ID: 921032667

View in Genome Browser
Species Human (GRCh38)
Location 1:211347339-211347361
Sequence TTCTGAAGCTTCCTCAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921032667_921032672 1 Left 921032667 1:211347339-211347361 CCAGGCTTGAGGAAGCTTCAGAA 0: 1
1: 0
2: 2
3: 15
4: 222
Right 921032672 1:211347363-211347385 GAGACGGATCCTGCCCTGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 136
921032667_921032671 -2 Left 921032667 1:211347339-211347361 CCAGGCTTGAGGAAGCTTCAGAA 0: 1
1: 0
2: 2
3: 15
4: 222
Right 921032671 1:211347360-211347382 AAGGAGACGGATCCTGCCCTGGG 0: 1
1: 0
2: 2
3: 19
4: 163
921032667_921032670 -3 Left 921032667 1:211347339-211347361 CCAGGCTTGAGGAAGCTTCAGAA 0: 1
1: 0
2: 2
3: 15
4: 222
Right 921032670 1:211347359-211347381 GAAGGAGACGGATCCTGCCCTGG 0: 1
1: 1
2: 0
3: 13
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921032667 Original CRISPR TTCTGAAGCTTCCTCAAGCC TGG (reversed) Intronic