTGG + Intronic
1195903700 X:109824120-109824142 GAGCTAAGCAGAGCAAGGAGAGG - Intergenic
1198222765 X:134617938-134617960 GAGGTAAGCAGAGCAGGTGCTGG - Intronic
1198594506 X:138221929-138221951 GTGCTAACCAAAGCTAGAGTCGG + Intergenic
1200153611 X:153963716-153963738 GGGCTCCGCAGAGCAAGAGGGGG + Intronic
1200164280 X:154025421-154025443 GAGGCGAGCAGAGCAGGAGTGGG + Intronic
1201061501 Y:10050705-10050727 GAGCTAAGGAGAGCTAGTGTGGG + Intergenic
1201422353 Y:13813361-13813383 GAGCTATGAAGAGCAAAAGCGGG - Intergenic