ID: 921032671

View in Genome Browser
Species Human (GRCh38)
Location 1:211347360-211347382
Sequence AAGGAGACGGATCCTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921032667_921032671 -2 Left 921032667 1:211347339-211347361 CCAGGCTTGAGGAAGCTTCAGAA 0: 1
1: 0
2: 2
3: 15
4: 222
Right 921032671 1:211347360-211347382 AAGGAGACGGATCCTGCCCTGGG 0: 1
1: 0
2: 2
3: 19
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921032671 Original CRISPR AAGGAGACGGATCCTGCCCT GGG Intronic