ID: 921042715

View in Genome Browser
Species Human (GRCh38)
Location 1:211448925-211448947
Sequence CAGAACAAAGAGAAATACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921042714_921042715 -7 Left 921042714 1:211448909-211448931 CCAGCTTTAGGTGGCTCAGAACA 0: 60
1: 127
2: 151
3: 169
4: 317
Right 921042715 1:211448925-211448947 CAGAACAAAGAGAAATACTCTGG No data
921042709_921042715 21 Left 921042709 1:211448881-211448903 CCACAGGGATGCTTGTGTCACTC 0: 8
1: 98
2: 272
3: 334
4: 568
Right 921042715 1:211448925-211448947 CAGAACAAAGAGAAATACTCTGG No data
921042712_921042715 -1 Left 921042712 1:211448903-211448925 CCATGCCCAGCTTTAGGTGGCTC No data
Right 921042715 1:211448925-211448947 CAGAACAAAGAGAAATACTCTGG No data
921042713_921042715 -6 Left 921042713 1:211448908-211448930 CCCAGCTTTAGGTGGCTCAGAAC 0: 52
1: 123
2: 140
3: 177
4: 277
Right 921042715 1:211448925-211448947 CAGAACAAAGAGAAATACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921042715 Original CRISPR CAGAACAAAGAGAAATACTC TGG Intergenic
No off target data available for this crispr