ID: 921046539

View in Genome Browser
Species Human (GRCh38)
Location 1:211481769-211481791
Sequence AGCTGGAAACACATGGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921046533_921046539 3 Left 921046533 1:211481743-211481765 CCTGAATCCTCACTAACTCCCAA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 921046539 1:211481769-211481791 AGCTGGAAACACATGGACTATGG 0: 1
1: 0
2: 1
3: 8
4: 181
921046530_921046539 19 Left 921046530 1:211481727-211481749 CCCAGAGAAAGGGCCTCCTGAAT 0: 1
1: 0
2: 0
3: 15
4: 176
Right 921046539 1:211481769-211481791 AGCTGGAAACACATGGACTATGG 0: 1
1: 0
2: 1
3: 8
4: 181
921046534_921046539 -4 Left 921046534 1:211481750-211481772 CCTCACTAACTCCCAACAAAGCT 0: 1
1: 0
2: 1
3: 10
4: 131
Right 921046539 1:211481769-211481791 AGCTGGAAACACATGGACTATGG 0: 1
1: 0
2: 1
3: 8
4: 181
921046531_921046539 18 Left 921046531 1:211481728-211481750 CCAGAGAAAGGGCCTCCTGAATC 0: 1
1: 0
2: 0
3: 16
4: 133
Right 921046539 1:211481769-211481791 AGCTGGAAACACATGGACTATGG 0: 1
1: 0
2: 1
3: 8
4: 181
921046532_921046539 6 Left 921046532 1:211481740-211481762 CCTCCTGAATCCTCACTAACTCC 0: 1
1: 0
2: 1
3: 16
4: 184
Right 921046539 1:211481769-211481791 AGCTGGAAACACATGGACTATGG 0: 1
1: 0
2: 1
3: 8
4: 181
921046527_921046539 30 Left 921046527 1:211481716-211481738 CCAGGATTGTGCCCAGAGAAAGG 0: 1
1: 0
2: 2
3: 20
4: 161
Right 921046539 1:211481769-211481791 AGCTGGAAACACATGGACTATGG 0: 1
1: 0
2: 1
3: 8
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921046539 Original CRISPR AGCTGGAAACACATGGACTA TGG Intronic
900648272 1:3718682-3718704 AGTTGGACACAGATGGAGTAAGG - Intronic
903809240 1:26025557-26025579 AGGTGGAAAAACATGGGCTTTGG - Intronic
904743336 1:32695390-32695412 AGCTGGAGAGAGATGGCCTAAGG - Exonic
904890720 1:33777437-33777459 TGCTGGAAACACAGAGACCACGG + Intronic
905024742 1:34842132-34842154 AGGTGGAAAACCATGGACTTTGG - Intronic
905820558 1:40986966-40986988 AACTGGAAACATATGGAACAGGG + Intronic
906195156 1:43925703-43925725 ATGTGGAGACACATGGACCAAGG + Intronic
906618074 1:47248831-47248853 AACTGGAAATAAATGGACTTTGG - Intergenic
908091253 1:60687493-60687515 AGCTGGAAACTCTAGGACTGGGG - Intergenic
909062126 1:70891192-70891214 TGCTGGAAGCTCATGGTCTAAGG - Intronic
911482718 1:98464491-98464513 ACCTGGAAACAGATCCACTAGGG + Intergenic
916142703 1:161713074-161713096 AGCTGGAAGCACCTGAATTATGG - Exonic
916899801 1:169208941-169208963 ATCTAAAAACAGATGGACTATGG - Intronic
917437277 1:175034087-175034109 TGCTGGAAACACAAGGAGGAAGG - Intergenic
920028506 1:203019982-203020004 AGGTGAAAACACATGGAATGGGG + Intronic
921046539 1:211481769-211481791 AGCTGGAAACACATGGACTATGG + Intronic
924611845 1:245580038-245580060 AGCTGGAAAAACATGGCAGAGGG - Intronic
1063709457 10:8463277-8463299 AAATGGAAACACATGGACACAGG + Intergenic
1067436288 10:46281225-46281247 AGCTGGGAACACACTGATTAAGG - Intergenic
1068065031 10:52120249-52120271 AGCTGCCAACACATGAACTTTGG + Intronic
1069928208 10:71865761-71865783 TGCTGGGAACACCTGGACTGTGG - Intergenic
