ID: 921066182

View in Genome Browser
Species Human (GRCh38)
Location 1:211623627-211623649
Sequence AATGGAAAGCCCCATGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921066179_921066182 22 Left 921066179 1:211623582-211623604 CCAATGCTCAGCAAATCTGATCT No data
Right 921066182 1:211623627-211623649 AATGGAAAGCCCCATGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921066182 Original CRISPR AATGGAAAGCCCCATGAGGA CGG Intergenic
No off target data available for this crispr