ID: 921067512

View in Genome Browser
Species Human (GRCh38)
Location 1:211633124-211633146
Sequence GTCCCGGAGGAAGACAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921067495_921067512 17 Left 921067495 1:211633084-211633106 CCATCTCTCCCACCCCACCCAGA No data
Right 921067512 1:211633124-211633146 GTCCCGGAGGAAGACAGTGAGGG No data
921067498_921067512 9 Left 921067498 1:211633092-211633114 CCCACCCCACCCAGAGGGAGCCA No data
Right 921067512 1:211633124-211633146 GTCCCGGAGGAAGACAGTGAGGG No data
921067504_921067512 0 Left 921067504 1:211633101-211633123 CCCAGAGGGAGCCATGTGGCCTG No data
Right 921067512 1:211633124-211633146 GTCCCGGAGGAAGACAGTGAGGG No data
921067505_921067512 -1 Left 921067505 1:211633102-211633124 CCAGAGGGAGCCATGTGGCCTGG No data
Right 921067512 1:211633124-211633146 GTCCCGGAGGAAGACAGTGAGGG No data
921067501_921067512 4 Left 921067501 1:211633097-211633119 CCCACCCAGAGGGAGCCATGTGG No data
Right 921067512 1:211633124-211633146 GTCCCGGAGGAAGACAGTGAGGG No data
921067499_921067512 8 Left 921067499 1:211633093-211633115 CCACCCCACCCAGAGGGAGCCAT No data
Right 921067512 1:211633124-211633146 GTCCCGGAGGAAGACAGTGAGGG No data
921067503_921067512 3 Left 921067503 1:211633098-211633120 CCACCCAGAGGGAGCCATGTGGC No data
Right 921067512 1:211633124-211633146 GTCCCGGAGGAAGACAGTGAGGG No data
921067500_921067512 5 Left 921067500 1:211633096-211633118 CCCCACCCAGAGGGAGCCATGTG No data
Right 921067512 1:211633124-211633146 GTCCCGGAGGAAGACAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921067512 Original CRISPR GTCCCGGAGGAAGACAGTGA GGG Intergenic
No off target data available for this crispr