ID: 921052145 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:211518299-211518321 |
| Sequence | GTATGCCCAGAGGCTGAGCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921052145_921052149 | -4 | Left | 921052145 | 1:211518299-211518321 | CCAAGCTCAGCCTCTGGGCATAC | No data | ||
| Right | 921052149 | 1:211518318-211518340 | ATACCATGTTTGGAGCCCAAGGG | No data | ||||
| 921052145_921052153 | 16 | Left | 921052145 | 1:211518299-211518321 | CCAAGCTCAGCCTCTGGGCATAC | No data | ||
| Right | 921052153 | 1:211518338-211518360 | GGGCAGTTTTCCATGCAACGAGG | No data | ||||
| 921052145_921052148 | -5 | Left | 921052145 | 1:211518299-211518321 | CCAAGCTCAGCCTCTGGGCATAC | No data | ||
| Right | 921052148 | 1:211518317-211518339 | CATACCATGTTTGGAGCCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921052145 | Original CRISPR | GTATGCCCAGAGGCTGAGCT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||