1077858291 11:6151500-6151522 AGCAGAAAGCACATGGACTTTGG - Intergenic
1081041512 11:38220238-38220260 AGATGGAAACGCAAGGACTGTGG - Intergenic
1082082023 11:48019449-48019471 AACAGGCAACACAGGGACTAGGG - Intronic
1083740887 11:64711355-64711377 AGCTGGAAGAACAGGGACGAGGG + Intronic
1084178554 11:67435581-67435603 AGCGGGGTACACATGGACTTGGG + Exonic
1084911037 11:72389462-72389484 AGCTGGTACCACATGGGCTGTGG + Intronic
1088432502 11:109774291-109774313 ATCTGGAAATACGTAGACTATGG - Intergenic
1089322947 11:117639168-117639190 AGCTGGATACACTTGGAGAAAGG + Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1097072987 12:56369205-56369227 AGCTTGTAACACCTGGACTTTGG + Intergenic
1097287227 12:57887692-57887714 ATATGGAAACACTTGGAATAGGG - Intergenic
1097684859 12:62681700-62681722 AGCAGGAAACACATGCTTTATGG + Intronic
1098114910 12:67164827-67164849 AGCTGGAAGCAAATAAACTAAGG - Intergenic
1098467212 12:70801196-70801218 AGTTGGAAACAGATGGAGTTGGG + Intronic
1098774078 12:74589165-74589187 AGCTATAAACACTTGGAATATGG + Intergenic
1099139574 12:78955469-78955491 AGCTGGAAACTCCTGGATCAAGG + Intronic
1099782315 12:87212346-87212368 AGCTGGATACAGATGGAGTAGGG - Intergenic
1100453914 12:94733554-94733576 AGCTGCAAACCCATGGAGCAGGG - Intergenic
1100636094 12:96435988-96436010 AGCTGGAAGTACATGGAGGAAGG + Intergenic
1101193959 12:102363599-102363621 AGCTGGAAACACAAAGAATGGGG - Intergenic
1101235199 12:102781619-102781641 AGATAGAGACAGATGGACTAGGG - Intergenic
1102113259 12:110381254-110381276 AGATGGAAATACATGGAATTGGG - Intronic
1104996933 12:132664115-132664137 AGCTGGACACAGATGGTATATGG - Exonic
1105544011 13:21338865-21338887 AGCAGGAAACAGAGGGACTCCGG + Intergenic
1109290406 13:60467180-60467202 AGCTGAGAACACATGGACACAGG - Intronic
1112204162 13:97307538-97307560 ACCTGGAATCACATGAAATATGG - Intronic
1114949388 14:27729558-27729580 AACTGGAAATACATGGGCTCTGG - Intergenic
1116238248 14:42308966-42308988 AGGGGGAAAAACAGGGACTATGG - Intergenic
1118710358 14:68513672-68513694 AGGGGGAAACACATGGATTTGGG + Intronic
1119771727 14:77224363-77224385 CTCTGGAACCACATGGACTGGGG - Intronic
1120051553 14:79872970-79872992 AGCTAGCAAGATATGGACTAAGG + Intergenic
1120421407 14:84290803-84290825 AACAGGAAACAGATGGACTATGG - Intergenic
1122896883 14:104762585-104762607 AACTGGAGACCCATGGACGAGGG + Intronic
1123980321 15:25596363-25596385 GCCTGGAAACAGATGGTCTATGG - Intergenic
1127337212 15:58000001-58000023 AGCTGAACACACATGGACACAGG + Intronic
1127466408 15:59248768-59248790 AGATGTGAACACATGAACTAAGG - Intronic
1128657065 15:69470162-69470184 AGCCCGAAACCCAGGGACTAAGG - Intergenic
1129142012 15:73607641-73607663 AGCTGGGAAGACTAGGACTACGG - Intronic
1130249557 15:82289383-82289405 AGATGAAAACACATGGACACAGG + Intergenic
1131195025 15:90348804-90348826 AGATGGAAGCACCTGGACTTAGG - Intergenic
1131325938 15:91445241-91445263 GGATGGAACCACATGCACTAAGG + Intergenic
1131958502 15:97763664-97763686 TGCAGTAAACACATGGACCAAGG - Intergenic
