ID: 921042715 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:211448925-211448947 |
Sequence | CAGAACAAAGAGAAATACTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
921042714_921042715 | -7 | Left | 921042714 | 1:211448909-211448931 | CCAGCTTTAGGTGGCTCAGAACA | 0: 60 1: 127 2: 151 3: 169 4: 317 |
||
Right | 921042715 | 1:211448925-211448947 | CAGAACAAAGAGAAATACTCTGG | No data | ||||
921042709_921042715 | 21 | Left | 921042709 | 1:211448881-211448903 | CCACAGGGATGCTTGTGTCACTC | 0: 8 1: 98 2: 272 3: 334 4: 568 |
||
Right | 921042715 | 1:211448925-211448947 | CAGAACAAAGAGAAATACTCTGG | No data | ||||
921042712_921042715 | -1 | Left | 921042712 | 1:211448903-211448925 | CCATGCCCAGCTTTAGGTGGCTC | No data | ||
Right | 921042715 | 1:211448925-211448947 | CAGAACAAAGAGAAATACTCTGG | No data | ||||
921042713_921042715 | -6 | Left | 921042713 | 1:211448908-211448930 | CCCAGCTTTAGGTGGCTCAGAAC | 0: 52 1: 123 2: 140 3: 177 4: 277 |
||
Right | 921042715 | 1:211448925-211448947 | CAGAACAAAGAGAAATACTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
921042715 | Original CRISPR | CAGAACAAAGAGAAATACTC TGG | Intergenic | ||
No off target data available for this crispr |