ID: 921032670

View in Genome Browser
Species Human (GRCh38)
Location 1:211347359-211347381
Sequence GAAGGAGACGGATCCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921032667_921032670 -3 Left 921032667 1:211347339-211347361 CCAGGCTTGAGGAAGCTTCAGAA 0: 1
1: 0
2: 2
3: 15
4: 222
Right 921032670 1:211347359-211347381 GAAGGAGACGGATCCTGCCCTGG 0: 1
1: 1
2: 0
3: 13
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921032670 Original CRISPR GAAGGAGACGGATCCTGCCC TGG Intronic