1132070760 15:98775104-98775126 GGCTTGATACACATGGACTCAGG - Intronic
1137526404 16:49240202-49240224 AGATGGAACCACATGTACTAAGG - Intergenic
1137904056 16:52300876-52300898 AGTAGGAAACACATTGAATAAGG + Intergenic
1139199069 16:64954320-64954342 AGTGGGAAAGAAATGGACTAAGG + Intronic
1140234860 16:73149514-73149536 AGCTGGTAGCGCATGGACTTTGG - Intergenic
1141203470 16:81914718-81914740 AGCAAGAAACACTTGGAGTAAGG - Intronic
1141604418 16:85144807-85144829 AGCTGGGAGCACAAGGACCAGGG - Intergenic
1146780137 17:35662987-35663009 AGTGGGAAAAACATGGACTGAGG - Intronic
1147636871 17:41969334-41969356 AGATGGAAAAACATGGACCCAGG + Intronic
1152041470 17:77906499-77906521 AGCTGGGAACACAGGGTCTCTGG + Intergenic
1154171959 18:12059134-12059156 AGCTAGAATCACATGGAATGGGG + Intergenic
1160273628 18:77410152-77410174 AGCTGAACCCACCTGGACTAAGG - Intergenic
1160540173 18:79616934-79616956 AGCTGGGAACACAGGGACCGGGG + Intergenic
1161945349 19:7432672-7432694 AACTGGAGACTTATGGACTAGGG + Intronic
1162020124 19:7864512-7864534 GGCTGGAAACACATGAAGAAAGG - Intronic
1162725567 19:12688175-12688197 AGGTGGGAACACATGGGCCAGGG + Intronic
1163708322 19:18830756-18830778 AACTGGAAGCACATGGTCTGTGG - Intergenic
1166848410 19:45744933-45744955 GGATGTTAACACATGGACTAGGG + Intronic
925775107 2:7327631-7327653 AGCAGGAAAAACATGGATTCTGG + Intergenic
931082799 2:58794481-58794503 AATTGGAAACACATGGTCAAGGG - Intergenic
931977335 2:67657109-67657131 AGCTGGAAACACATGGGAAGAGG + Intergenic
932874678 2:75438642-75438664 AACTGAAAACAAATGAACTATGG + Intergenic
933353283 2:81183121-81183143 ATCTGGAAACACATGCATTAAGG + Intergenic
934979133 2:98825907-98825929 AGCTGGAGACAGTTGGGCTAGGG - Intronic
936745718 2:115574153-115574175 AGGTGGAAAGACAGGGTCTAGGG - Intronic
941920165 2:170842223-170842245 GGCAGGAACCACATGGACAAGGG - Intronic
942404601 2:175640868-175640890 AGCTGAAAGCTCATGGACTTTGG - Intergenic
945732983 2:213563913-213563935 ATGTGGAAAAACATGGAGTATGG + Intronic
1168862501 20:1055878-1055900 AGCTGTGAACAGTTGGACTAGGG - Intergenic
1168952112 20:1809641-1809663 AGATGGTGAGACATGGACTAAGG - Intergenic
1169551320 20:6704282-6704304 TGCTGCAACCACATGGAGTAGGG - Intergenic
1169988073 20:11469290-11469312 AGCTGGGCAGAAATGGACTATGG + Intergenic
1171207450 20:23292154-23292176 AGCTGAGAATACATGGACAAAGG + Intergenic
1176043691 20:63081544-63081566 ATGTGGACACACATGGACAAGGG + Intergenic
1178262803 21:31115760-31115782 TTCTGTAAACACATGGAGTATGG - Intergenic
1179907870 21:44433627-44433649 AGCTGGCAACACATGCAGCAAGG - Intronic
1180072864 21:45445477-45445499 AGGTGGAATCACTGGGACTATGG + Intronic
1182698045 22:32209520-32209542 AGTTGTAATCACATGGACTCAGG + Intergenic
1183120536 22:35727005-35727027 AGCTGGAAGCACCTGGAGGATGG + Exonic
1183581448 22:38728914-38728936 AGCTGGAAACATCTGGAGTTTGG - Intronic
1183814065 22:40284391-40284413 CCCTGGAATCACATGGATTAAGG - Intronic
1184274647 22:43403505-43403527 AGCTGGAAACATTTGGAGTAGGG + Intergenic
950510814 3:13425418-13425440 AGCTGGCAACACATGGTTTCTGG + Intergenic
