ID: 921042418

View in Genome Browser
Species Human (GRCh38)
Location 1:211446730-211446752
Sequence GAAAATACTGGTAGTGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921042418_921042420 -2 Left 921042418 1:211446730-211446752 CCAGTATCACTACCAGTATTTTC No data
Right 921042420 1:211446751-211446773 TCAGAAAAGTCATTAAGTATTGG No data
921042418_921042421 30 Left 921042418 1:211446730-211446752 CCAGTATCACTACCAGTATTTTC No data
Right 921042421 1:211446783-211446805 AAACTCATGATGTAAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921042418 Original CRISPR GAAAATACTGGTAGTGATAC TGG (reversed) Intergenic
No off target data available for this crispr