ID: 921032672

View in Genome Browser
Species Human (GRCh38)
Location 1:211347363-211347385
Sequence GAGACGGATCCTGCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921032667_921032672 1 Left 921032667 1:211347339-211347361 CCAGGCTTGAGGAAGCTTCAGAA 0: 1
1: 0
2: 2
3: 15
4: 222
Right 921032672 1:211347363-211347385 GAGACGGATCCTGCCCTGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921032672 Original CRISPR GAGACGGATCCTGCCCTGGG AGG Intronic