ID: 921037149

View in Genome Browser
Species Human (GRCh38)
Location 1:211391508-211391530
Sequence AGCCCAAAATGTTAGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921037145_921037149 11 Left 921037145 1:211391474-211391496 CCATAGGAAAGCCCTTCACAACA No data
Right 921037149 1:211391508-211391530 AGCCCAAAATGTTAGTGCTGAGG No data
921037147_921037149 -1 Left 921037147 1:211391486-211391508 CCTTCACAACAAAGAATAATCCA No data
Right 921037149 1:211391508-211391530 AGCCCAAAATGTTAGTGCTGAGG No data
921037146_921037149 0 Left 921037146 1:211391485-211391507 CCCTTCACAACAAAGAATAATCC No data
Right 921037149 1:211391508-211391530 AGCCCAAAATGTTAGTGCTGAGG No data
921037144_921037149 19 Left 921037144 1:211391466-211391488 CCTAAAATCCATAGGAAAGCCCT No data
Right 921037149 1:211391508-211391530 AGCCCAAAATGTTAGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921037149 Original CRISPR AGCCCAAAATGTTAGTGCTG AGG Intergenic
No off target data available for this crispr