ID: 921046963

View in Genome Browser
Species Human (GRCh38)
Location 1:211484748-211484770
Sequence AGGTGGGAAGAGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7753
Summary {0: 1, 1: 2, 2: 33, 3: 624, 4: 7093}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921046963_921046969 -5 Left 921046963 1:211484748-211484770 CCTGCCTCCCTCTCTTCCCACCT 0: 1
1: 2
2: 33
3: 624
4: 7093
Right 921046969 1:211484766-211484788 CACCTCCGCTTCATCCCACATGG 0: 1
1: 0
2: 2
3: 15
4: 131
921046963_921046974 2 Left 921046963 1:211484748-211484770 CCTGCCTCCCTCTCTTCCCACCT 0: 1
1: 2
2: 33
3: 624
4: 7093
Right 921046974 1:211484773-211484795 GCTTCATCCCACATGGTAAGGGG 0: 1
1: 0
2: 1
3: 12
4: 103
921046963_921046978 21 Left 921046963 1:211484748-211484770 CCTGCCTCCCTCTCTTCCCACCT 0: 1
1: 2
2: 33
3: 624
4: 7093
Right 921046978 1:211484792-211484814 GGGGCCTTGCAAACACGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 67
921046963_921046972 0 Left 921046963 1:211484748-211484770 CCTGCCTCCCTCTCTTCCCACCT 0: 1
1: 2
2: 33
3: 624
4: 7093
Right 921046972 1:211484771-211484793 CCGCTTCATCCCACATGGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 61
921046963_921046979 22 Left 921046963 1:211484748-211484770 CCTGCCTCCCTCTCTTCCCACCT 0: 1
1: 2
2: 33
3: 624
4: 7093
Right 921046979 1:211484793-211484815 GGGCCTTGCAAACACGTGTGGGG 0: 1
1: 0
2: 1
3: 11
4: 92
921046963_921046977 20 Left 921046963 1:211484748-211484770 CCTGCCTCCCTCTCTTCCCACCT 0: 1
1: 2
2: 33
3: 624
4: 7093
Right 921046977 1:211484791-211484813 AGGGGCCTTGCAAACACGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 87
921046963_921046973 1 Left 921046963 1:211484748-211484770 CCTGCCTCCCTCTCTTCCCACCT 0: 1
1: 2
2: 33
3: 624
4: 7093
Right 921046973 1:211484772-211484794 CGCTTCATCCCACATGGTAAGGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921046963 Original CRISPR AGGTGGGAAGAGAGGGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr