ID: 921062965

View in Genome Browser
Species Human (GRCh38)
Location 1:211601416-211601438
Sequence AACTCAAATGTCCCTCGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921062965_921062968 -8 Left 921062965 1:211601416-211601438 CCCAACCGAGGGACATTTGAGTT No data
Right 921062968 1:211601431-211601453 TTTGAGTTGTTTCCAGCTTTTGG 0: 7
1: 95
2: 707
3: 2171
4: 4449
921062965_921062970 24 Left 921062965 1:211601416-211601438 CCCAACCGAGGGACATTTGAGTT No data
Right 921062970 1:211601463-211601485 ATAAAGCTGCTATAAATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921062965 Original CRISPR AACTCAAATGTCCCTCGGTT GGG (reversed) Intergenic
No off target data available for this crispr