951090036 3:18561733-18561755 ATCTGGAAACCAATGGATTAAGG + Intergenic
961917655 3:130393774-130393796 AGCCTGAAACAGCTGGACTAAGG + Intronic
962640744 3:137383540-137383562 AGCTGTGGACAGATGGACTATGG + Intergenic
962875812 3:139535399-139535421 AGCGGGAACCACATGTACAAAGG - Intronic
963668050 3:148215451-148215473 AGCAGGAGACACATGTATTAAGG - Intergenic
967426145 3:189329677-189329699 AGCTGGAGACACAAGCTCTAGGG + Intergenic
968066195 3:195761160-195761182 AGGTGGACACAGATGGAATAAGG - Intronic
969832810 4:9811470-9811492 AGATGGTAACACTTGGTCTAGGG + Intronic
970213630 4:13736210-13736232 TGCTACAAACACATGGACCATGG - Intergenic
972970462 4:44568649-44568671 AGCTGTAAACAGAAGCACTAGGG - Intergenic
977443387 4:97098791-97098813 AGGTGGGAAAACAGGGACTATGG - Intergenic
978401981 4:108340938-108340960 AGCTGCCAACAAATGGGCTAGGG + Intergenic
979794155 4:124824624-124824646 AGCTGAAAACAAATGGATTTAGG - Intergenic
982166821 4:152620883-152620905 AGTTGGAAAGACATGGAACAAGG + Exonic
982718410 4:158833774-158833796 AGATGGAAACACATAGAAGAGGG - Intronic
982947305 4:161640935-161640957 AGCTGCAAACAATTGTACTAAGG - Intronic
986268501 5:6211120-6211142 ACATGGAAACACATGGAGTGAGG + Intergenic
987692660 5:21287288-21287310 AGTTAGAAACAAATGAACTATGG + Intergenic
988522069 5:31955083-31955105 AGCTGGGAAGAAATGGACCAAGG + Intronic
990424219 5:55669853-55669875 AGCTGGAACTACATGGTCTGGGG + Exonic
991747695 5:69762759-69762781 AGTTAGAAACAAATGAACTATGG - Intergenic
991799273 5:70342613-70342635 AGTTAGAAACAAATGAACTATGG - Intergenic
991801607 5:70372370-70372392 AGTTAGAAACAAATGAACTATGG + Intergenic
991826989 5:70637656-70637678 AGTTAGAAACAAATGAACTATGG - Intergenic
991829324 5:70667423-70667445 AGTTAGAAACAAATGAACTATGG + Intergenic
991891632 5:71342040-71342062 AGTTAGAAACAAATGAACTATGG - Intergenic
994275730 5:97834808-97834830 AGCTGCAGACACATGGCATAGGG - Intergenic
994743498 5:103649941-103649963 AGTTGGAAACACATTTACAATGG - Intergenic
995577228 5:113551553-113551575 AGCTGAGAACACATGGACACAGG + Intronic
996889382 5:128399928-128399950 AGTAGGAAGCACAAGGACTATGG + Intronic
997643831 5:135467219-135467241 AGCTGTGAGCACATGGAGTAGGG + Intergenic
1000327323 5:160182184-160182206 AGCCGGAAGCACAGGGACCAGGG + Intergenic
1000724690 5:164754738-164754760 TGCTGGAAAGGCCTGGACTAGGG - Intergenic
1002704918 5:181154270-181154292 ACCTGGGATCACATGGACTTGGG - Intergenic
1003128398 6:3374382-3374404 AGAAGGAAACACATGGAGGATGG + Intronic
1003295497 6:4822714-4822736 AACTGAAAACACATGAAATAGGG - Intronic
1004822338 6:19381351-19381373 AGCTTGAAACCCATGGTCCAAGG + Intergenic
1006174134 6:32111699-32111721 AGCTGAAGACACAGGGACTGAGG - Intronic
1007177076 6:39904141-39904163 ACCTGGAAACAAAAGGACTATGG + Exonic
1012375815 6:98560352-98560374 TGCTGGAAAAACATAGACCAAGG + Intergenic
1015016756 6:128422836-128422858 AGTTTGAACCACATAGACTAGGG - Intronic
1017330719 6:153195283-153195305 AGCTGGAAAGAGATGTACTGAGG + Intergenic
1018367475 6:163136264-163136286 AGCAGAAAACACATGCACAAAGG - Intronic
