ID: 921065961

View in Genome Browser
Species Human (GRCh38)
Location 1:211621997-211622019
Sequence CCCAGTGGGGTCCCCGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921065948_921065961 2 Left 921065948 1:211621972-211621994 CCCAATTTTAACCAGTCCAGCCC No data
Right 921065961 1:211621997-211622019 CCCAGTGGGGTCCCCGGGTCTGG No data
921065949_921065961 1 Left 921065949 1:211621973-211621995 CCAATTTTAACCAGTCCAGCCCT No data
Right 921065961 1:211621997-211622019 CCCAGTGGGGTCCCCGGGTCTGG No data
921065951_921065961 -9 Left 921065951 1:211621983-211622005 CCAGTCCAGCCCTCCCCAGTGGG No data
Right 921065961 1:211621997-211622019 CCCAGTGGGGTCCCCGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921065961 Original CRISPR CCCAGTGGGGTCCCCGGGTC TGG Intergenic
No off target data available for this crispr