ID: 921037145

View in Genome Browser
Species Human (GRCh38)
Location 1:211391474-211391496
Sequence TGTTGTGAAGGGCTTTCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921037145_921037149 11 Left 921037145 1:211391474-211391496 CCATAGGAAAGCCCTTCACAACA No data
Right 921037149 1:211391508-211391530 AGCCCAAAATGTTAGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921037145 Original CRISPR TGTTGTGAAGGGCTTTCCTA TGG (reversed) Intergenic
No off target data available for this crispr