1020242839 7:6409111-6409133 AGCTGTACACACAAGCACTATGG + Exonic
1020434663 7:8150147-8150169 TCCTGGAAACAAATGGACTTTGG + Intronic
1021873756 7:25029363-25029385 AGCTGGAAACCAAGGGACTCAGG + Intergenic
1022240736 7:28510159-28510181 AGCTGGAAAAACCTGGTCAAAGG - Intronic
1027166815 7:75840528-75840550 AGCTGGAAGCATCTGGATTAAGG - Intergenic
1027421511 7:78021402-78021424 AGCTTGAATCACATGCACTGAGG - Intronic
1027655413 7:80924311-80924333 AGCAGGAAACACATGGACTGTGG - Intergenic
1030594857 7:111525637-111525659 ATCTGGAAATAGATGGACAATGG + Intronic
1034385647 7:150738388-150738410 ACCTGGAAATACATGGGCTGGGG + Intronic
1041458127 8:58082072-58082094 AGCTGCGAGCACATGGGCTAGGG + Intronic
1041710758 8:60892302-60892324 AGCTGGAAAGCCATTGACTGAGG + Intergenic
1042978607 8:74500254-74500276 AGCTGGAAAATTATGGACCATGG + Intergenic
1045297320 8:100883190-100883212 AGCTGGAACCACAGGGAGAAGGG + Intergenic
1045476047 8:102553644-102553666 GGCTGGAAAGACCTGGACAAGGG - Intronic
1045923620 8:107562565-107562587 AGCAGGAAGCACAGGGAGTAGGG + Intergenic
1047560667 8:125984819-125984841 AGGTGGAAACTCAAGTACTAGGG + Intergenic
1048581580 8:135733476-135733498 CTCTGGAATCACATGGACTCAGG - Intergenic
1049068671 8:140339627-140339649 GGCTGGATGCACAAGGACTATGG - Intronic
1049129143 8:140821048-140821070 AGCTGGAAAGACAGGAGCTATGG + Intronic
1049162794 8:141108357-141108379 AGCAGGAGACACATGGACTCTGG + Intergenic
1050802271 9:9630097-9630119 ATATGGAAACACATGCATTAGGG + Intronic
1051907726 9:22115717-22115739 AGCTTGGATCACATGGACTTGGG + Intergenic
1057148137 9:92772336-92772358 ATCTGGAGTCACATGGACCAGGG - Intergenic
1058759026 9:108111854-108111876 ATCTGAAAACACTTGGACTTGGG + Intergenic
1059840724 9:118212594-118212616 AGGTGGAAACACTGGAACTAGGG + Intergenic
1060329746 9:122656325-122656347 AGCTCCCAACACATGGACTTTGG - Intergenic
1061267490 9:129515262-129515284 AGCTGGAAACCTCTGGACTGTGG - Intergenic
1187235695 X:17464969-17464991 AGCTGGCAATACATGGACACTGG + Intronic
1189536680 X:41942389-41942411 AGCTGCAAACACATGGCATTTGG - Intergenic
1192549430 X:72042213-72042235 TGCTGAAATCACAGGGACTAGGG - Intergenic
1192888116 X:75358968-75358990 ACCTGGTAATACATGGACAAGGG - Intergenic
1192963912 X:76157542-76157564 AGCTGGACCCACAAGTACTAGGG + Intergenic
1193331962 X:80244907-80244929 AGCTTCCAACACATGGACTTTGG - Intergenic
1194665999 X:96678253-96678275 AGCTGGTAAAGCATGGAGTAGGG - Intergenic
1194870061 X:99118577-99118599 AGCAAGAAACACATGGAGCATGG + Intergenic
1195449278 X:104992007-104992029 AGCAGGAAAAACATGTACTAAGG + Intronic
1195808244 X:108799780-108799802 AGCTGCAAACACCTTGACTTCGG + Intergenic
1198208697 X:134495291-134495313 AGTGAGAAACACATGGACTTGGG + Intronic
1198320570 X:135515448-135515470 AGGTGGAAACAAATGGTCCAAGG + Intergenic
1199540658 X:148954686-148954708 CTCTGGATACACATGGACCAGGG - Intronic
1201485922 Y:14494693-14494715 GGCTTAAAACACCTGGACTACGG + Intergenic
1202031536 Y:20579795-20579817 AAATGGAAACACAGGGACAACGG - Intronic