ID: 921052145

View in Genome Browser
Species Human (GRCh38)
Location 1:211518299-211518321
Sequence GTATGCCCAGAGGCTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921052145_921052149 -4 Left 921052145 1:211518299-211518321 CCAAGCTCAGCCTCTGGGCATAC No data
Right 921052149 1:211518318-211518340 ATACCATGTTTGGAGCCCAAGGG No data
921052145_921052153 16 Left 921052145 1:211518299-211518321 CCAAGCTCAGCCTCTGGGCATAC No data
Right 921052153 1:211518338-211518360 GGGCAGTTTTCCATGCAACGAGG No data
921052145_921052148 -5 Left 921052145 1:211518299-211518321 CCAAGCTCAGCCTCTGGGCATAC No data
Right 921052148 1:211518317-211518339 CATACCATGTTTGGAGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921052145 Original CRISPR GTATGCCCAGAGGCTGAGCT TGG (reversed) Intergenic
No off target data available for this crispr